International Immunology, Vol. 13, No. 11, 1433-1442,
November 2001
© 2001 Japanese Society for Immunology
Signals delivered through TCR instruct IL-12 receptor (IL-12R) expression: IL-12 and tumor necrosis factor-
synergize for IL-12R expression at low antigen dose
Molecular Immunogenetics and Vaccine Research Section, Metabolism Branch, National Cancer Institute, National Institute of Health, Bethesda, MD 20892, USA
Correspondence to: J. A. Berzofsky
| Abstract |
|---|
|
|
|---|
Regulation of the IL-12 receptor (IL-12R) ß2 chain has been suggested to function as a molecular switch in determining T cell phenotype. However, because most studies have been carried out under conditions in which cell proliferation was occurring, it has been difficult to distinguish between instructive and selective mechanisms in regulating this key receptor. Here, in the course of trying to understand the mechanism for synergy between IL-12 and TNF-
in up-regulating IFN-
production, we find that when the stimulus through the TCR is too weak to induce cell proliferation, which would be needed for selection, IL-12 and TNF-
synergize to up-regulate not only IFN-
, but also the IL-12Rß2 chain, which triggers IFN-
production. Neither cytokine alone was sufficient. This observation held true both in the absence of antigen-presenting cells (APC), when the stimulus was anti-CD3 on plastic, and in the presence of APC presenting ovalbumin peptide to TCR-transgenic T cells. In contrast, when the TCR signal was stronger, no cytokines were necessary to up-regulate the IL-12R. Our results support the strength of signal model in instructing Th phenotype, and suggest both an instructive role and, later, through the production of IFN-
, a selective role, of this synergistic combination of cytokines in the preferential differentiation and expansion of Th1 cells.
Keywords: cellular activation, cytokine, cytokine receptors, T lymphocyte, Th1/Th2
| Introduction |
|---|
|
|
|---|
It is well established that selection of CD4+ Th phenotype is controlled by cytokines which regulate expression of IFN-
(Th1 cells) and IL-4 (Th2 cells) during antigen-driven proliferation, although the precise role of cytokines in initial instruction is less clear (reviewed in <1,2). IL-12 plays an essential role in inducing IFN-
production, up-regulation of the IL-12 receptor (IL-12R) ß2 subunit chain and development of a CD4+ Th1 phenotype (3). Regulation of the IL-12Rß2 chain has been suggested as a critical control point in Th1 differentiation (46). Th2 cells lack expression of IL-12Rß2 and STAT-4 signals. A hierarchical basis for cytokine influence on IL-12Rß2 chain expression has been demonstrated in BALB/c transgenic mice, in which IFN-
is dominant over IL-4, which is dominant over IL-12. Maximum IFN-
production by T cells has been clearly shown to be dependent on IL-12, although in BALB/c mice IL-12 alone is insufficient and requires proinflammatory cytokines, tumor necrosis factor (TNF)-
, IL-1 or IGIF as a cofactor (79). The basis for this cofactor dependency in BALB/c mice is unclear. Furthermore, it has been suggested that BALB/c mice have a propensity to develop Th2-like responses as a result of inherently greater IL-4 response to antigen, leading to extinction of IL-12Rß2 expression (10). IL-12 causes up-regulation of its own receptor in IFN-
-deficient mice and IFN-
has been shown to modestly up-regulate the receptor in IL-12-deficient mice (6). This implies the existence of both an IFN-
-dependent and -independent pathway for regulation of the IL-12R. Since in naive cells up-regulation of the IL-12R must precede the action of the cytokine IL-12 in regulating its own receptor, we hypothesize that initial regulation of the receptor must include an instructive signal involving activation through the TCR which synergizes with cytokine(s) in inducing and maintaining the expression of Th1 genes, followed by selection of activated cells expressing this phenotype.
At the single-cell level, the ability of the native peptide or altered peptide ligands to instruct phenotype maybe a stochastic process independent of the signal transmitted through the TCR, suggesting that phenotype selection occurs at the population level based on the balance of absolute numbers of cells secreting IFN-
or IL-4 (11). Phenotype evolves as a consequence of this cascade of self- and cross-regulating expression of cytokines (12,13). Furthermore, it has been suggested that a cell must proceed through a defined number of cell divisions, or at least enter into S phase of the cell cycle, for chromosome remodeling events that make cytokine genes accessible to transcription complexes and committed to a particular phenotype (14,15).
We have previously shown that IL-12 and TNF-
strikingly synergize for IFN-
production in BALB/c mice, skewing the CD4+ response toward Th1 following peptide immunization, and further demonstrated an essential effector function for Th1 cells in protection from viral challenge (7,16). We therefore wanted to investigate the mechanism of cytokine synergy for induction of IFN-
by looking at the effect of these two cytokines directly on the naive T cell in an antigen-presenting cell (APC)-free system. We hypothesized that the mechanism may involve a synergistic up-regulation of the IL-12Rß2 chain by the combination IL-12 and TNF-
, and that synergy for IFN-
production may be mediated by an enhanced sensitivity of CD4+ T cells for IL-12 induced by up-regulation of the IL-12R. To investigate this possibility we looked at the relationship between strength of signal delivered through the TCR, and the role of cytokines on both cytokine gene and IL-12R mRNA expression. Unlike previous studies, here we look at the role of cytokines in initial events regulating expression of the IL-12R, in the absence of cell proliferation.
In this study we demonstrate synergy between IL-12 and the proinflammatory cytokine TNF-
in driving IFN-
production and expression of both IL-12Rß1 and IL-12Rß2 chains in naive CD4+ cells, and furthermore show a similar effect in an established CD8+ cytotoxic T lymphocyte (CTL) clone. This effect on inducing Th1 differentiation in naive CD4+ cells is most pronounced at low-dose antigen concentrations in the absence of a proliferative response, is not blocked by anti-IFN-
antibody and thus appears to be independent of IFN-
. Our results suggest that the combination TNF-
/IL-12 serves an instructive role in Th1 differentiation by up-regulating IL-12Rß chain expression at the single-cell level before clonal expansion and a role in selecting a Th1 response at the population level by up-regulation of IFN-
production. Thus, we find the combination of TNF-
and IL-12 necessary to overcome a weak signal transmitted through the TCR to prime activation of Th1 cells. Interestingly, CD28 co-stimulation was not instructive in priming Th1 responses, IFN-
or IL-12R chain expression at low antigen concentrations, although we could show that proliferation and IL-2 production were significantly enhanced at a single suboptimal dose of antigen. Thus, a proinflammatory milieu in which both IL-12 and TNF-
are present is an essential first stage for the development of Th1 responses in BALB/c mice.
| Methods |
|---|
|
|
|---|
Animals
Female BALB/c mice were housed under pathogen-free conditions and used at 56 weeks of age (Animal Production Colonies, Frederick Cancer Research Facility, National Institutes of Health, Frederick, MD, and Charles River Laboratories, Wilmington, MA) for naive splenic CD4+ T cell isolations. BALB/c-TgN (DO11.10) 10Loh mice were obtained from the laboratory of Dr William Paul (NIAID, Bethesda, MD) or Jackson Laboratories (Bar Harbor, ME). All procedures with animals were carried out in accordance with institutionally approved protocols.
Isolation of CD4+ T cells and an enriched APC population
Mouse spleen cells were obtained from 5- to 6-week-old BALB/c mice. Mouse T cell populations were prepared by passing mononuclear spleen cell suspensions over a T cell column (R & D Systems, Minneapolis, MN) to remove FcR+ cells and B cells. CD4+ T cells were negatively selected by further depleting class II+ cells (2G9, anti-Ad, Ed), NK cells (DX5) and mouse CD8+ T cells using magnetic beads (Dynal, Lake Success, NY). The purity of isolated CD4 cells was >92% by FACScan analysis (Becton Dickinson, Mountain View, CA). CD4+ cells from naive DO11.10 transgenic mice were isolated from mononuclear spleen cell suspensions by negative selection. B220+ and CD8+ cells were removed directly using magnetic beads (Dynal). Further depletion of spleen cell suspensions was achieved using streptavidin-coated beads (Dynal) charged with biotinylated antibodies CD11c, CD11b, F4/80 and pan-NK (DX5). The population of cells used for in vitro stimulation was 80% CD4+ T cells and 7080% D011.10 TCR+, Mel 14+, IL-2R, CD40L. An enriched professional APC population was obtained from spleens of BALB/c mice directly depleted of CD4+CD8+ and B220+ cells using magnetic beads, and of CD19 and NK cells using streptavidin-coated beads charged with anti-CD19 and pan-NK antibodies. Anti-macrophage antibody, clone F4/80 hybridoma (ATCC, Manassas, VA), was purified from culture supernatants on a Protein GSepharose column. All other antibodies were obtained from PharMingen (San Diego, CA).
Cell incubations
Medium for incubation of mouse cell cultures consisted of RPMI:EHAA 50:50, with the addition of 2 mM L-glutamine, 100 µg/ml streptomycin, 100 IU/ml penicillin G and 5x105 M 2-mercaptoethanol.
Ninety-six-well flat- or round-bottom plates (Costar, Corning, NY) were coated with 200 µl of anti-mouse CD3
(145-2C11; PharMingen) antibody covering a range of antigen concentrations (1 ng/ml to 3 µg/ml) in PBS for 3 h at 37°C and washed with medium 34 times before the addition of naive CD4+ T cells. Anti-mouse CD28 (PharMingen) (1 µg/ml) was added during preincubation with anti-CD3 to coat the plates. Naive CD4+ T cells (35x 105/well), incubated at 37°C with exogenous cytokines, were harvested at multiple time points after stimulation: 24 h, 3 days or 5 days to determine the kinetics of IFN-
and IL-12R mRNA induction. Viability of CD4+ cells was 100% in all cultures under all incubation conditions. Carrier-free IL-12, TNF-
and IL-1
(R & D Systems) were used in cell culture at a concentration of 10 ng/ml. IL-4 was used in cultures at a concentration of 300 U/ml. Purified neutralizing cytokine antibodies (no azide/low endotoxin): anti-IFN (XMG1.2), anti-IL-4 (11B11), anti-IL-12 (C17.8) and anti TNF-
(G281-2626) were obtained from PharMingen, and used at a concentration of 10 µg/ml. DO11.10 CD4 cells (2.55 x106) were incubated with 24x106 enriched, irradiated APC in 1.5 ml medium/well in 12-well plates and harvested at the indicated time points. Ovalbumin (OVA) peptide (323339) (generous gift from Dr William Paul) used to stimulate DO11.10 TgN T cells was added directly to duplicate wells during the incubation.
ELISA
Aliquots of 100 µl of 4872 h culture supernatants from purified CD4+ cells stimulated in vitro with anti-CD3 were tested in an IFN-
ELISA assay (Life Technologies, Grand Island, NY) according to the manufacturer's instructions. Standards were curve fit to a four-parameter logistic function and sample concentrations (ng/ml) interpolated from the standard curve.
RT-PCR
Semiquantitative RT-PCR was performed to compare relative levels of IFN-
or IL-12R gene expression within each experiment. Amplification of equal amounts of cDNA was performed under non-saturating conditions for 20 cycles under stringent amplification conditions for IL-12R expression. We tested responses over a range of amplification cycles and found that amplification for <20 cycles failed to reproducibly amplify IL-12R mRNA in repeated experiments. Therefore, results stating relative expression levels between treatment groups are highly conservative and would only be underestimated in the unlikely event that under these non-saturating conditions any sample had reached a plateau in amplification curve. CD4+, CD8+ or DO11.10 TCR+ (clone KJI-26; Caltag, Burlingame, CA) cells were isolated from cultures using antibody-coated magnetic beads. Total RNA was then isolated from purified T cells by immediate lysis in guanidinum thiocyanate followed by acid phenolchloroform extraction and precipitated overnight at 20°C with isopropanol. Contaminating DNA co-precipitated with total RNA was removed using DNA-away reagents (Ambion, Austin, TX). mRNA was then reversed transcribed using oligo(dT) primers from ~25 µg of total RNA using a Superscript II first-strand cDNA synthesis kit (Life Technologies, Grand Island, NY).
The following primer pairs were constructed using complete coding sequences for murine IL-12Rß1 (GenBank accession no. U23922) and ß2 (GenBank accession no. U64199). IL12Rß1 primers: forward CACAGTCCTGTCCAGTTAC; IL12Rß1 reverse GTCTTATGGGTCCTCCAAAG generated a single product of 824 bp. IL-12Rß2 forward ACATAGTGGACCTATGTGGC; IL-12Rß2 reverse GCTTATTGGATGTGAGTTTTG primer pair generated a single product of 526 bp. Primers for the housekeeping gene: HPRT forward GTTGGATACAGGCCAGACTTTGTTG; HPRT reverse TCGGTATCCGGTCGGATGGGAG generated a single PCR product of 450 bp. Murine cytokine primers and controls: IL-2, IL-4, IL-10 and IFN-
(Clontech, Palo Alto, CA) were used at a concentration of 0.4 µM/30 µl reaction. Approximately 1 µg of cDNA was added to 30 µl Superscript PCR buffer (Life Technologies, Grand Island, NY) with an additional 1 mM MgCl plus primers (0.4 µM/reaction). PCR was performed using commercial primers under non-saturating conditions for 25 cycles using the following parameters: 94°C, 30 s; 60°C 1 min; 72°C 1 min, extended to 5 min during the last cycle. PCR products (5 µl of 40µl total) were run on 10% TBE gels for 1.5 h, stained for 10 min with Vistra Green (Amersham, Arlington Heights, IL) and fluorescent bands scanned using a phosphofluoroimager (Molecular Dynamics, Sunnyvale CA). Each sample was repeated in a separate experiment and results found to be highly reproducible. Semiquantitative analysis for expression of the gene of interest was made by normalization to HPRT housekeeping gene expression.
| Results |
|---|
|
|
|---|
TNF-
and IL-12 act directly on naive CD4+ T cells to synergize for IFN-
productionIn previous work we had shown a synergistic effect of IL-12 and TNF-
in vivo, when emulsified in adjuvant with antigen on IFN-
production by both CD4+ and CD8+ cells, thus skewing toward Th1 responses following immunization. To explore the mechanism, we tested these cytokines for their direct effect on naive CD4+ cells in vitro in an APC-free system. Thus, no endogenous source of IL-12 was present in cultures and, in addition, exogenous IL-2 was not added to the cultures. Since expression of both IFN-
and IL-12R is associated with a Th1 phenotype, we stimulated naive CD4+ T cells with anti-CD3 (1 µg/ml) for 5.5 days and looked for mRNA expression by semiquantitative RT-PCR (Fig. 1A
and IL-12, IL-1
and IL-12, and TNF-
, IL-1
and IL-12 led to demonstrable increases in IFN-
mRNA expression. IFN-
mRNA expression was increased from 3.34.2 times that of anti-CD3 stimulation only. TNF-
or IL-1
alone did not enhance IFN-
expression, whereas in this experiment IL-12 alone led to a 3-fold increase in expression. Neither IFN-
treatment or co-stimulation via plate-bound anti-CD28 antibody (1 µg/ml) up-regulated IFN-
expression.
|
Results obtained from RT-PCR correlated with protein expression of IFN-
, measured in 72 h culture supernatants by ELISA. Treatment with TNF-
and IL-12 led to a 5-fold increase in IFN-
production compared to anti-CD3 stimulation only (Fig.1C
enhanced IFN-
production, although the addition of IL-1
did not further enhance levels seen with TNF-
and IL-12. IL-12 alone enhanced IFN-
and this effect was reproducible in four additional experiments, although the effect of the combination IL-12 and TNF-
on IFN-
production on naive CD4+ cells after a single stimulation was generally more than additive.
Conversely, IL-12Rß1 and ß2 chain expression were not significantly up-regulated by any treatment when stimulated at this dose of anti-CD3. Interestingly, we also did not see down-regulation of IL-12Rß2 expression in cultures treated with exogenous IL-4 (300 U/ml) and anti-IFN-
(10 µg/ml). Since previous studies examining the effect of cytokines on the expression of the IL-12Rß2 chain found changes in total mRNA expression by Northern blot analysis only after 5.5 days stimulation in cultures with added IL-2 to obtain maximum proliferation and selection (17), we initially chose to examine mRNA expression at this time point without added exogenous IL-2 using RT-PCR as a more sensitive technique for detecting low levels of mRNA expression. Expression of both chains of the IL-12R was readily detected in cultures at this time point when stimulated with anti-CD3 under these proliferating conditions. These results were reproduced in five separate experiments in which CD4+ cells were stimulated with plate-bound anti-CD3 (coated at concentrations of between 0.5 and 3 µg/ml). We repeated these experiments looking at earlier time points, 24 h and 3 days after anti-CD3 stimulation, and found identical results to those at 5.5 days and later time points. Further experiments focused on these two earlier time points since conclusions regarding a direct effect of cytokines on induction of IFN-
and IL-12R mRNA expression could be determined. Although human IL-12Rß2 mRNA expression has been shown to correlate with cell-surface receptor expression, murine antibodies were not available to confirm surface expression of IL-12R, and thus surface expression was assumed to correlate with enhanced induction of IFN-
mRNA expression and protein expression since we see no IFN-
expression in the absence of IL-12R expression. Although both IL-12R and IFN-
could be detected 24 h after stimulation, peak levels of mRNA expression occurred at 3 days and IFN-
production was highest at 34 days. IFN-
mRNA expression was transient in the absence of IL-12, implying that IL-12R expression precedes induction of IFN-
and that IL-12R mRNA expression is sustained once turned on by TCR ligation. Experiments shown in Fig. 4
(A and B) confirm this hypothesis (see below). Results from these initial experiments suggested that the strength of signal delivered through CD3 during primary in vitro stimulation was sufficient to induce IL-12R expression as early as 24 h and this expression could be maintained in a population of proliferating cells cultured under cytokine conditions selecting for a Th2 phenotype.
|
Thus, we conclude from these experiments that the combination of IL-12 and the proinflammatory cytokine TNF-
act on naive CD4+ T cells to drive a Th1 phenotype in BALB/c mice. The effect of IL-12 and TNF-
on IFN-
production occurred over a wide range of antigen strength, and thus IFN-
induction appeared independent of the strength of signal received through the TCR. Initially, short-term production of IFN-
could be induced through TCR signal during the first 2472 h in the absence of IL-12; however, expression was not sustained in the absence of IL-12 and cofactor TNF-
(Figs 2B and 4A
, IL-12Rß1 and ß2. Although it is clear that CD4+ cells were not activated prior to in vitro stimulation, it is possible that memory cells precommitted to either a Th1 or Th2 phenotype would also be activated and expanded by anti-CD3 stimulation. We believe that responses reported in the anti-CD3 system represent predominantly priming of naive cells for several reasons. First, at high-dose anti-CD3, induction of IFN-
in this population of unactivated cells was strongly cytokine dependent (Fig.1
mRNA expression should be equal in cultures stimulated with anti-CD3 alone and together with exogenous cytokines at early time points such as 24 h. Second, cytokines did not further enhance proliferation or IL-2 production of CD4+ cells at high-dose anti-CD3 (data not shown). If a precommitted Th1 memory cell population were expanded equally and showed similar levels of IL-2 production, then it might have been expected to show similar levels of IFN-
or IL-12R mRNA expression as well. Third, at low dose anti-CD3 in the absence of proliferation, induction of IFN-
and IL-12Rß chain mRNA expression occur only when IL-12 and TNF-
are included in the culture (Fig. 2
in inducing IFN-
production and skewing Th1 responses following immunization with HIV-1 Th CTL vaccine constructs (7,16).
|
IL-12Rß2 expression is dependent on TCR signal strength, and up-regulated by TNF-
and IL-12Since IL-12Rß2 mRNA expression was maximally up-regulated following stimulation with an optimum dose of anti-CD3 for proliferation of naive CD4+ cells, we performed a titration experiment to determine the dose of anti-CD3 at which IL-12Rß2 was not already up-regulated compared to naive CD4+ cells. A 5-fold increase in IL-12Rß2 expression occurred in naive CD4+ when stimulated with plate-bound anti-CD3 (0.5 µg/ml) and the level of expression dropped >3-fold to ~1.5 times the level of naive cells with a 1-log reduction in anti-CD3 dose (0.05 µg/ml) (Fig. 2A
could influence expression of the IL-12Rß2 chain at these lower doses, we tested anti-CD3 stimulated cultures with plate-bound anti-CD28 antibody or the combination IL-12 and TNF-
. Cultures were stimulated with decreasing doses of plate-bound anti-CD3 without exogenous IL-2 and levels of mRNA expression for IFN-
and IL-12Rß2 determined 3 days later by RT-PCR (Fig. 2B
led to significant enhancement of IL-12Rß2 expression following stimulation of naive CD4+ cells with 0.5 µg/ml plate-bound anti-CD3 (Fig. 2B
and IL-12Rß2 chain expression were increased by addition of IL-12 and TNF-
when the dose of anti-CD3 stimulation (0.05 and 0.01 µg/ml) was reduced by
1 log. No expression of IFN-
was seen in CD4+ cells stimulated with anti-CD3 alone or with CD28 co-stimulation at these lower doses. Enhancement of both IFN-
and IL-12Rß1 and ß2 chains by the combination TNF-
and IL-12 was most striking at low-dose anti-CD3 stimulation when IL-2 was added to cultures to stimulate a small proliferative response (Fig. 2C and D
mRNA expression was increased 7.6-fold, IL-12Rß2 expression dramatically increased 59-fold and IL-12Rß1 increased 102-fold. In comparison to co-stimulation using plate-bound anti-CD28, IL-12 and TNF-
induced a 10.5-fold higher IFN-
expression and 9-fold higher IL-12Rß2, whereas there was a modest increase of 1.7-fold in IL-12Rß1 expression. Cytokines alone (without any anti-CD3 or antigen) did not enhance mRNA expression compared to naive cells.
In three separate experiments proliferation was low or absent and not significantly different among groups stimulated at this 0.01 µg/ml dose of anti-CD3 even with the addition of IL-2 (Fig. 2D
). These results suggest that the combination TNF-
and IL-12 is capable of priming more naive CD4+ cells toward a Th1 phenotype and serves to instruct phenotype preference on an individual cell basis, rather than selectively expanding a subset of cells, which cannot occur without proliferation. Since we did not measure IL-4 production in these cultures, it was not possible to determine if the effect of these cytokines inhibited expression of Th2 cytokines. Therefore, it is possible that the combination of cytokines could have acted as a co-stimulatory factor in priming Th1 cells rather than directly instructing transcription events.
In this study we found no direct role for CD28 co-stimulation in the induction of IFN-
or IL-12Rß2, or in selection of a Th1phenotype. Proliferation (Fig. 2D
) and IL-2 production (data not shown) were significantly enhanced at only a single suboptimal concentration of anti-CD3 (0.1 µg/ml) by CD28 co-stimulation and were not further increased by the addition of exogenous IL-2, suggesting an effect of co-stimulation on IL-2 production only.
Concordant up-regulation of IL-12Rß1 and ß2 expression by IL-12, TNF-
and IL-1
in naive CD4+ cells and instruction of a Th1 phenotype are independent of IFN-
An IFN-
-dependent mechanism has been proposed to regulate continued IL-12Rß2 chain expression in selecting a Th1 phenotype through inhibition of the down-regulating effects of IL-4 on this receptor (17). Since both IFN-
and IL-12Rß2 chain expression were increased at low anti-CD3 dose by the combination of TNF-
and IL-12, we wanted to determine if the effect on IL-12Rß2 expression was dependent on IFN-
production. We also looked at the effect of cytokines on expression of the IL-12Rß1 since IFN-
has been reported to regulate expression of the IL-12Rß2 chain but not IL-12Rß1 in a TCR transgenic system (17). Naive CD4+ cells were stimulated through the TCR with low-dose anti-CD3 (0.05 µg/ml) plus cytokines for 3.5 days and mRNA expression examined by RT-PCR (Fig. 3A
). Results were normalized to HPRT expression and compared relative to anti-CD3 stimulation (Fig. 3B
). IL-12 and TNF-
synergized to significantly enhance expression of both IFN-
and IL-12R chain expression. IFN-
was increased 3.8-fold while IL-12Rß2 expression was increased 3.5-fold and IL-12Rß1 increased 4-fold. Individual cytokines, CD28 co-stimulation or the combination IL-12 and IL-1
did not lead to significant increases in expression for IFN-
or either IL-12R chain. The combination of IL-12, TNF-
and IL-1
was slightly more effective in increasing expression of both IL-12Rß chains. To determine the dependence of this cytokine synergy on endogenous IFN-
production, we treated cultures in vitro with anti-IFN-
(10 µg/ml). The synergistic cytokine-induced up-regulation of IFN-
and IL-12Rß mRNA expression was not inhibited by anti-IFN-
antibody. These results support a mechanism by which exogenous cytokine combinations translate a weak activation signal through the TCR to prime Th1 responses before selection of phenotype occurs at the population level.
|
IL-12 synergizes with cofactor TNF-
to prime a Th1 phenotype before selection occursOther groups have shown a role for IL-12 in regulating the IL-12Rß2 subunit chain as well as a modest yet independent role for IFN-
and IFN-
(6,14,18). Our results using plate-bound anti-CD3 stimulation in an APC-free system suggest that signals transmitted through the TCR are readily capable of inducing the IL-12R and cytokines exert little effect on initial expression of this receptor when there is a strong signal transmitted through the TCR. In addition, expression of the IL-12R occurred at antigen concentrations too low to cause proliferation only when both IL-12 and TNF-
were included in the cultures, and this effect appeared independent of IFN-
. It is possible that the role of TNF-
was not apparent in other studies using BALB/c mice because it was an available cofactor in cultures containing both T cells, monocytes and macrophages, whereas we avoided the contribution of other cytokines by using an APC-free system. To address this situation, we stimulated naive DO11.10 TCR+ transgenic cells under similar conditions of antigen and cytokines using an enriched professional APC population depleted of T, B and NK cells. In cultures of DO11.10 TgN T cells stimulated with decreasing doses of peptide, IFN-
expression dropped dramatically and was not maintained at 6.5 days (Fig. 4A
shifted the doseresponse curve inducing IFN-
production at peptide concentrations 2 logs lower than peptide alone, and was essential for maintaining expression in cells at 6.5 days. In agreement with our findings in the anti-CD3 system, IL-12Rß2 was induced by signals delivered through the TCR over a wider range of antigen dose than IFN-
, but required IL-12 and TNF-
to maintain maximum levels of expression at 6.5 days when stimulated at lower peptide concentrations.
Since the effects of IL-12 and TNF-
on IL-12R expression were only revealed at a suboptimal stimulating dose in the anti-CD3 system, we stimulated DO11.10 TgN T cells with low-dose peptide and polarizing cytokine combinations (Fig. 4B
). At low-dose peptide (0.001 µM) neither peptide alone or the individual cytokines IL-12 and TNF-
appeared to activate naive T cells as shown by the lack of cytokine expression (Fig. 4A and B
), as well as absence of proliferation (data not shown). Strikingly, IL-12 and TNF-
induced IFN-
and both chains of the IL-12R, priming Th1 differentiation. IL-12 and TNF-
, in the absence of antigen (Fig. 4B
, lane 2), failed to induce IFN-
, yet induced a slight increase in IL12R expression which indicates a role in priming expression independent of TCR signals. TNF-
was a necessary cofactor in this response as shown by inhibition of IFN-
and the absence of expression of IL-12R chains when anti-TNF-
antibody was added to cultures. Levels of IFN-
were unaffected when anti-IFN-
antibody was added to cultures, indicating a lack of direct self-regulation, although the slight increase in IL-4 may down-regulate IL-12-induced transcriptional events. In contrast to our findings in the anti-CD3 system, anti-IFN-
prevented expression of both IL-12R subunit chains. This implies a difference in transcriptional regulation in signals delivered through the TCR by antigen and anti-CD3 cross-linking. In summary, in two separate systems we have shown that IL-12 and TNF-
synergize to instruct naive T cells to develop a Th1 phenotype, when the signal through the TCR is too weak to induce proliferation and thus allow selection.
The synergistic effect of IL-12 and TNF-
is seen in a memory CD8+ CTL clone
To determine whether or not the synergistic effect of IL-12 and TNF-
was limited to naive cells, we tested an established CD8+ CTL clone stimulated with an optimum dose of antigen for expression of IFN-
and IL-12R chain expression by RT-PCR (Fig. 5
). Rested cells incubated with APC or stimulated with antigen plus TNF-
alone did not express IFN-
or IL-12Rß1 within 36 h of stimulation, although a base level of IL-12Rß2 was seen. IL-12 added to stimulated cultures led to a slight increase in expression of IFN-
and significant increases in IL-12R expression. IL-12Rß2 expression was increased 3.5-fold over unstimulated cultures. The combination of IL-12 and TNF-
was synergistic, increasing IFN-
expression 10-fold compared to IL-12 only. IL-12Rß1 and ß2 expression were also enhanced compared to IL-12 treated cultures, 1.8- and 1.3-fold respectively. Thus the direct synergistic effect of the exogenous cytokine combination is not limited to priming phenotype differentiation in naive T cells, but also applies to enhancing the function of a cell of established phenotype.
|
| Discussion |
|---|
|
|
|---|
In this study we investigated the role of signals delivered through the TCR (over a wide range of antigen or anti-CD3 concentrations) and cytokines on early events in Th1 differentiation. We demonstrated an essential synergy between IL12 and TNF-
in the induction and maintenance of IFN-
expression independent of antigen dose. IFN-
may then function to induce production of the essential cofactor TNF-
and IL-12 by professional APC, and suppress IL-4 production, thus perpetuating a cycle of Th1 differentiation and expansion. IL-12 production is dependent on CD40 ligandCD40 interactions between the activated T cell and professional APC (19,20 and Ahlers et al., submitted), and a weak signal delivered through the TCR by peptide or altered peptide ligand may block phenotype selection at this stage. Surprisingly, expression of the IL-12R was readily induced over a wide range of antigen or anti-CD3 concentrations and exogenous cytokines did not appear to be a major limiting factor in the initial events instructive of its expression. However, addition of exogenous IL-12 and TNF-
to culture proved essential in priming expression of both IFN-
and IL-12R subunit chains ß1 and ß2 at limiting doses of antigen or anti-CD3 (generally, doses too low to induce proliferation).
Although we found that IL-12 requires TNF-
as a cofactor in induction of IFN-
and regulation of IL-12Rß chain expression in BALB/c mice, studies have shown that IL-12 is sufficient to drive Th1 responses in other inbred and congenic strains of mice (7,9). The molecular basis for this cofactor requirement for IL-12-mediated effects in BALB/c mice is unknown. Here we have shown that this requirement for the cofactor, TNF-
, extends to induction of IL-12Rß chain expression, since DO11.10 cultures stimulated with peptide with IL-12 only or IL-12 and anti-TNF-
failed to induce expression of either chain of the IL-12R (Fig. 4B
). In the anti-CD3 system, IFN-
could be induced in the absence of any source of IL-12 provided the signal through TCR was sufficient in strength; however, maintenance and continued expression was dependent on both IL-12 and TNF-
in an APC-free system and peptide-specific OVA transgenic TCR model (data not shown and Fig. 4A
). We have shown that induction and maintenance of IFN-
expression by IL-12 and TNF-
occurs over a wide range of antigen concentration and appears to be independent of the strength of signal transmitted though the TCR, whereas up-regulation of IL12Rß chains is directly dependent upon the strength of signal transmitted. At low antigen concentrations the combination of TNF-
and IL-12 served to instruct naive CD4+ cells to up-regulate IL-12Rß expression and IFN-
production, in the absence of proliferation that could permit selective expansion. Thus TNF-
and IL-12 serve both an instructive role in Th1 differentiation by up-regulating IL-12R ß expression at the single-cell level and a role in selecting phenotype by up-regulating IFN-
which leads to preferential expansion of a population of Th1 cells. Therefore, instruction of a Th1 phenotype is limited by the availability of these two cofactors in inducing IFN-
and IL-12 R expression. Recent data has identified the transcription factor T-bet concordantly regulated with IFN-
expression, and further demonstrated its role in activating Th1 lineage development and suppressing Th2 transcriptional events (21). Further evidence supporting a role for IL-12 in initial instructive events comes from a study in which IL-12 responsiveness in human Th2 cells was restored by the addition of IL-12, and this was accompanied by suppression of GATA-3 expression and induction of T-bet expression (22).
Surprisingly, we found that induction of IL-12R expression was independent of IFN-
in the anti-CD3 system (Fig. 3A and B
), whereas anti-IFN-
antibody abrogated expression in DO11.10 transgenic T cell stimulated with peptide/APC (Fig. 4B
). The reason for this difference in dependency on IFN-
between the two systems is not entirely clear, but may represent qualitative differences in signals transmitted through the TCR, or possibly exogenous TNF-
is limiting in the antigen/APC system and IFN-
is necessary for its induction.
The IL-12R is regulated by the strength of signal transmitted through the TCR and by cytokines, which both instruct and select a population of cells with a Th1 phenotype. Ultimately instruction is the compounded result of both the strength of signal delivered through the TCR and cytokine-induced STAT gene activation. Concordant activation of all Th2 genes following TCR engagement and a requirement for co-stimulation in Th2 differentiation (23) support the strength of signal model. Notably, the transcription factor GATA 3 maybe regulated by signals delivered through the TCR, is required for transcription of all Th2 genes and appears to be down-regulated in Th1 cells by IL-12-induced T-bet expression (22,24). Th2 cells lack the IL-12Rß2 chain and IL-4 has been shown to down-regulate IL-12Rß2 chain expression, whereas IL-12 and IFN-
in mouse cells (6) and IL-12 and IFN-
in human cells (5) independently exert a positive effect on IL-12Rß2 chain expression. In several experiments we observed a significant decrease in IL-12Rß2 under polarizing conditions of exogenous IL-4, and anti-IL-12 and anti-IFN-
, but only after 6 days of culture and suboptimal antigen concentrations. Thus regulation of IL-12Rß2 subunit expression by IL-4 appears to occur secondary to events involved in selection of a Th2 phenotype. In support of this hypothesis, it has recently been shown that stimulation of the IL-12R and subsequent STAT-4 activation did not affect Th2 phenotype in an established Th2 clone, or in naive cells stimulated under Th2 polarizing conditions, that had been transfected with the IL-12Rß2 (25,26). Our results may also explain the observation that low antigen doses preferentially induce IL-4 production and development of a Th2 phenotype, whereas higher antigenic dose are required for IFN-
production and Th1 differentiation (12,27). In the absence of priming levels of IL-12 and TNF-
, Th1 differentiation is not initiated at low antigen dose. Conversely, these cytokines could be used in a vaccine to steer a response toward Th1 even if the TCR signal is weak (cf. 7,16,28). Co-stimulation has been shown to enhance IL-2 production and proliferation (29), but no effect on IFN-
production or IL-12R expression was found in this study. This finding is in agreement with another study that showed CD28 co-stimulation did not affect Th1 responses to altered peptide ligands (20).
Our results are in agreement with the idea that phenotype instruction is a stochastic process, and that the subsequent selection process is the result of a balance between absolute numbers of IL-4- and IFN-secreting cells. Since induction and maintenance of IFN-
is critically dependent upon IL-12 and TNF-
as a cofactor, there maybe a temporal delay in expression due to this intermediate step requiring the activation of APC to secrete IL-12. As a result, weak signals delivered through the TCR tend to prime Th2 responses in the absence of other environmental factors (13). In this study the effector function of an established CD8+ CTL clone was also enhanced by TNF-
and IL-12 present during activation. Although IL-12 alone was shown to regulate its own receptor in the established CD8+ clone, the combination TNF-
and IL-12 synergized for enhanced effector function. Thus, the combination of TNF-
and IL-12 was necessary to overcome a weak strength of signal transmitted through the TCR to fully activate a memory CD8+ clone in which epigenetic changes associated with imprinting of cytokine gene expression had already been established.
In conclusion, we have found that under conditions of limiting antigen concentration too low for induction of T cell proliferation, a signal through the TCR can synergize with a combination of IL-12 and the proinflammatory cytokine TNF-
to markedly up-regulate the IL-12Rß2; at least in some cases, the receptor up-regulation is not dependent on IFN-
. Without proliferation to allow selection, this synergistic combination provides an instructive signal for Th1 differentiation. Thus, a proinflammatory milieu in which both IL-12 and TNF-
are present is an essential first step for the development of Th1 responses in BALB/c mice. These synergistic cytokines may thus be useful for converting a weak TCR signal, which would otherwise induce a Th2 response, into an inducer of a Th1 response. Use of this synergistic combination of cytokines may be valuable in skewing disease responses such as atopy or asthma or skewing responses to vaccines.
| Acknowledgments |
|---|
We thank Drs Alan Sher and William E. Paul for critical reading of the manuscript and helpful suggestions. We thank Cynthia Watson and Jane Hu-Li for helpful suggestions and providing DO11.10 mice and OVA peptide, and Lisa Smith for her assistance in preparation of this manuscript.
| Abbreviations |
|---|
| APC antigen-presenting cell |
| CTL cytotoxic T lymphocyte |
| IL-12R IL-12 receptor |
| OVA ovalbumin |
| TNF tumor necrosis factor |
| Notes |
|---|
Transmitting editor: Warren J. Leonard
Received 27 March 2001, accepted 20 August 2001.
| References |
|---|
|
|
|---|
- O'Garra, A. 1998. Cytokines induce the development of functionally heterogeneous T helper cell subsets. Immunity 8:275.[Web of Science][Medline]
- Reiner, S. L. and Seder, R. A. 1999. Dealing from the evolutionary pawnshop: review how lymphocytes make decisions. Immunity 11:1.[Web of Science][Medline]
- Trinchieri, G. 1995. Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific adaptive immunity. Annu. Rev. Immunol. 13:251.[Web of Science][Medline]
- Szabo, S. J., Jacobson, N. G., Dighe, A. S., Gubler, U. and Murphy, K. M. 1995. Developmental commitment to the Th2 lineage by extinction of IL-12 signaling. Immunity 2:665.[Web of Science][Medline]
-
Rogge, L., Barberis-Maino, L., Biffi, M., Passini, N., Presky, D. H., Gubler, U. and Sinigaglia, F. 1997. Selective expression of an interleukin-12 receptor component by human T helper 1 cells. J. Exp. Med. 185:825.
[Abstract/Free Full Text] -
Chang, J. T., Shevach, E. M. and Segal, B. M. 1999. Regulation of interleukin (IL)-12 receptor B2 subunit expression by endogenous IL-12: a critical step in the differentiation of pathogenic autoreactive T cells. J. Exp. Med. 189:969.
[Abstract/Free Full Text] -
Ahlers, J. D., Dunlop, N., Alling, D. W., Nara, P. L. and Berzofsky, J. A. 1997. Cytokine-in-adjuvant steering of the immune response phenotype to HIV-1 vaccine constructs: GM-CSF and TNF-
synergize with IL-12 to enhance induction of CTL. J. Immunol. 158:3947.[Abstract]
-
Robinson, D., Shibuya, K., Mui, A., Zonin, F., Murphy, E., Sana, T., Hartley, S. B., Menon, S., Kastelein, R., Bazan, F. and O'Garra, A. 1997. IGIF does not drive Th1 development but synergizes with IL-12 for interferon-
production and activates IRAK and NFKB. Immunity 7:571.[Web of Science][Medline]
-
Shibuya, K., Robinson, D., Zonin, F., Hartley, S. B., Macatonia, S. E., Somoza, C., Hunter, C. A., Murphy, K. M. and O'Garra, A. 1998. IL-1
and TNF-
are required for IL-12-induced development of Th1 cells producing high levels of IFN-
in BALB/c but not C57BL/6 mice. J. Immunol. 160:1708.[Abstract/Free Full Text] -
Hsieh, C.-S., Macatonia, S. E., O'Garra, A. and Murphy, K. M. 1995. T cell genetic background determines default T helper phenotype development in vitro. J. Exp. Med. 181:713.
[Abstract/Free Full Text] -
Grakoui, A., Donermeyer, D. L., Kanagawa, O., Murphy, K. M. and Allen, P. M. 1999. TCR-independent pathways mediate the effects of antigen dose and altered peptide ligands on Th cell polarization. J. Immunol. 162:1923.
[Abstract/Free Full Text] -
Hosken, N. A., Shibuya, A., Heath, A. W., Murphy, K. M. and O'Garra, A. 1995. The effect of antigen dose on CD4+ T helper cell phenotype development in a T cell receptor-alpha beta-transgenic model. J. Exp. Med. 182:1579.
[Abstract/Free Full Text] -
Rogers, P. R. and Croft, M. 1999. Peptide dose, affinity, and time of differentiation can contribute to the Th1/Th2 cytokine balance. J. Immunol. 163:1205.
[Abstract/Free Full Text] - Bird, J. J., Brown, D. R., Mullen, A. C., Moskowitz, N. H., Mahowald, M. A., Sider, J. R., Gajewski, T. F., Wang, C.-R. and Reiner, S. L. 1999. Helper T cell differentiation is controlled by the cell cycle. Immunity 9:229.
-
Richter, A., Lohning, M. and Radbruch, A. 1999. Instruction for cytokine expression in T helper lymphocytes in relation to proliferation and cell cycle progression. J. Exp. Med. 190:1439.
[Abstract/Free Full Text] -
Ahlers, J. D., Belyakov, I. M., Matsui, S. and Berzofsky, J. A. 2001. Mechanisms of cytokine synergy essential for vaccine protection against viral challenge. Int. Immunol. 13:897.
[Abstract/Free Full Text] -
Szabo, S. J., Dighe, A. S., Gubler, U. and Murphy, K. M. 1997. Regulation of the Interleukin (IL)-12R ß2 subunit expression in developing T helper 1 (Th1) and Th2 cells. J. Exp. Med. 185:817.
[Abstract/Free Full Text] -
Reiner, S. L., Wang, Z.-E., Hatam, F., Scott, P. and Locksley, R. M. 1993. TH1 and TH2 cell antigen receptors in experimental leishmaniasis. Science 259:1457.
[Abstract/Free Full Text] - Cella, M., Engering, A., Pinet, V., Pieters, J. and Lanzavecchia, A. 1997. Inflammatory stimuli induce accumulation of MHC class II complexes on dendritic cells. Nature 388:782.[Medline]
-
Ding, L. and Shevach, E. M. 1998. Differential effects of CD28 engagement and IL-12 on T cell activation by altered peptide ligands. J. Immunol. 161:6614.
[Abstract/Free Full Text] - Szabo, S. J., Kim, S. T., Costa, G. L., Zhang, X., Fathman, C. G. and Glimcher, L. H. 2000. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell 100:655.[Web of Science][Medline]
- Smits, H. H., van Rietschoten, G. I., Hilkens, C. M. U., Sayilir, R., Stiekema, F., Kapsenberg, M. L. and Wierenga, E. A. 2001. IL-12-induced reversal of human Th2 cells is accompanied by full restoration of IL-12 responsiveness and loss of GATA-3 expression. Eur. J. Immunol. 31:1055.[Web of Science][Medline]
- Rulifson, I. C., Sperling, A. I., Fields, P. E., Fitch, F. W. and Bluestone, J. A. 1997. CD28 costimulation promotes the production of Th2 cytokines. J. Immunol. 158:658.[Abstract]
- Ouyang, W., Lohning, M., Gao, Z., Assenmacher, M., Ranganath, S., Radbruch, A. and Murphy, K. M. 2000. Stat6-independent GATA-3 autoactivation directs IL-4-independent Th2 development and commitment. Immunity 12:27.[Web of Science][Medline]
-
Nishikomori, R., Ehrhardt, R. O. and Strober, W. 2000. T helper type 2 cell differentiation occurs in the presence of interleukin 12 receptor ß2 chain expression and signaling. J. Exp. Med. 191:847.
[Abstract/Free Full Text] -
Heath, V. L., Showe, L., Crain, C., Barrat, F. J., Trinchieri, G. and O'Garra, A. 2000. Ectopic expression of the IL-12 receptor-b2 in developing and committed Th2 cells does not affect the production of IL-4 or induce the production of IFN-
. J. Immunol. 164:2861.[Abstract/Free Full Text] - Tao, X., Grant, C., Constant, S. and Bottomly, K. 1997. Induction of IL-4-producing CD4+ T cells by antigenic peptides altered for TCR binding. J. Immunol. 158:4237.[Abstract]
-
Belyakov, I. M., Ahlers, J. D., Clements, J. D., Strober, W. and Berzofsky, J. A. 2000. Interplay of cytokines and adjuvants in the regulation of mucosal and systemic HIV-specific cytotoxic T lymphocytes. J. Immunol. 165:6454.
[Abstract/Free Full Text] -
Murtaza, A., Kuchroo, V. K. and Freeman, G. J. 1999. Changes in the strength of co-stimulation through the B7/CD28 pathway alter functional T cell responses to altered peptide ligands. Int. Immunol. 11:407.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
K. J. Welsh, A. N. Abbott, S.-A. Hwang, J. Indrigo, L. Y. Armitige, M. R. Blackburn, R. L. Hunter, and J. K. Actor A role for tumour necrosis factor-{alpha}, complement C5 and interleukin-6 in the initiation and development of the mycobacterial cord factor trehalose 6,6'-dimycolate induced granulomatous response Microbiology, June 1, 2008; 154(6): 1813 - 1824. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. G. Ovsyannikova, R. M. Jacobson, N. Dhiman, R. A. Vierkant, V. S. Pankratz, and G. A. Poland Human Leukocyte Antigen and Cytokine Receptor Gene Polymorphisms Associated With Heterogeneous Immune Responses to Mumps Viral Vaccine Pediatrics, May 1, 2008; 121(5): e1091 - e1099. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.-X. Zhang, S. Yu, B. Gran, J. Li, I. Siglienti, X. Chen, D. Calida, E. Ventura, M. Kamoun, and A. Rostami Role of IL-12 Receptor {beta}1 in Regulation of T Cell Response by APC in Experimental Autoimmune Encephalomyelitis J. Immunol., November 1, 2003; 171(9): 4485 - 4492. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bao, Y. Yang, H.-S. Jun, and J.-W. Yoon Molecular Mechanisms for Gender Differences in Susceptibility to T Cell-Mediated Autoimmune Diabetes in Nonobese Diabetic Mice J. Immunol., May 15, 2002; 168(10): 5369 - 5375. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







