International Immunology, Vol. 13, No. 5, 607-613,
May 2001
© 2001 Japanese Society for Immunology
Antigen-specific Th1 cells as direct effectors of Propionibacterium acnes-primed lipopolysaccharide-induced hepatic injury
1 Takasago Research Laboratories, Kaneka Corp., Takasago, Hyogo 676-8688, Japan
Department of Medicine and Clinical Science, Kyoto University Graduate School of Medicine, 54 Shogoin-kawahara-cho, Sakyo-ku, Kyoto 606-8507, Japan
Correspondence to: S. Ozaki, Department of Rheumatic and Allergic Diseases, St Marianna University School of Medicine, Sugao, Miyamae-ku, Kawasaki 216-8512, Japan
| Abstract |
|---|
|
|
|---|
Th1 cells are cytotoxic effector cells that utilize Fas ligand (FasL) and tumor necrosis factor. The physiological roles of cytotoxic Th1 cells are considered to be immunoregulation by eliminating autoreactive lymphocytes or hyper-activated foreign antigen-specific lymphocytes. Their pathological roles, however, remain to be clarified. To investigate whether Th1 cells can destroy organs, we generated a Propionibacterium acnes-specific Th1 clone from C57BL/6 mice and tested whether the clone could serve as an effector in a P. acnes-primed lipopolysaccharide (LPS)-induced hepatic injury system, one of the septic shock models. B6Smn.C3H-FasLgld (B6-gld) mice, which were deficient in functional FasL, were resistant to P. acnes/LPS-induced hepatic shock. The Th1 clone rendered B6-gld mice sensitive to the hepatic shock after the i.v. transfer. The hepatic injury in the clone-transferred B6-gld mice, which was evaluated by both biochemical and histological examination, was inhibited by an anti-FasL mAb that we developed. These results suggested that bacterial antigen-specific Th1 cells like this clone can participate in organ destruction in vivo as one of the cytotoxic effectors and play a critical role in endotoxin-induced hepatic injury.
Keywords: cytotoxicity, endotoxin shock, lipopolysaccharide rodent, Th1/Th2
| Introduction |
|---|
|
|
|---|
CD4+ T cells are generally divided into two categories, Th1 and Th2 cells, based on their cytokine expression patterns and functions (1). Th1 cells have been recently recognized as cytotoxic T lymphocytes (CTL), and their physiological functions and interactions have been elucidated. Since the first report of CD4+ T cell-mediated cytotoxicity by Tite et al. in 1984 (2), tumor necrosis factor (TNF)- and Fas ligand (FasL)-mediated pathways in the mechanism of cytotoxicity have been elucidated (35). The latter pathway by antigen-specific Th1 cells is involved in the peripheral deletion of CD4+ T cells, and the elimination of autoreactive and bystander B cells (6). However, the pathological contribution of Th1-mediated cytotoxicity in vivo has not been reported.
FasL-mediated pathological mechanisms have been reported in murine models of hepatitis, autoimmune diabetes and Propionibacterium acnes-primed lipopolysaccharide (LPS)-induced hepatic shock (7,8). In the former two models, hepatitis B virus-specific CD8+ T cells and islet cell-specific CD8+ T cells were demonstrated to be effector cells. The latter model was first reported by Ferluga et al. in 1978 (9). In this model, mice are primed with killed P. acnes i.v. on day 0 and challenged by a small amount of LPS i.v. on day 7. Within 24 h, hepatocytes are injured, followed by shock (9,10). TNF-
and FasL have been reported as the effector molecules in this model (7,11,12). Although the significance of Th1 cells was speculated in this model (13,14), direct evidence of Th1 cells being in vivo effector cells remains to be demonstrated.
In the present study, we established a P. acnes-specific Th1 clone, B11, from C57BL/6 mice and adoptively transferred those cells into B6Smn.C3H-FasLgld (B6-gld) mice, which lacked functional FasL and were resistant to the P. acnes/LPS-induced hepatic injury. Our results indicated that the transfer of B11 cells rendered B6-gld mice sensitive to the hepatic injury and that the injury was inhibited by anti-FasL mAb that we developed. Our findings suggest that Th1 cells are one of the cytotoxic effectors for organ destruction, mainly through the FasLFas pathway, in this endotoxin shock model.
| Methods |
|---|
|
|
|---|
Animals
Male C57BL/6 mice, 58 weeks old, were obtained from SLC (Shizuoka, Japan). B6-gld mice were purchased from the Jackson Laboratory (Bar harbor, ME) and maintained under specific pathogen-free conditions at SLC.
Antigens
P. acnes (ATCC11827) was grown in brain heart infusion medium supplemented with L-cysteine (0.03%) and Tween 80 (0.03%) with oxylase (Oxylase, Mansfield, OH) by standing culture for 4 days. The bacterial cells were harvested and washed 3 times with physiological saline by centrifugation at 5500 g for 15 min. They were then resuspended in physiological saline, autoclaved and sonicated. Then, they were stored at 80°C until use.
Establishment of P. acnes-specific CD4+ T cell line and clone
Eight-week-old C57BL/6 mice were immunized by s.c. injection of 100 µg of P. acnes emulsified with complete Freund's adjuvant (H37Ra; Sigma, St Louis, MO). Ten days after immunization, draining lymph nodes were removed and cultured in single-cell suspensions with 10 µg/ml P. acnes. A P. acnes-specific T cell line, PB1, was obtained by repeating the cycle of stimulation and resting (15). The P. acnes-specific CD4+ T cell clone, B11, was established from PB1 by the limiting dilution (0.4 cell/well) method as described previously (15).
Generation of FasL transfectant
Murine FasL (mFasL) cDNA was prepared by RT-PCR from total RNA of the activated murine Th1 hybridoma clone A3.4C6 (16) using modified oligonucleotide primers (ATTGAATTCCATGGAGCAGCAGCCCATGAATTACCC at the 5' end and CCGAACATATTCGAAATTATCTTAAGAG at the 3' end) designed to the published sequence (17). After EcoRI digestion, the PCR product was subcloned into pUC19. The mFasL cDNA was then transferred into the pMKITNeo expression vector (kindly provided by K. Maruyama, Tokyo Medical and Dental University, Tokyo). For generation of stable transfectants, mFasL/pMKITNeo was transfected into WR19L (kindly provided by Dr S. Nagata, Osaka University Medical School) and CHO-K1 cells by electroporation using SSH-2 (Shimazu, Kyoto, Japan). After selection with G418 and limiting dilution, both transfectants of mFasL/WR19L (WEL1) and mFasL/CHO-K1 (CHO-FasL) were obtained.
Generation of anti-mFasL mAb
Five-week-old male Armenian hamsters were immunized by i.p. injection of CHO-FasL (2x107 cells) several times at 2 week intervals. Three days after the final immunization, the splenocytes were fused with SP2/O murine myeloma cells. After hypoxanthineaminopterinthymidine selection, hybridomas were screened by FACS for antibodies capable of binding to WEL1 transfectant cells but not to wild-type WR19L cells. One hybridoma (2A10) was identified and cloned.
Proliferation assay
Samples containing 2x104 T cells were cultured in round-bottomed 96-well plates (no. 3595; Costar, Corning, NY) for 4 days with the antigen and 5x105 mitomycin C-treated C57BL/6 spleen cells. During the final 24 h of culture, 37 kBq [methyl-3H]thymidine was added. The cells were harvested and proliferation was estimated by scintillation counting of [methyl-3H]thymidine (c.p.m.) incorporation into DNA. Values were expressed as means ± SEM of triplicate determinations.
Cytotoxicity assay
A 51Cr-release assay was carried out in round-bottomed 96-well plates (no. 3799; Costar), as previously described (18). To determine spontaneous and maximum release, the target cells were incubated with the same volume of complete medium alone and with 0.1 M HCl solution alone, respectively. The percent specific lysis was calculated as [(experimental release spontaneous release)/(maximum release spontaneous release)]x100. Each sample was tested in triplicates.
Cytokine profile of cloned T cells
Total cellular RNA was prepared from 2x106 T cells stimulated by the plastic-coated 2C11 for 4 h, using a RNeasy Mini kit (Qiagen, Germany). RNA was then primed at 70°C using oligo(dT) (1218) (Gibco/BRL, Rockville, MD) and reverse transcribed at 42°C with 200 U of Superscript RT (Gibco/BRL) in a final volume of 20 µl. The reaction was terminated by heating to 70°C for 15 min. Aliquots of 2.5 µl of cDNA were then used for subsequent PCR. PCR was carried out using 5 U AmpliTaq Gold (Applied Biosystems, Foster City, CA) in reaction mixtures containing 5 µl 10xPCR buffer, 3.3 mM MgCl2, 4 µl dNTP mix (25 mM), 150 pmol each primer and 2.5 µl cDNA in a final volume of 50 µl. PCR primers were purchased from Takara (Tokyo, Japan). PCR primer sequences were as follows: ß-actin 5' primer, GTG GGC CGC TCT AGG CAC CA, 3' primer, GTT GGC CTT AGG GTT CAG GGG G; IFN-
5' primer, CCT CAG ACT CTT TGA AGT CT, 3' primer, CAG CGA CTC CTT TTC CGC TT; IL-4 5' primer, CAC TTG AGA GAG AGA TCA TCG G, 3' primer, GGC TTT CCA GGA AGT CTT TCA; TNF-
5' primer, ATG AGC ACA GAA AGC ATG ATC CGC, 3' primer, AAA GTA GAC CTG CCC GGA CTC; TNF-ß 5' primer, TGA CAC TGC TCG GCC GTC TCC A, 3' primer, GTT GCT CAA AGA GAA GCC ATG TCG; Perforin 5' primer, GCC ACG ACC TGT CCC TGC, 3' primer, TTG GTT CCC GAA GAG C; FasL 5' primer, CTG GAA TGG GAA GAC ACA TA, 3' primer, AAA GGT CTT AGA TTC CTC AA.
Flow cytometry
Cells were stained with FITC-conjugated anti-CD8 mAb (YTS169.4), anti-Thy1.2 mAb (5a-8), anti-TCR
mAb (GL-3), phycoerythrin-conjugated anti-CD4 mAb (GK1.5), anti-B220 mAb (RA-6B2) or anti-TCR
ß mAb (H57-597) purchased from Caltag (South San Francisco, CA). FITC-conjugated anti-CD3
mAb (1452C11) and phycoerythrin-conjugated anti-NK1.1 mAb (PK136) were purchased from PharMingen (San Diego, CA). The cells were incubated with directly conjugated antibodies for 20 min at 4°C in PBS containing 1% FCS and 0.1% sodium azide, and then washed and analyzed on a FACSCalibur (Becton Dickinson Immunocytometry Systems, Mountain View, CA). When unconjugated antibodies were used, a further incubation step was performed with secondary antibodies under the same conditions before analysis.
Induction of hepatic injury by P. acnes and LPS
Hepatic injury was induced in mice according to the method described elsewhere (10). To induce standard hepatic injury, the mice were treated by i.v. injection of heat-killed P. acnes (5 mg/mouse) suspended in 100 µl of saline. Then, the mice were given an i.v. injection of LPS (Salmonella enteriditis; Sigma) dissolved in 100 µl saline 7 days later. Injury to the liver was confirmed by measuring serum alanine aminotransferase (ALT) activity in mice 12 h after LPS injection. ALT activity was determined using a Quickauto II (Sinotest, Tokyo, Japan).
Adoptive transfer
A P. acnes-specific Th1 clone, B11, and CD4+ T cells purified by passage through a CD4 T cell isolation column (Pierce, Rockford, IL) were used in the adoptive transfer experiments. The purity of CD4+ T cells was >95% in this positive selection system. Indicated amounts of these cells were suspended in 100 µl of saline and i.v. transferred.
Histological studies
P. acnes-primed B6-gld mice, with or without cell transfer, were sacrificed 12 h after LPS injection. The livers were fixed in 10% formalin and embedded in paraffin. Individual sections were examined after staining with hematoxylin & eosin.
| Results |
|---|
|
|
|---|
Inhibition of P. acnes/LPS-induced hepatic injury of C57BL/6 mice by anti-FasL mAb
C57BL/6 mice were primed by i.v. injection of P. acnes on day 0 and challenged by i.v. injection with LPS (10 µg/mouse) on day 7. After 12 h, serum aminotransferase levels of each mouse were measured to estimate the severity of hepatic injury. The serum aminotransferase level of P. acnes-primed LPS-induced C57BL/6 mice was significantly increased as compared to baseline controls. The i.p. injection of anti-FasL mAb (2A10) at 2 h before the LPS injection inhibited the hepatic injury in a dose-dependent manner (Fig. 1
|
Establishment and characterization of P. acnes-specific Th 1 clone, B11
FasL is a strongly cytotoxic molecule, which is mainly distributed in CTL and Th1 cells (19), and is associated with immune privilege site (20,21). As this hepatic injury system requires priming with P. acnes 1 week before LPS challenge and because the primed P. acnes was distributed into the reticuloendothelial system in the liver (22), we hypothesized that P. acnes might act as an antigen to induce antigen-specific CD4+ T cells and that specific Th1 cells might play a pivotal role as effector cells. To confirm this hypothesis, the P. acnes-specific CD4+ T cell clone B11 was established from C57BL/6 mice by conventional methods (15). The clone B11 proliferated in a dose-dependent manner (Fig. 2
mAb. As shown in Fig. 3
and FasL, but did not express IL-4 or perforin. The surface markers of B11 were analyzed by FACS analysis. The clone expressed CD3, CD4, TCR
ß, but did not express CD8, TCR
, NK1.1 or B220 (Fig. 4
mAb and A20.2J cells (18) killed the target cells, and this cytotoxicity was inhibited by the anti-FasL mAb 2A10 in a dose-dependent fashion (Fig. 5
|
|
|
|
Hepatic injury in B6-gld mice induced by the adoptive transfer of the Th 1 clone
To examine the in vivo cytotoxicity via FasL, we transferred the Th1 clone into P. acnes-primed B6-gld mice and challenged with LPS. B6-gld mice have a non-functional FasL caused by a point mutation (17). As shown in Table 1
|
To further investigate whether P. acnes-specific Th1 cells play a more crucial role as effectors than non-specific CD4+ T cells, we purified CD4+ T cells from spleen cells of naive C57BL/6 mice. The adoptive transfer of these CD4+ T cells or cloned B11 cells was performed on the day before LPS challenge. As shown in Table 1
|
| Discussion |
|---|
|
|
|---|
To investigate the cytotoxic effects of antigen-specific Th1 cells in vivo, we used B6-gld mice as recipients which were functionally deficient in FasL by virtue of a point mutation (17). The hepatic injury induced by priming with P. acnes and challenge with LPS in B6-gld mice was much weaker than that in wild-type C57BL/6 mice. To confirm whether Th1-mediated cytotoxicity could directly contribute to organ destruction, we established the P. acnes-specific Th1 clone B11 from FasL+ C57BL/6 mice and transferred the cloned cells into the FasL-deficient syngeneic mice. The transfer of B11 into B6-gld mice resulted in marked hepatic injury following LPS challenge, which was blocked by anti-FasL mAb. These results suggested that the B11-induced hepatic injury was mainly caused by the FasLFas system. Moreover, the hepatic injury in B6-gld mice caused by the transfer of B11 was severer than that induced by non-specific CD4+ T cells purified from C57BL/6 mice, which was demonstrated both in serum aminotransferase analysis and histological examination. These results indicated that the P. acnes-specific Th1 cells play a pivotal role as direct effector cells in the P. acnes-primed LPS-induced hepatic injury model.
Ferluga et al. first reported the P. acnes-primed LPS-induced hepatic shock model in mice in 1978 (9). Since then, many investigators have tried to explain the mechanism of the model (11,13,2224), but the effector cells have not been identified. In 1997, Kondo et al. reported that the FasLFas pathway plays a pivotal role in the destruction of hepatocytes in this model (7), but the nature of the direct effector cells for the destruction of hepatocytes in this model has not been elucidated. Kaufmann et al. reported that i.v. injected P. acnes was distributed mainly in the liver and spleen in humans (25). Multiple small granulomatous lesions were detected in macroscopic liver specimens from P. acnes-injected mice (9). Matsui et al. reported that the Th1 response was augmented in mice by priming with P. acnes (14). We observed that an antigen-specific CD4+ CTL was elicited by immunization of mice with some bacterial antigen, including P. acnes and bacillus Calmette-Guerin (26). Moreover, P. acnes-primed LPS-induced hepatic injury can be inhibited by antibodies against IL-18, which is produced by LPS-stimulated macrophages (10) and promotes the killing by Th1 cells (27). Taken together, these previous and present observations brought us the idea that primed P. acnes is mainly distributed into the liver where antigen processing and presentation to specific Th1 cells occur, that these cells act as the main effector cells in LPS-induced hepatic injury, and that effector cells including Th1 cells in the liver can be stimulated by LPS-induced cytokines such as IL-18 to destroy hepatocytes. The same scenario was demonstrated in recent reports, in which mice were primed with ovalbumin (OVA)-containing liposomes and adoptively transferred with OVA-specific Th1 cells (28) or mice were injected with hepatitis B virus surface antigen (HBsAg) and HBsAg-specific Th1 cells (29) to induce hepatic injury. In these elegant transfer systems, TNF-
rather than FasL was reported to be the major effector molecule (28,29). The discrepancy may be due to the difference in antigens, Th1 cells and recipient animals examined.
FasL and TNF have been suggested to be the major cytotoxic molecules involved in the mechanism of the CD4+ T cell (Th1)-mediated cytotoxicity (35). However, the physiological and pathological roles of cytotoxic Th1 cells in vivo are poorly understood. Th1 cells are considered to participate in immunoregulation, allograft rejection and target-organ destruction in vivo. Rathmell et al. reported the mechanism of peripheral clonal proliferation of foreign antigen-specific B cells and clonal deletion of autoantigen-specific B cells by Th1 cells (6). In the allograft skin transplantation system using nude mice as recipients, adoptively transferred CD4+ lymphocytes from CD8-deficient mice were sufficient to mediate the rejection of skin grafts. In this experiment, however, direct cytotoxicity of Th1 cells was not confirmed (30). In non-obese diabetic (NOD) mice, diabetes was accelerated by transfer of islet-reactive Th1 cells (31). Fas-deficient NOD mice did not develop the disease (8). In chronic thyroiditis, a fratricidal mechanism of action among thyrocytes bearing FasL was reported by Giordano et al. (32). These previous studies, however, provided no direct evidence of the pathological role of Th1 cells as cytotoxic effectors upon islet cells or thyrocytes in vivo. In the present study, the only FasL+ effector cells in the adoptive-transfer system were the Th1 clone B11. Thus, together with the OVA/Th1 (28) and the HBsAg/Th1 (29) systems, the P. acnes /Th1 system is also a model that can demonstrate the pathological contribution of Th1 cells to organ destruction. However, the role of other effector cells such as CD8+ or NK cells also remains to be clarified in this model.
The induction of hepatic injury in B6-gld mice by transfer of the Th1 clone B11 in our study suggested that bacterial antigen-specific Th1 cells such as B11 might play a pivotal role in endotoxin-induced septic shock, although B11 is not necessarily the faithful representative of every Th1 clone. Ferluga reported that the LPS injection subsequent to the priming of bacillus Calmette-Guerin provoked the same hepatic injury in mice (33). Thus, our transfer model of the bacterial antigen-specific Th1 clone may also explain the septic shock caused by systemic bacterial infection. Moreover, our findings suggested that the organ-specific invasion of Th1 cells may be responsible for the target-organ destruction in some autoimmune diseases.
| Acknowledgments |
|---|
We thank Dr Jay A. Berzofsky (NCI, NIH, Bethesda, MD) and Dr Nagahiro Minato (Kyoto University, Japan) for critical reading of the manuscript, and Dr K. Fujii (Kaneka Co., Takasago Research Laboratories, Japan) for technical support in culturing P. acnes.
| Abbreviations |
|---|
| ALT alanine aminotransferase |
| B6-gld B6Smn.C3H-FasLgld |
| FasL Fas ligand |
| HBsAg hepatitis B virus surface antigen |
| LPS lipopolysaccharide |
| mFasL murine FasL |
| NOD non-obese diabetic |
| OVA ovalbumin |
| TNF tumor necrosis factor |
| Notes |
|---|
2 Present address: Molecular Immunogenetics and Vaccine Research Section, Metabolism Branch, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892-1578, USA
3 Present address: Department of Rheumatic and Allergic Diseases, St Marianna University School of Medicine, Sugao, Miyamae-ku, Kawasaki 216-8512, Japan ![]()
Transmitting editor: S. Nagata
Received 18 September 2000, accepted 23 January 2001.
| References |
|---|
|
|
|---|
- Abbas, A. K., Murphy, K. M. and Sher, A. 1996. Functional diversity of helper T lymphocytes. Nature 383:787.[Medline]
- Tite, J. P. and Janeway, C. A., Jr. 1984. Cloned helper T cells can kill B lymphoma cells in the presence of specific antigen: Ia restriction and cognate vs. noncognate interactions in cytolysis. Eur. J. Immunol. 14:878.[ISI][Medline]
- Ju, S. T., Ruddle, N. H., Strack, P., Dorf, M. E. and DeKruyff, R. H. 1990. Expression of two distinct cytolytic mechanisms among CD4 subsets. J. Immunol. 144:23.[Abstract]
-
Ju, S. T., Cui, H., Panka, D. J., Ettinger, R. and Marshak, R. A. 1994. Participation of target Fas protein in apoptosis pathway induced by CD4+ Th1 and CD8+ cytotoxic T cells. Proc. Natl Acad. Sci. USA 91:4185.
[Abstract/Free Full Text] -
Hanabuchi, S., Koyanagi, M., Kawasaki, A., Shinohara, N., Matsuzawa, A., Nishimura, Y., Kobayashi, Y., Yonehara, S., Yagita, H. and Okumura, K. 1994. Fas and its ligand in a general mechanism of T-cell mediated cytotoxicity. Proc. Natl Acad. Sci. USA 91:4930.
[Abstract/Free Full Text] - Rathmell, J. C., Townsend, S. E., Xu, J. C., Flavell, R. A. and Goodnow, C. C. 1996. Expansion or elimination of B cells in vivo: dual roles for CD40- and Fas(CD95)-ligands modulated by the B cell antigen receptor. Cell 87:319.[ISI][Medline]
- Kondo, T., Suda, T., Fukuyama, H., Adachi, M. and Nagata, S. 1997. Essential roles of the Fas ligand in the development of hepatitis. Nat. Med. 3:409.[ISI][Medline]
- Chervonsky, A. V., Wang, Y., Wong, F. S., Visintin, I., Flavel, R. A., Janeway, C. A. and Matis, L. A. 1997. The role of Fas in autoimmune diabetes. Cell 89:17.[ISI][Medline]
- Ferluga, J. and Allison, A. C. 1978. Role of mononuclear infiltrating cells in pathogenesis of hepatitis. Lancet i:610.
-
Okamura, H., Tsutsui, H., Komatsu, T., Yutsudo, M., Hakura, A. Tanimoto, T., Torigoe, K., Okura, T., Nukada, Y., Hattori, K. and Kurimoto, M. 1995. Cloning of a new cytokine that induces IFN-
production by T cells. Nature 378:88.[Medline]
-
Tsutsui, H., Nakanishi, K., Matsui, K., Hashimoto, K., Okamura, H., Miyazawa, Y. and Kaneda, K. 1996. IFN-
-inducing factor up-regulates Fas ligand-mediated cytotoxic activity of murine natural killer cell clones. J. Immunol. 157:3967.[Abstract]
- Smith, S. R., Calzetta, A., Bannkovsky, J., Kenworthy-Bott, L. and Terminelli, C. 1993. Lipopolysaccharide-induced cytokine production and mortality in mice treated Corynebacterium paruvum. J. Leuk. Biol. 54:23.[Abstract]
- Tanaka, Y., Takahashi, A., Kobayashi, K., Arai, I., Higuchi, S., Otomo, S., Watanabe, K., Habu, S. and Nishimura, T. 1995. Establishment of a T cell-dependent nude mouse liver injury model induced by Propionibacterium acnes and LPS. J. Immunol. Methods 182:21.[ISI][Medline]
- Matsui, K., Yoshimoto, T., Tsutsui, H., Hyodo, Y., Hayashi, N., Hiroishi, K., Kawada, N., Okamura, H., Nakanishi, K. and Higashino, K. 1997. Propionibacterium acnes treatment diminishes CD4+ NK1.1+ T cells but induces type 1 T cells in the liver by induction of IL-12 and IL-18 production from Kupffer cells. J. Immunol. 159:97.[Abstract]
- Ozaki, S., York-Jolley, J., Kawamura, H. and Berzofsky, J. A. 1987. Cloned protein antigen-specific, Ia-restricted T cells with both helper and cytolytic activities: mechanism of activation and killing. Cell. Immunol. 105:301.[ISI][Medline]
- Ozaki, S., Durum, S. K., Muegge, K., York-Jolley, J. and Berzofsky, J. A. 1988. Production of TT hybrids from T cell clones. Direct comparison between cloned T cells and T hybridoma cells derived from them. J. Immunol. 141:71.[Abstract]
- Takahashi, T., Tanaka, M., Brannan, C. I., Jenkins, N. A., Copeland, N. G., Suda, T. and Nagata, S. 1994. Generalized lympho- proliferative disease in mice caused by a point mutation in the Fas ligand. Cell 76:969.[ISI][Medline]
- Okazaki, T., Ozaki, S. and Nakao, K. 1994. CD4+ T cells require adhesion via LFA-1/ICAM-1 to induce target apoptosis in TNF-independent pathway. Cell. Immunol. 156:135.[ISI][Medline]
- Suda, T., Okazaki, T., Naito, Y., Yokota, T., Arai, N., Ozaki, S., Kazuwa, N. and Nagata, S. 1995. Expression of the Fas ligand in cells of T cell lineage. J. Immunol. 154:3806.[Abstract]
- Bellgrau, D., Gold, D., Selawry, H., Moore, J., Franzusoff, A. and Duke, R. C. 1995. A role for CD95 ligand in preventing graft rejection. Nature 377:630.[Medline]
-
Griffith, T. S., Brunner, T., Fletcher, S. M., Green, D. R. and Ferguson, T. A. 1995. Fas ligand-induced apoptosis as a mechanism of immune privilege. Science 270:1189.
[Abstract/Free Full Text] - Tsutsui, H., Mizoguchi, Y. and Morisawa, S. 1992. Importance of direct hepatocytolysis by liver macrophages in experimental fulminant hepatitis. Hepatogastroenterology 39:553.[Medline]
- Harbrecht, B. G., Billiar, T. R., Stadler, J., Demetris, J., Ochoa, J., Curran, R. D. and Simmons, R. L, 1992. Inhibition of nitric oxide synthesis during endotoxemia promotes intrahepatic thrombosis and an oxygen radical-mediated hepatic injury, 1992. J. Leuk. Biol. 52:390.[Abstract]
- Tanaka, Y., Kobayashi, K., Takahashi, A., Arai, I., Higuchi, S., Otomo, S., Habu, S. and Nishimura, T. 1993. Inhibition of inflammatory liver injury by a monoclonal antibody against lymphocyte function-associated antigen-1. J. Immunol. 151:5088.[Abstract]
- Kaufmann, M., Marqverson, J., Stanley, K. E., Mouritzen, C. and Hvid, H. H. 1986. Distribution of intrapleural and intravenous Corynebacterium parvum in humans; 99mTc-, and 131I-labeled bacteria. Cancer Immunol. Immunother. 22:56.[ISI][Medline]
- Ozaki, S., Okazaki, T. and Nakao, K. 1995. Biological response modifiers (BRM) as antigens III. T cell lines specific for BRM kill tumor cells in a BRM-specific manner. Cancer Immumol. Immunother. 40:219.
- Dao, T., Ohashi, K., Kayano, T., Kurimoto, M. and Okamura, H. 1996. Interferon-gamma-inducing factor, a novel cytokine, enhances Fas ligand-mediated cytotoxicity of murine T helper 1 cells. Cell. Immunol. 173:230.[ISI][Medline]
-
Nishimura, T. and Ohta, A. 1999. A critical role for antigen-specific Th1 cells in acute liver injury in mice. J. Immunol. 162:6503.
[Abstract/Free Full Text] -
Ohta, A., Sekimoto, M., Sato, M., Koda, T., Nishimura, S., Iwakura, Y., Sekikawa K. and Nishimura, T. 2000. Indispensable role for TNF-
and IFN-
at the effector phase of liver injury mediated by Th1 cells specific to hepatitis B virus surface antigen. J. Immunol. 165:956.[Abstract/Free Full Text] - Dalloul, A. H., Chmouzies, E., Ngo, K. and Fung-Leung, W. P. 1996. Adoptively transferred CD4+ lymphocytes from CD8/ mice are sufficient to mediate the rejection of MHC class II or class I disparate skingrafts. J. Immunol. 156:4114.[Abstract]
-
Katz, J., Benoist, C. and Mathis, D. 1995. T helper subsets in insulin-dependent diabetes. Science 268:1185.
[Abstract/Free Full Text] -
Giordano, C., Stassi, G., DeMaria, R., Todaro, M., Richiusa, P., Papoff, G., Ruberti, G., Bagnasco, M., Testi, R. and Galluzzo, A. 1997. Potential involvement of Fas and its ligand in the pathogenesis of Hashimoto's thyroiditis. Science 275:960.
[Abstract/Free Full Text] - Ferluga, J. 1981. Tuberculin hypersensitivity hepatitis in mice infected with Mycobacterium bovis (BCG). Am. J. Pathol. 105:82.[Abstract]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



X174HaeIII as a marker.

) or control hamster IgG () 30 min before mixed incubation. The data shown are the means ± SE of triplicate experiments.