International Immunology, Vol. 13, No. 11, 1391-1404,
November 2001
© 2001 Japanese Society for Immunology
Lipopolysaccharide and CpG DNA synergize for tumor necrosis factor-
production through activation of NF-
B
1 Crippled Children's Foundation Research Center at Le Bonheur Children's Hospital and Department of Pediatrics, University of Tennessee Health Science Center, Memphis, TN 38103, USA
2 Department of Microbiology and Immunology, Indiana University School of Medicine, Indianapolis, IN 46202, USA
3 Walther Oncology Center, Walther Cancer Institute, Indianapolis, IN 46208, USA
4 College of Pharmacy, University of Iowa, IA 52242, USA
5 Interdisciplinary Graduate Program in Immunology and Department of Internal Medicine, College of Medicine, University of Iowa, Iowa City, IA 52242, USA
6 Department of Veteran Affairs Medical Center, Iowa City, IA 52246, USA
7 Coley Pharmaceutical Group, Inc., Wellesley, MA 02481, USA
Correspondence to: A.-K. Yi
| Abstract |
|---|
|
|
|---|
Unmethylated CpG motifs in bacterial DNA (CpG DNA) activate host innate immune responses synergistically with some other microbial products, such as endotoxins, and may contribute to disease pathogenesis through excessive production of proinflammatory cytokines. Because monocyte-derived tumor necrosis factor (TNF)-
is an important mediator of disease, we investigated whether CpG DNA and lipopolysaccharide (LPS) synergize for inducing TNF-
biosynthesis. CpG DNA and LPS synergistically induce TNF-
production in RAW264.7 cells and J774 cells through activation of NF-
B. Furthermore, transient transfection with a super-repressive mutant of I
B
(I
B
-AA) demonstrated that NF-
B plays a critical role in CpG DNA-mediated TNF-
expression. Like NF-
B activation, CpG DNA-induced activation of mitogen-activated protein kinases (MAPK) regulates TNF-
production. Both extracellular receptor kinase (ERK) and p38 can regulate TNF-
gene transcription induced by CpG DNA. Although CpG DNA at the higher concentration slightly enhanced LPS-mediated phosphorylation of ERK, it did not alter the LPS-mediated activation of c-Jun N-terminal kinase and p38. In addition, CpG DNA showed little or no enhancement of LPS-mediated AP-1 activation. These results suggest that CpG DNA- and LPS-mediated signals converge at or above the level of NF-
B and ERK, and that there are distinct, as well as common, signaling pathways which are utilized by both CpG DNA and LPS for activating various transcription factors and MAPK.
Keywords: cytokines, endotoxin shock, inflammatory mediators, lipopolysaccharide, monocytes, macrophages, transcription factors
| Introduction |
|---|
|
|
|---|
Innate immune responses are initiated rapidly after infection by host recognition of conserved molecular structures present in microorganisms (e.g. endotoxins and high mannose proteins) and limit pathogen spread. Recent studies have suggested that immune cells recognize unmethylated CpG dinucleotides in particular base contexts (`CpG motifs': GACGTT for murine and GTCGTT for human) in bacterial DNA as one such conserved molecular pattern (15). To quickly and efficiently clear infections before they become pathogenic, immune cells recognize and respond to low levels of different innate immune activators in a synergistic manner. However, under certain conditions, this synergistic activation of immune cells by different innate immune activators like CpG DNA and lipopolysaccharide (LPS) can induce the systemic inflammatory response syndrome (SIRS) or inflammatory arthritis (68, and Waldschimidt and Krieg, unpublished).
CpG motifs in bacterial DNA and synthetic oligodeoxynucleotides (CpG DNA) induce B cell proliferation, tumor necrosis factor (TNF)-
, IL-6, IL-10 and Ig secretion, and apoptosis resistance (1,917). In addition to its direct effects on B lymphocytes, CpG DNA also directly activates monocytic cells, such as monocytes/macrophages, and dendritic cells to secrete various cytokines, including type I IFN, TNF-
, IL-1, IL-6, IL-10 and IL-12, and to up-regulate expression of co-stimulatory factors (6,9,10,12,13,1821). In addition, some cytokines, such as IL-12, that are secreted by monocytic cells after CpG DNA stimulation, act on NK cells to induce their lytic activity and IFN-
production (6,22). Overall, CpG DNA induces a Th1-like pattern of cytokine production dominated by IL-12 and IFN-
(18,2325).
The biochemical mechanisms by which CpG DNA activates immune cells to produce Th1-type cytokines and protects B cells from apoptosis are yet to be fully understood, although recent studies have provided exciting new insights. The innate immune system detects many infectious agents through a family of proteins known as toll-like receptors (TLR) that function as pattern recognition receptors capable of specifically binding molecular patterns present in microbes but not in vertebrate cells (reviewed in 26). This heterogeneous family of proteins includes TLR-2 (which binds peptidoglycan), TLR-4 (which binds LPS) and the newly described TLR-9 (which is required for the immune stimulatory effects of CpG DNA) (2730). In addition, CpG DNA signaling is dependent on the MyD88/IRAK pathway which is suggested to be a downstream effector of TLR-9 (31). On the other hand, evidence also exists for a second pathway in which the DNA-activated protein kinase, DNA-PKcs, has been suggested to mediate the response to CpG DNA (32). Prior to cellular activation through these pathways, CpG DNA appears to be endocytosed by leukocytes and acidified in an endosomal compartment, which is coupled to the rapid generation of intracellular reactive oxygen species (ROS) (19). The CpG DNA-induced ROS generation precedes activation of NF-
B, which is required for all downstream events such as proto-oncogene expression, cytokine production, B cell proliferation and apoptosis protection (12,1517,19). In addition, CpG DNA induces activation of certain mitogen-activated protein kinase (MAPK) kinases (MKK; MKK3, MKK4 and MKK6) and MAPK, including extracellular receptor kinase (ERK), c-Jun N-terminal kinase (JNK) and p38 (33,34, and Yi and Krieg manuscript in preparation). Endosomal acidification of CpG DNA is also required for this MAPK activation (33,34). In turn, CpG DNA-mediated MAPK activation has been reported to be involved in the cytokine production (3335). However, it is largely unknown how MAPK activated by CpG DNA lead to the production of each cytokine.
The proinflammatory cytokine TNF-
is an important regulator of the early inflammatory immune response and a central mediator of the SIRS (36). As in the LPS response, secretion of TNF-
by leukocytes is an early effect of CpG DNA (6,8,34, and Yi and Krieg, unpublished data). This TNF-
produced by CpG DNA has been shown to play an important role in the CpG DNA-mediated inflammatory arthritis and SIRS (68, and Waldschmidt and Krieg, unpublished data). Interestingly, low doses of CpG DNA and LPS can synergistically induce SIRS and inflammatory arthritis which, at least in part, might be due to production of large amounts of TNF-
(6,8). Considering the critical role of TNF-
in CpG DNA-mediated inflammatory arthritis and SIRS, it is important to understand the molecular mechanisms by which CpG DNA mediates TNF-
production, in monocytic cells. Therefore, we investigated whether CpG DNA and LPS synergize for TNF-
production, and how CpG DNA-mediated signals interact with LPS-mediated signals to synergistically induce TNF-
synthesis in murine monocytic cells, RAW264.7 and J774. Our results indicate that CpG DNA-mediated TNF-
production is dependent on the activation of NF-
B, ERK and p38. In addition, our results demonstrated that CpG DNA synergizes with LPS for TNF-
production through activation of NF-
B in RAW264.7 and J774 cells.
| Methods |
|---|
|
|
|---|
Oligodeoxynucleotides
Nuclease-resistant phosphorothioate oligodeoxynucleotides (S-ODN) were supplied by the Coley Pharmaceutical Group (Wellesley, MA) and had no detectable endotoxins by Limulus assay. The sequences of S-ODN used were 5'-TCCATGACGTTCCTGACGTT-3' (CpG DNA: 1826) and 5'-TCCAGGACTTCTCTCAGGTT-3' (non-CpG DNA: 1982). Escherichia coli DNA and calf thymus DNA were purchased from Sigma (St Louis, MO), and purified by phenolchloroform extraction followed by ethanol precipitation using pyrogen-free solutions, and had undetectable endotoxin by Limulus assay (QCL-1000; Biowhittaker, Walkersville, MD) following the manufacturer's protocol. For the sake of consistency, only the results using these two ODN are shown herein. However, essentially the same results have been obtained in experiments with other CpG and control non-CpG DNA, including bacterial DNA.
Cell lines, culture conditions and reagents
The murine monocytic cell line RAW264.7 (ATCC, Rockville, MD) was cultured at 37°C in a 5% CO2 humidified incubator, and maintained in RPMI 1640 supplemented with 10% (v/v) heat-inactivated FCS, 1.5 mM L-glutamine, 50 µM 2-mercaptoethanol, 100 U/ml penicillin and 100 µg/ml streptomycin. J774 cells (ATCC) were cultured at 37°C in a 5% CO2 humidified incubator, and maintained in DMEM supplemented with 10% (v/v) heat-inactivated FCS, 1.5 mM L- glutamine, 100 U/ml penicillin and 100 µg/ml streptomycin. All culture reagents were purchased from Gibco/BRL (Gaithersburg, MD). LPS (Salmonella typhimurium) was purchased from Sigma (St Louis, MO). SB202190, a p38 kinase inhibitor, and U0126, a MEK inhibitor, were purchased from Calbiochem (La Jolla, CA).
ELISA
RAW264.7 cells (5x105 cells/ml) or J774 cells (5x106 cells/ml) were treated with CpG or non-CpG DNA (030 µg/ml) in the presence or absence of LPS (05000 ng/ml) for 6 h. For some experiments, RAW264.7 cells were stimulated with media, CpG DNA or LPS in the presence or absence of U0126 (2.5 µM) or SB202190 (2.5 µM) for 6 h. For IL-6 and IL-12p40 analysis, RAW264.7 cells (2x106 cells/ml) or J774 cells (1x106 cells/ml) were treated with CpG or non-CpG DNA (030 µg/ml) in the presence or absence of LPS (0500 ng/ml) for 24 h. Culture supernatants were analyzed by ELISA for TNF-
, IL-6 or IL-12p40 as described previously (10). Antibodies specific for murine TNF-
, IL-6 and IL-12p40, and recombinant murine TNF-
, IL-6 and IL-12 were purchased from PharMingen (San Diego, CA).
Transfections, luciferase assay, ß-galactosidase assay and chloramphenicol acetyl transferase (CAT) ELISA
RAW264.7 cells or J774 cells (~80% confluent in a 100-mm tissue culture dish) were transfected with AP-1ß-galactosidase (8 µg), 5' TNF-
CAT (4 µg) or a mixture of NF-
Bluciferase (4 µg) and pRL-TKluciferase (1 µg) constructs using LipofectAMINE Plus (Gibco/BRL). Transfected cells were pooled and washed 3 times with culture media. Cells (5x105 cells/ml for AP-1ß-galactosidase, 5' TNF-
CAT or NF-
Bluciferase and pRL-TKluciferase) were stimulated with CpG DNA (06 µg/ml) in the presence or absence of LPS (0100 ng/ml) for 12 h. For some experiments, RAW264.7 cells were co-transfected with super-suppressive I
B
mutant construct (I
B
-AA, 15 µg) or control vector (pOPRSVI.mcs1, 15 µg) and 5' TNF-
CAT (8 µg) construct, AP-1-ß-galactosidase (12 µg), or a mixture of NF-
Bluciferase (8 µg) and pRL-TKluciferase (2 µg) constructs, and then incubated for 6 h before stimulating with media, CpG DNA (0.6 or 3 µg/ml) and/or LPS (5 or 50 ng/ml) for 12 h. To investigate the role of ERK and p38 in CpG DNA- and LPS-mediated TNF-
transcription, RAW264.7 cells transfected with TNF-
transcriptional promoter linked with gene encoding reporter enzyme CAT (5' TNF-
CAT; 4 µg) were stimulated with media, CpG DNA (0.6 or 3 µg/ml) and/or LPS (5 or 50 ng/ml) for 12 h in the presence or absence of DMSO, U0126 (2.5 µM) or SB202190 (2.5 µM). ß-Galactosidase and luciferase activities in cell extracts were analyzed according to manufacturer's protocol using the Galacto-Light Plus reporter gene assay for ß-galactosidase (Tropix, Bedford, MA) and Dual-Luciferase reporter assay system (Promega, Madison, WI) respectively. For expression of CAT in the transfected cells, CAT protein levels in the cell lysates were analyzed using the CAT-ELISA kit (Boehringer Mannheim, Mannheim, Germany). NF-
Bluciferase activity was normalized using pRL-TKluciferase activity in each sample. For AP-1ß- galactosidase assay and CAT-ELISA, equal concentrations of cell lysates were used. AP-1ß-galactosidase and NF-
Bluciferase constructs were kindly provided by Dr G. Koretzky (University of Pennsylvania) (37). 5' TNF-
CAT construct was provided by Dr B. Beutler (University of Texas Southwestern Medical Center at Dallas) (38) and super-suppressive I
B
mutant construct (I
B
-AA) was provided by Dr. G. Bishop at U. Iowa (39).
Preparation of RNA and quantitation of TNF-
mRNA by real-time PCR analysis
RAW264.7 cells (2x106 cells/ml) were treated with various concentrations of CpG DNA (00.6 µg/ml) in the presence or absence of LPS (5 ng/ml). Cells were harvested 30 min after LPS and DNA treatments, and total RNA was isolated by using the RNeasy mini kit (Qiagen, Valencia, CA) following the manufacturer's protocol. To measure the relative amount of TNF-
mRNAs, amplification of sample cDNA was monitored with the fluorescent DNA binding dye SYBR Green in combination with the ABI 5700 sequence detection system (PE Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. Forward and reverse primers were designed using primerExpress software (PE Applied Biosystems). GAPDH was used for endogenous control. The PCR primers used in this study were: TNF-
(F: TGGGAGTAGACAAGGTACAACCC; R: AGAGGGAAATCGTGCGTGAC) and GAPDH (F: TTCACCACCATGGAGAAGGC; R: GGCATGGACTGTGGTCATGA).
Preparation of whole-cell lysates and nuclear extracts, Western blot analysis, and electrophoretic mobility shift assay (EMSA)
RAW264.7 cells (2x106 cells/ml) were treated with medium, CpG DNA (06 µg/ml) and/or LPS (05 ng/ml). Cells were harvested at the indicated time points (15 min, 30 min, 1 h and 2 h) and then whole-cell lysates or nuclear extracts were prepared as previously described (15,19). To detect phosphorylated ERK, JNK or p38, equal amounts of whole-cell lysates (50 µg/lane) were subjected to electrophoresis on a 10% polyacrylamide gel containing 0.1% SDS (SDSPAGE) and then Western blots were performed as previously described (19) using a specific antibody against the phosphorylated form of each protein. Specific antibodies against the phosphorylated form of ERK, JNK and p38 were purchased from New England BioLabs (Beverly, MA). Specific antibody against p38 was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). To detect DNA binding activity of the transcription factor AP-1, NF-AT, NFIL-6, or NF-
B, nuclear extracts (3 µg/lane) were analyzed by EMSA as previously described (15) using 32P-labeled double-stranded oligodeoxynucleotides containing the AP-1 (GATCTAGTGATGAGTCAGCCGGATC) (40), NF-AT (TGCCCAAAGAGGAAAATTTGTTTCATACAG) (41), NF-IL-6 (TCGAGACATTGCACAATCTG) (40) or NF-
B (GTAGGGGACTTTCCGAGCTCGAGATCCTATG) (42) binding sequence as a probe.
| Results |
|---|
|
|
|---|
Synergistic effects of CpG DNA and LPS on TNF-
production in RAW 264.7 and J774 cellsTo investigate whether CpG DNA and LPS can synergize for TNF-
production, we used the murine monocytic cell lines, RAW264.7 and J774. RAW264.7 cells or J774 cells were stimulated with various concentrations of CpG DNA or control non-CpG DNA in the presence or absence of various concentrations of LPS for 6 h. The levels of TNF-
in culture supernatants were measured by an ELISA specific for murine TNF-
. As demonstrated in Fig. 1
production. As anticipated, CpG DNA also induced TNF-
production in a dose-dependent manner and showed synergy with LPS (100 ng/ml) (Fig. 1B
or has a more general impact on other phenomena, we analyzed effects on IL-6 production. As expected, CpG DNA and LPS synergized for IL-6 production in J774 cells (Fig. 1C and D
production in RAW264.7 cells in a dose-dependent manner (Fig. 2A
production. This synergistic effect of CpG DNA and LPS for TNF-
production was observed not only at low concentrations of CpG DNA, but also with the concentration which induced maximal TNF-
production (Fig. 2A
production in a dose-dependent manner and showed synergy with a suboptimal dose of CpG DNA (0.06 µg/ml) (data not shown). In contrast, control non-CpG DNA neither induced TNF-
production by itself nor enhanced LPS-mediated TNF-
production in RAW264.7 cells (Fig. 2B
, CpG DNA and LPS also synergistically induced production of later cytokines including IL-6 and IL-12 in RAW264.7 cells (Fig. 2C and D
as well as other cytokines in murine monocytic cells, and that in addition to the common shared pathway of MyD88/TRFA6, CpG DNA and LPS might also have a capability to transduce signals through different pathways that converge for TNF-
production.
|
|
Agonistic effects of CpG DNA and LPS for activation of TNF-
promoter and expression of TNF-
mRNA in RAW264.7 cellsIt has been demonstrated that the biosynthesis of TNF-
is regulated at both the transcriptional and translational levels (38,43). Therefore we investigated whether CpG DNA induces production of TNF-
by activating TNF-
promoter activities and whether it can synergize with LPS at the level of TNF-
transcription. To investigate these possibilities, we transiently transfected RAW264.7 cells with the TNF-
transcriptional promoter reporter plasmids which encoding the 5' TNF-
promoter linked with CAT as a reporter gene (5' TNF-
CAT) (38) and then stimulated with various concentrations of CpG DNA (03 µg/ml) in the presence or absence of a low concentration of LPS (1 ng/ml) for 12 h. Levels of CAT proteins in the cell lysates were measured by CAT-ELISA. As demonstrated in Fig. 3
promoter activation in a dose-dependent manner. In addition, a low concentration of LPS greatly enhanced CpG DNA-mediated TNF-
promoter activation (Fig. 3A
promoter actually correlate with the levels of TNF-
mRNA expression, we stimulated RAW264.7 cells with low concentrations of CpG DNA (00.6 µg/ml) in the presence or absence of LPS (5 ng/ml) for 30 min and then measured levels of TNF-
mRNA by real-time PCR. As shown in Fig. 3
mRNA. The levels of TNF-
mRNA in RAW264.7 cells increased upon CpG DNA stimulation in a dose-dependent manner. Furthermore, the levels of TNF-
mRNA were greatly increased when CpG DNA and LPS were added simultaneously (Fig. 3B
by CpG DNA and LPS might be controlled, at least in part, at the transcriptional level.
|
CpG DNA and LPS synergize for activation of NF-
B but not AP-1, NF-IL-6 or NF-ATSince CpG DNA and LPS synergize for TNF-
promoter activity, we investigated whether CpG DNA and LPS activate different transcription factors and/or can synergize for activation of a particular transcription factor. RAW264.7 cells were stimulated with CpG DNA (0.06 or 6 µg/ml) and/or LPS (1, 5 or 50 ng/ml) for 12 h, and nuclear extracts were analyzed for DNA binding activities of several transcription factors. At these concentrations, CpG DNA and LPS synergistically induced DNA binding activity of p65/p50 NF-
B heterodimers, but not AP-1, NF-AT or NF-IL-6 (Fig. 4A and 4B
B correlates with its transcriptional ability, RAW264.7 cells or J774 cells were transiently transfected with a reporter construct encoding NF-
Bluciferase and then stimulated with various concentrations of CpG DNA in the absence or presence of various concentrations of LPS for 12 h. As demonstrated in Fig. 5
B in J774 cells. In addition, CpG DNA- or E. coli DNA-mediated activation of NF-
B was greatly enhanced by addition of a low concentration of LPS in RAW264.7 cells (Fig. 5B
B in a dose- dependent manner and the simultaneous addition of LPS synergistically enhanced CpG DNA-mediated NF-
B activation in RAW264.7 cells. As expected, LPS alone also induced transcriptional activities of NF-
B in a dose-dependent manner and addition of CpG DNA synergistically enhanced this (data not shown). As for NF-
B, either CpG DNA alone or LPS alone induced the transcriptional activity of AP-1 in a dose-dependent manner (Fig. 5D
B that may contribute to the synergistic biosynthesis of TNF-
at the transcriptional level.
|
|
Transcriptional activation of TNF-
synthesis induced by CpG DNA is dependent upon NF-
B activationBecause our data demonstrated that CpG DNA and LPS synergize for TNF-
biosynthesis, at least in part, at the transcriptional level (Fig. 3
B is synergistically induced by both signals (Figs 4 and 5
B has a functional role in the synergistic activation of TNF-
transcription. To directly determine the role of NF-
B in the CpG DNA-mediated TNF-
expression, RAW264.7 cells were co-transfected with constructs encoding super-repressive I
B
mutant (I
B
-AA) or control empty vector and 5' TNF-
CAT construct, AP-1-ß-galactosidase construct or NF-
Bluciferase and pRL-TKluciferase constructs. As shown in Fig. 6
B
mutant, I
B
-AA, completely abolished CpG DNA- or LPS-mediated NF-
B activation in RAW264.7 cells indicating the functional inhibitory activities of I
B
-AA for NF-
B. CpG DNA and LPS synergized for NF-
B activation (Fig. 5 and 6B
B
-AA (Fig. 6B
promoter activity was greatly suppressed in the presence of I
B
-AA in these cells, indicating the critical role of NF-
B in CpG DNA-mediated TNF-
expression (Fig. 6C
promoter activity were also abolished (Fig. 6D
B
-AA, demonstrating the specific functional role of I
B
-AA for suppression of NF-
B (Fig. 6E
(44), NF-
B plays a critical role in the CpG DNA-induced TNF-
expression in RAW264.7 cells, and suggest that synergistic activation of NF-
B by CpG DNA and LPS may be the major contributor for the synergistic induction of TNF-
promoter activity by these stimuli.
|
CpG DNA slightly enhances LPS-induced phosphorylation of ERK but not JNK or p38 in RAW264.7 cells
Activation of one or more members of MAPK is one of the early signaling events in the CpG DNA-mediated leukocyte activation (33,34). It has previously been indicated that CpG DNA-mediated production of various cytokines is regulated by one or more activated MAPK in murine monocytic and B cells (3335). In addition, inhibition of ERK or p38 by pharmacological inhibitors greatly suppresses TNF-
production induced by CpG DNA (3335). Therefore, we investigated whether CpG DNA-mediated MAPK contributes to biosynthesis of TNF-
at the transcriptional level, and whether CpG DNA and LPS also synergize for activation of one or more MAPK in RAW264.7 cells. To evaluate whether ERK or p38 has a functional role in CpG DNA-induced TNF-
transcription, RAW264.7 cells were transiently transfected with TNF-
transcriptional promoter (5' TNF-
CAT) and then stimulated with CpG DNA (3 µg/ml) in the presence or absence of DMSO, MEK inhibitor, U0126 (2.5 µM), or p38 inhibitor, SB202190 (2.5 µM), for 12 h. Levels of CAT protein in the cell lysates were measured by CAT-ELISA. Specific inhibitory effects of U0126 and SB202190 on MEK1/2 and p38 respectively at the concentration used for this study were verified by phospho-specific Western blot and in vitro kinase assay (data not shown). As shown in Fig. 7
promoter activities were partially impaired in the presence of MEK inhibitor or p38 inhibitor, indicating regulatory effects of ERK and p38 in TNF-
synthesis at the transcriptional level. Our results indicate that both ERK and p38 have a regulatory function in CpG DNA-induced TNF-
synthesis at the transcriptional level, and that CpG DNA and LPS synergize for TNF-
synthesis at the transcriptional level. Therefore we further investigated whether CpG DNA and LPS also synergize for activation of one or more MAPK, and whether MEK inhibitor or p38 inhibitor abolishes synergistic effects of CpG DNA and LPS on the TNF-
promoter activation. RAW264.7 cells or J774 cells were stimulated with low concentrations of CpG DNA (00.1 µg/ml) in the presence or absence of suboptimal concentrations of LPS (15 ng/ml) for 15, 30 or 60 min. As shown in Fig. 8
transcriptional promoter activation, RAW264.7 cells were transiently transfected with 5' TNF-
CAT, and then stimulated with low doses of CpG DNA and/or LPS in the presence or absence of DMSO, U0126 or SB202190. As anticipated, CpG DNA and LPS induced activation of TNF-
transcriptional promoter, 5' TNF-
CAT, and U0126 and SB202190 partially inhibited activation of 5' TNF-
CAT induced by low doses of CpG DNA plus LPS (Fig. 7B
transcriptional promoter activation were not inhibited (Fig. 7B
biosynthesis induced by either CpG DNA or LPS alone (3335,45), MAPK may have little or no contribution to the synergistic effects of CpG DNA and LPS for production of TNF-
at the transcriptional level. Our results also suggested that, at least in part, CpG DNA and LPS might utilize common pathways to activate MAPK in RAW 264.7 and J774 cells.
|
|
| Discussion |
|---|
|
|
|---|
Over the past few years, CpG motifs in bacterial DNA have received tremendous attention for their strong innate immune stimulatory effects. Because of their abilities to induce Th1-type responses, and to strongly activate immune cells such as B lymphocytes, NK cells and monocytic cells, the utility of CpG DNA as a therapeutic agent has been vigorously studied and well documented (reviewed in 46,47). However, CpG DNA could have detrimental effects in the body under certain pathologic circumstances such as overwhelming bacterial infection. Recent studies have demonstrated that high doses of CpG DNA can induce SIRS or inflammatory arthritis under certain experimental conditions (68,48, and Waldschmidt and Krieg, unpublished data). In addition, low concentrations of CpG DNA enhance LPS-mediated SIRS and septic arthritis (6,8). Furthermore, CpG DNA and LPS also act in synergy for nitric oxide production, which might play an important role in SIRS (49). The proinflammatory cytokine TNF-
has also been known to up-regulate nitric oxide production (50). Interestingly, TNF-
produced by monocytic cells has been demonstrated to play a critical role in CpG DNA-induced SIRS and inflammatory arthritis (6,8,48). Moreover, previously we showed that priming with bacterial DNA dramatically enhances LPS-induced secretion of several cytokines, including TNF-
and IL-6, and can promote the SIRS (6). These results suggest that synergistic induction of SIRS and inflammatory arthritis by low doses of CpG DNA and LPS might be due to the production of large amounts of TNF-
by both innate stimulators through separate and/or shared pathways. In the present study, the murine monocytic cell lines RAW264.7 and J774 were used to investigate some aspects of the molecular mechanisms mediating the synergistic effects of CpG DNA and LPS on TNF-
biosynthesis.
TNF-
is the first cytokine produced by leukocytes upon stimulation by CpG DNA (Yi and Krieg, unpublished data). The levels of TNF-
mRNA in the spleen were dramatically increased within 30 min, and the serum levels of TNF-
protein were detected within 30 min and peaked within 1 h after the injection of CpG DNA in BALB/c mice (Yi and Krieg, unpublished data). As seen in vivo, CpG DNA is a strong TNF-
inducer in RAW264.7 cells. Like LPS, CpG DNA induced TNF-
secretion in RAW264.7 cells in a dose- dependent manner at concentrations as low as 0.03 µg/ml (~0.005 µM) (Fig. 1A
). In addition, a suboptimal concentration (5 ng/ml) of LPS synergizes with a broad concentration range (0.031 µg/ml) of CpG DNA for TNF-
production. Likewise, a suboptimal concentration (0.06 µg/ml) of CpG DNA synergizes with a broad dose range of LPS (0.1100 ng/ml) for TNF-
production (data not shown). This synergistic effect of CpG DNA and LPS for TNF-
production was also seen in another murine monocytic cell J774 (Fig. 1
). Of note, synergy between CpG DNA and LPS was seen not only for TNF-
production, but also for production of many other cytokines, including IL-6, IL-10, IL-12 and IFN-
, nitric oxide production, and B cell proliferation and Ig secretion (Figs 1 and 2![]()
) (49, and Yi and Krieg, unpublished data). Taken together, these data suggest the possibility that the innate immune response might have evolved synergistic activation to low LPS and CpG DNA concentrations to increase sensitivity to small infections. At higher concentrations of each agent, the magnitude of the synergy is reduced, which may help to reduce the risk of inducing SIRS. These synergistic effects at low concentrations also indicate that CpG DNA and LPS act through, at least in part, distinct intracellular biochemical signaling pathways.
Synergistic effects by simultaneous exposure to different bacterial components is not unique for CpG DNA and LPS. Several other reports demonstrated that bacterial products which are recognized by TLR-2, such as bacterial lipopeptides and lipoproteins, also synergize with LPS for inflammatory cytokine production (5153). In addition to these synergistic actions, lipopeptides and LPS induce cross-tolerance (53). Similar to this, pretreatment of CpG DNA also induces tolerance to later LPS-induced iNOS and TNF-
production (49,54). However, LPS pretreatment is less effective at induction of tolerance to CpG DNA (49,54). Molecular mechanisms of synergy and cross-tolerance between CpG DNA and LPS are poorly understood at the present time and of great interest.
Biosynthesis of TNF-
requires two types of signals. One signal induces transcription of its promoter and the second signal releases the translational repression imposed on the AU-rich region in the 3'-untranslated region (3'-UTR) of its mRNA (43,45,55). Previous studies have demonstrated that LPS-mediated biosynthesis of TNF-
is regulated at both the transcriptional and translational levels through activation of the transcription factor NF-
B, and MAPK including ERK and p38 (49,56). Like LPS, CpG DNA has been shown to activate NF-
B and MAPK within 30 min after stimulation in leukocytes (13,19,33,34,57). CpG DNA induces activation of both the TNF-
transcriptional reporter (5' TNF-
CAT) and the functional reporter, which is 3'-UTR of TNF-
linked to the 5' TNF-
CAT reporter gene (5' TNF-
CAT3'-UTR) (Fig. 3
and data not shown) indicating the ability of CpG DNA to induce TNF-
biosynthesis at both the transcriptional and the translational levels. In addition, our data demonstrated that low concentrations of CpG DNA and LPS additively induce TNF-
mRNA expression and activation of the TNF-
transcriptional reporter, 5' TNF-
CAT, indicating that at least part of the synergistic increase in production of TNF-
by these stimuli takes place at the transcriptional level (Fig. 3
). While we were revising this manuscript, Morrison and colleagues reported that bacterial DNA and LPS synergize for TNF-
production at the post-transcriptional level but not at the transcriptional level (54). However, this conclusion was based on indirect evidence from quantitating TNF-
mRNA levels by RT-PCR which is relatively insensitive to small differences, and they did not include studies to more directly assess the activity of the TNF-
promoter, as in our present study. In addition, those authors did not examine the effects of CpG and LPS on transcription factor function. While other differences between our experimental systems could also contribute to our different results, our data nevertheless support the conclusion of at least additive effects of CpG DNA and LPS on the TNF-
promoter.
Additive or synergistic activation of TNF-
transcription induced by low concentrations of CpG DNA and LPS could be due to activation of different transcription factors which up-regulate TNF-
expression and/or due to synergistic activation of one transcription factor by both CpG DNA and LPS. Both CpG DNA and LPS induce activation of the transcription factors AP-1, NF-
B and NF-IL-6 in murine and human leukocytes (13,19,34,48,5759, and Yi and Krieg, unpublished data). Consensus binding sites for the transcription factors AP-1, NF-AT, NF-
B and NFIL-6 are present in the TNF-
promoter (6062). Both CpG DNA and LPS at optimal concentrations induce nuclear DNA binding activity of AP-1 and NF-
B (p50/p65 heterodimers) in RAW264.7 cells (data not shown). Neither CpG DNA nor LPS induced the transcriptional activity of NF-AT in RAW264.7 cells in our experimental conditions (data not shown). At a substimulatory concentration, CpG DNA and LPS synergistically induced DNA binding activity of p65/p50 NF-
B heterodimers but not AP-1, NF-AT or NF-IL-6 (Fig. 4A
). This synergistic induction of DNA binding activity of nuclear NF-
B was also observed with high concentrations of CpG DNA and LPS treatments (Fig. 4B
). In addition to synergistically inducing the DNA binding activity of nuclear NF-
B, various concentrations of CpG DNA and LPS also synergistically induced the transcriptional activity of NF-
B (Fig. 5
). However, as for DNA binding activity, there was little or no significant enhancement in the AP-1 transcription activity by the same concentrations of CpG DNA and LPS (Figs 4 and 5![]()
). This synergistic NF-
B activation by CpG DNA and LPS suggests the presence of signaling pathways that are unique for each stimulus in addition to the known shared signaling pathway through MyD88 (31). Interestingly, recent studies demonstrated that CpG DNA, but not LPS, activates NF-
B through a wortmannin-sensitive DNA-PKcs-dependent pathway (32). Furthermore, wortmannin greatly suppresses TNF-
production induced by CpG DNA while it shows no effects on LPS-induced TNF-
production in RAW264.7 cells (Yi and Choi, unpublished data), indicating the presence of additional CpG DNA-triggered unique signaling pathways for NF-
B activation and subsequent TNF-
production.
It has been demonstrated that NF-
B activation plays a critical role in the TNF-
production induced by many stimuli including LPS (44,63). In addition, it has been speculated that CpG DNA-induced TNF-
production is due to its ability to activate NF-
B (57). Previous studies by us using pharmacological inhibitors of NF-
B also suggested a correlation between CpG DNA-induced NF-
B activation and TNF-
production (19). We now demonstrate directly that overexpression of a super-supressive I
B
mutant in RAW264.7 cells greatly, but not completely, inhibits the TNF-
promoter activity induced by CpG DNA (Fig. 6C
). These demonstrate the critical role of NF-
B activation in TNF-
biosynthesis at the transcriptional level. Furthermore, our study shows that CpG DNA and LPS-mediated synergistic activations of NF-
B and TNF-
promoter are also abolished by over-expression of I
B
-AA (Fig. 6B and D
). These results are compatible with the hypothesis that cooperative induction of TNF-
promoter activity by CpG DNA and LPS might be due to the synergistic activation of NF-
B by these stimuli.
Of note, CpG DNA-mediated transcriptional activity of NF-
B was completely inhibited by over-expression of I
B
-AA (Fig. 6A
), while AP-1 activation is unaffected (Fig. 6E
), demonstrating the functional and specific inhibitory activities of I
B
-AA. Compared to this, there is always residual CpG DNA-induced TNF-
promoter activity that is not inhibited by over-expression of I
B
-AA under the same conditions (Fig. 6C
), indicating NF-
B may be the major but not the sole transcription factor involved in the CpG DNA-induced TNF-
transcription in RAW264.7 cells. Recent studies have demonstrated regulatory effects of MAPK on the production of various cytokines through an activation of transcription factors, such as AP-1 and NF-
B, and/or a signal which releases the translational repression factor which acts on the AU-rich region in the 3'-UTR of cytokine mRNA (49,56,64). LPS-mediated ERK and p38 activation have been demonstrated to be involved in TNF-
biosynthesis at both the transcriptional and translational levels (49,56). Recently, it has been reported that pharmacological inhibitors of MEK, which is an upstream kinase of ERK, or of p38 suppress CpG DNA-induced TNF-
production, indicating the important role of MAPK in CpG DNA-mediated signaling pathways (3335). As in the LPS response, U0126, a MEK inhibitor, or SB202190, a p38 inhibitor, partially suppress CpG DNA-induced TNF-
promoter activation (Fig. 7
), suggesting the functional role of ERK and p38 in the TNF-
transcription induced by CpG DNA. However, in contrast to the present study, Hacker et al. (35) showed no significant inhibition of the CpG DNA-induced TNF-
transcription by PD98059, another MEK inhibitor, in RAW264.7 cells. This conflicting result between Hacker et al.'s and our study may be due to slightly different experimental conditions, different methods for analysis and/or different effects of inhibitors which block MEK activities through different mechanisms. The target transcription factors of p38 or ERK that mediate TNF-
transcription induced by CpG DNA are currently unknown. In our hands, U0126 at 2.5 µM, a submaximal concentration without affect on cell viability, slightly inhibits CpG DNA-induced transcriptional activities of NF-
B, while it greatly suppresses CpG DNA-induced transcriptional activities of AP-1. In contrast, SB202190 at 2.5 µM slightly suppresses CpG DNA-induced transcriptional activities of both NF-
B and AP-1. However, neither U0126 nor SB202190 inhibits DNA binding activities of nuclear NF-
B induced by CpG DNA in RAW264.7 cells (Yi and Krieg, manuscript in preparation). These studies suggest CpG DNA-induced NF-
B DNA binding activity is independent of either MEK or p38, but CpG DNA-induced NF-
B transcriptional activity is minimally dependent on p38 and MEK activation. As pointed out previously, addition of CpG DNA slightly, but not significantly, enhances LPS-induced AP-1 activation (Fig. 5D
), which might be correlated with the slight enhancement of ERK phosphorylation by LPS and CpG DNA in RAW264.7 cells. Currently, the role of AP-1 in the CpG DNA-mediated transcriptional activation of TNF-
is not yet fully understood.
Although the present study is focused on the synergistic regulation of TNF-
transcription via signals generated upon exposure to low concentrations of CpG DNA and LPS, the possibility of regulation of TNF-
biosynthesis at the translational level by ERK and p38 cannot be ruled out. Of note, CpG DNA does not activate ERK in J774 cells but does activate ERK in RAW264.7 cells (34). This lack of ERK activation by CpG DNA in J774 cells might be related to the lower level of TNF-
production in J774 cells compared to that in RAW264.7 cells. This also indicates that ERK activation may play a critical role in the CpG DNA-mediated TNF-
production at the post-transcriptional level in RAW264.7 cells. Furthermore, it is also possible that LPS-mediated ERK activation in J774 cells may contribute to the synergistic production of TNF-
by CpG DNA and LPS at the post-transcriptional level. Therefore, further investigation of the synergistic effects of CpG DNA and LPS on TNF-
production at the post-transcriptional level through ERK activation is of great interest.
Related to the observations that addition of LPS slightly enhances CpG DNA-mediated ERK phosphorylation without affecting phosphorylation of JNK and p38 in RAW264.7 cells (Fig. 8
), CpG DNA failed to alter LPS-mediated ERK, JNK and p38 activation in J774 cells (data not shown). In addition, unlike LPS which strongly activated ERK, CpG DNA does not activate ERK in J774 cells (34). Of note, CpG DNA- and LPS-mediated synergistic effects of the TNF-
transcriptional reporter activation were not suppressed by inhibition of either ERK or p38 (Fig. 7B
). Taken together, these observations suggest that CpG DNA and LPS might utilize some common pathways to activate MAPK, which is in agreement with recent reports using MyD88 gene-deficient mouse (31). However, these observations also suggest the presence of different signaling pathways for ERK activation by CpG DNA and LPS which are yet to be fully unrevealed.
In summary, the present study demonstrates that low concentrations of CpG DNA and LPS synergize for TNF-
production in the murine monocytic cell lines RAW264.7 and J774. This synergistic induction of TNF-
biosynthesis by CpG DNA and LPS is, at least partly, mediated at the transcriptional level though a synergistic activation of NF-
B which is demonstrated to play a critical role in the regulation of TNF-
transcription. In contrast to the synergistic activation of NF-
B, combinations of CpG DNA and LPS do not synergistically activate other upstream signaling modulators, including JNK and p38, which activate AP-1. These results suggest the presence of distinct as well as shared common pathways for the activation of NF-
B and MAPK by LPS and CpG DNA.
| Acknowledgments |
|---|
We thank Mi-Yeon Choi, Clifford Novak, Jenna Ryan and Sharon Setterquist for their excellent technical support, and Gail Dobbins for her outstanding secretarial support. A. K. Y. was supported by Crippled Children's Foundation Research Center at Le Bonheur Children's Hospital, and by grants from Arthritis National Research Foundation and NIH 1 R03 AR47757. S.-C. H. was supported by a grant from NIH RO1 DE13988. T. W. R. was supported by grants from Burroughs Welcome Fund and the American Foundation for Pharmaceutical Education. A. M. K. was supported through a Career Development Award from the Department of Veterans Affairs, and by grants from DARPA, the Coley Pharmaceutical Group, Inc. and NIH PO1 CA60570. Services were provided by the University of Iowa Diabetes and Endocrinology Center (NIH DK25295).
| Abbreviations |
|---|
| CAT chloramphenicol acetyl transferase |
| EMSA electrophoretic mobility shift assay |
| ERK extracellular receptor kinase |
| JNK c-Jun N-terminal kinase |
| LPS lipopolysaccharide |
| MAPK mitogen-activated protein kinase |
| MKK mitogen-activated protein kinase kinase |
| ROS reactive oxygen species |
| SIRS systemic inflammatory response syndrome |
| TLR toll-like receptor |
| TNF tumor necrosis factor |
| UTR untranslated region |
| Notes |
|---|
Transmitting editor: K. M. Murphy
Received 8 February 2001, accepted 31 July 2001.
| References |
|---|
|
|
|---|
- Krieg, A. M., Yi, A.-K., Matson, S., Waldscmidt, T., Bishop, G., Teasdale, R., Koretzky, G. A. and Klinman, D. 1995. CpG motifs in bacterial DNA trigger direct B cell activation. Nature 374:546.[Medline]
- Krieg, A. M. 1999. CpG DNA: a novel immunomodulator. Trends Microbiol. 7:64.[Web of Science][Medline]
- Krieg, Arthur M., Yi, A.-K. and Hartmann, G. 1999. Mechanisms and therapeutic applications of immune stimulatory CpG DNA. Pharmacol. Ther. 84:113.[Web of Science][Medline]
- Krieg, Arthur M., Hartmann, G. and Yi., A.-K. 1999. Mechanism of Action of CpG DNA. Curr. Top. Microbiol. Immunol. 247.
- Wagner, H. 1999. Bacterial CpG DNA activates immune cells to signal infections danger. Adv. Immunol. 73:329.[Web of Science][Medline]
- Cowdery, J. S., Chace, J. H., Yi, A.-K. and Krieg, A. M. 1996. Bacterial DNA induces NK cells to produce interferon-gamma in vivo and increases the toxicity of lipopolysaccharides. J. Immunol. 156:4570.[Abstract]
- Sparwasser, T., Miethke, T., Lipford, G., Borschert, K., Hacker, H., Heeg, K. and Wagner, H. 1997. Bacterial DNA causes septic shock. Nature 386:336.[Medline]
- Deng, G.-M., Nilsson, I. M., Verdrengh, M., Collins, L. V. and Tarkowski. A. 1999. Intra-articularly localized bacterial DNA containing CpG motifs induces arthritis. Nat. Med. 5:702.[Web of Science][Medline]
-
Klinman, D. M., Yi, A.-K., Beaucage, S. L., Conover, J. and Krieg, A. M. 1996. CpG motifs present in bacterial DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12, and interferon
. Proc. Natl Acad. Sci. USA 93:2879.[Abstract/Free Full Text] -
Yi, A.-K., Chace, J. H., Cowdery, J. S. and Krieg, A. M. 1996. IFN-
promotes IL-6 and IgM secretion in response to CpG motifs in bacterial DNA and oligodeoxynucleotides. J. Immunol. 156:558.[Abstract]
- Yi, A.-K., Hornbeck, P., Lafrenz, D. E. and Krieg, A. M. 1996. CpG DNA rescue of murine B lymphoma cells from anti-IgM induced growth arrest and programmed cell death is associated with increased expression of c-myc and bcl-xL. J. Immunol. 157:4918.[Abstract]
- Yi, A.-K., Klinman, D. M., Martin, T. L., Matson, S. and Krieg, A. M. 1996. Rapid immune activation by CpG motifs in bacterial DNA: systemic induction of IL-6 transcription through an antioxidant-sensitive pathway. J. Immunol. 157:5394.[Abstract]
-
Redford, T. W., Yi, A.-K., Ward, C. T. and Krieg, A. M. 1998. Cyclosporine A enhances IL-12 production by CpG motifs in Oligodeoxynucleotides. J. Immunol. 161:3930.
[Abstract/Free Full Text] -
Yi, A.-K., Chang, M., Peckham, D., Krieg, A. M. and Ashman, R. F. 1998. CpG oligodeoxyribonucleotides rescue mature murine spleen B cells from spontaneous apoptosis and promote cell cycle entry. J. Immunol. 160:5898.
[Abstract/Free Full Text] -
Yi, A.-K. and Krieg, A. M. 1998. CpG DNA rescue from anti-IgM induced WEHI-231 B lymphoma apoptosis via modulation of I
B
and I
Bß and sustained activation of nuclear factor-
B/c-Rel. J. Immunol. 160:1240.[Abstract/Free Full Text] -
Yi, A.-K., Peckham, D. W., Ashman, R. F. and Krieg, A. M. 1999. CpG DNA rescues B cells from apoptosis by activating NF
B and preventing mitochondrial membrane potential disruption via a chloroquine sensitive pathway. Int. Immunol. 11:2015.[Abstract/Free Full Text] - Krieg, A. M. and Yi, A.-K. 2000. Rescue of B cells from apoptosis by immune stimulatory CpG DNA. Semin. Immunophathol. 22:55.
- Anitescu, M., Chace, J. H., Tuetken, R., Yi, A.-K., Berg, D. J., Krieg, A. M. and Cowdery, J. S. 1997. IL-10 functions in vitro and in vivo to inhibit bacterial DNA-induced secretion of IL-12. J. Interferon Cytokine Res. 17:781.[Web of Science][Medline]
-
Yi, A.-K., Tuetken, R., Redford, T., Waldschmidt, M., Kirsch, J. and Kreig, A. M. 1998. CpG motifs in bacterial DNA activate leukocytes through the pH-dependent generation of reactive oxygen species. J. Immunol. 160:4755.
[Abstract/Free Full Text] - Hartman, G. and Krieg, A. M. 1999. CpG DNA and LPS induce distinct patterns of activation in human monocytes. Gene Therapy 6:893.[Web of Science][Medline]
-
Hartman, G., Weiner, G. J. and Kreig, A. M. 1999. CpG DNA: a potent signal for growth, activation, and maturation of human dendritic cells. Proc. Natl Acad. Sci. USA 96:9305.
[Abstract/Free Full Text] - Ballas, Z. K., Rasmussen, W. L. and Krieg, A. M. 1996. Induction of NK activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J. Immunol. 157:1840.[Abstract]
-
Krieg, A. M., Love-Homan, L., Yi, A.-K. and Harty, J. T. 1998. CpG DNA induces sustained IL-12 expression in vivo and resistance to L. monocytogenes challenge. J. Immunol. 161:2428.
[Abstract/Free Full Text] -
Brazolot-Millian, C. L., Weeratna, R., Krieg, A. M., Siegrist, C. A. and Davis, H. L. 1998. CpG DNA can induce strong Th1 humoral and cell-mediated immune responses against hepatitis B surface antigen in young mice. Proc. Natl Acad. Sci. USA 95:15553.
[Abstract/Free Full Text] - Jakob, T., Walker, P. S., Krieg, A. M., vonStebut, E., Udey, M. C. and Vogel, J. C. 1999. Bacterial DNA and CpG-containing oligodeoxynucleotides activate cutaneous dendritic cells and induce IL-12 production: implications for the augmentation of Th1 responses. Int. Arch. Allergy Immunol. 118:457.[Web of Science][Medline]
- Aderem, A. and Ulevitch, R. J. 2000. Toll-like receptors in the induction of the innate immune response. Nature 406:782.[Medline]
-
Poltorak, A., He, X., Smirnova, I., Liu, M.-Y., Huffel, C. V., Du, X., Birdwell, D., Alejos, E., Silva, M., Galanos, C., Freudenberg, M., Ricciardi-Castagnoli, P., Layton, B. and Beutler, B. 1998. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282:2085.
[Abstract/Free Full Text] - Takeuchi, O., Hoshino, K., Kawai, T., Sanjo, H., Takada, H., Ogawa, T., Takeda, K. and Akira, S. 1999. Differential roles of TLR2 and TLR4 in recognition of gram-negative and gram-positive bacterial cell wall components. Immunity 443.
-
Poltorak, A., Ricciardi-Castagnoli, P., Citterio, S. and Beutler, B. 2000. Physical contact between lipopolysaccharide and Toll-like receptor 4 revealed by genetic complementation. Proc. Natl Acad. Sci. USA 97:2163.
[Abstract/Free Full Text] - Hemmi, H., Takeuchi, O., Kawai, T., Kaisho, T., Sato, S., Sanjo, H., Matsumoto, M., Hoshino, K., Wagner, H., Takeda, K. and Akira, S. 2000. A toll-like receptor recognizes bacterial DNA. Nature 408:740.[Medline]
-
Hacker, H., Vabulas, R. M., Takeuchi, O., Hoshino, K., Akira, S. and Wagner, H. 2000. Immune cell activation by bacterial CpG-DNA through myeloid differentiation marker 88 and tumor necrosis factor receptor-associated factor (TRAF)6. J. Exp. Med. 192:595.
[Abstract/Free Full Text] - Chu, W.-M., Gong, X., Li, Z.-W., Takabayashi, K., Ouyang, H.-H., Chen, Y., Lois, A., Chen, D. J., Li, G. C., Karin, M. and Raz, E. 2000. DNA-PKcs is required for activation of innate immunity by immunostimulatory DNA. Cell 103:909.[Web of Science][Medline]
- Hacker, H., Mischak, H., Miethke, T., Liptay, S., Schmid, R., Sparwasser, T., Heeg, K., Lipford, G. B. and Wagner, H. 1998. CpG DNA specific activation of antigen presenting cells requires stress kinase activity and is preceded by non-specific endocytosis and endosomal maturation. EMBO J. 17:6230.[Web of Science][Medline]
-
Yi, A.-K. and Krieg, A. M. 1998. Rapid induction of mitogen activated protein kinases by immune stimulatory CpG DNA. J. Immunol. 161:4493.
[Abstract/Free Full Text] - Hacker, H., Mischak, H., Hacker, G., Eser, S., Prenzel, N., Ullrich, A. and Wagner, H. 1999. Cell type-specific activation of mitogen-activated protein kinases by CpG-DNA controls interleukin-12 release from antigen-presenting cells. EMBO J. 18:6973.[Web of Science][Medline]
- Beutler, B. 1993. Endotoxin, tumor necrosis factor, and related mediators: new approaches to shock. New Horiz. 1:3.[Medline]
- Lee, J. R. and Koretzky, G. A. 1998. Production of reactive oxygen intermediates following CD40 ligation correlates with c-Jun N-terminal kinase activation and IL-6 secretion in murine B lymphocytes. Eur. J. Immunol. 28:4188.[Web of Science][Medline]
- Beutler, B. and Brown, T. 1991. A CAT reporter construct allows ultrasensitive estimation of TNF synthesis, and suggests that the TNF gene has been silenced in non-macrophage cell lines. J. Clin. Invest. 87:1336.
-
Hsing, Y. and Bishop, G. A. 1999. Requirement for nuclear factor-
B activation by a distinct subset of CD40-mediated effector functions in B lymphocytes. J. Immunol. 162:2804.[Abstract/Free Full Text] -
Olsson, C., Riebeck, K., Dohlsten, M. and Michaelsson, E. 1999. CTLA-4 ligation suppresses CD28-induced NF-
B and AP-1 activity in mouse T cell blasts. J. Biol. Chem. 274:14400.[Abstract/Free Full Text] -
Park, J., Takeuchi, A. and Sharma, S. 1996. Characterization of a new isoform of the NF-AT (nuclear factor of activated T cells) gene family member NF-ATc. J. Biol. Chem. 271:20914.
[Abstract/Free Full Text] -
Plaisance, S., Berghe, W. V., Boone, E., Fiers, W. and Haegeman, G. 1997. Recombination signal sequence binding protein J
is constitutively bound to the NF-
B site of the interleukin-6 promoter and acts as a negative regulatory factor. Mol. Cell. Biol. 17:3733.[Abstract]
-
Raabe, T., Bukrinsky, M. and Currie, R. A. 1998. Relative contribution of transcription and translation to the induction of tumor necrosis factor-
by lipopolysaccharide. J. Biol. Chem. 273:974.[Abstract/Free Full Text] -
Collart, M. A., Baeuerle, P. and Vassalli, P. 1990. Regulation of tumor necrosis factor alpha transcription in macrophages: involvement of four
B like motifs and of constitutive and inducible forms of NF-
B. Mol. Cell. Biol. 10:1498.[Abstract/Free Full Text] - Geppert, T. D., Whitwhurst, C. E., Thompson, P. and Beutler, B. 1994. Lipopolysaccharide signals activation of tumor necrosis factor biosynthesis through the Ras/Raf-1/MEK/MAPK pathway. Mol. Med. 1:93.[Web of Science][Medline]
- Krieg, A. M., Yi, A.-K. and Hartmann, G. 1999. Mechanisms and therapeutic applications of immune stimulatory CpG DNA. Pharmacol. Ther. 84:113.
- Krieg, A. M., Yi, A.-K., Schorr, J. and Davis, H. 1998. The role of CpG dinucleotides in DNA vaccines. Trends Microbiol. 6:23.[Web of Science][Medline]
-
Sparwasser, T., Miethke, T., Lipford, G., Erdmann, A., Hacker, H., Heeg, K. and Wagner, H. 1997. Macrophages sense pathogens via DNA motifs: induction of tumor necrosis factor-
-mediated shock. Eur. J. Immunol. 27:1671.[Web of Science][Medline]
-
Gao, J. J., Zuvanich, E. G., Xue, Q., Horn, D. L., Silverstein, R. and Morrison, D. C. 1999. Bacterial DNA and LPS act in synergy in inducing nitric oxide production in Raw 264.7 macrophages. J. Immunol. 163: 4095.
[Abstract/Free Full Text] - Corradin, S. B., Fasel, N., Buchmuller-Rouiller, Y., Ransijn, A., Smith, J. and Mauel, J. 1993. Introduction of macrophage nitric oxide production by interferon-gamma and tumor necrosis factor-alpha is enhanced by interleukin-10. Eur. J. Immunol. 23:2045.[Web of Science][Medline]
- Kreutz, M., Ackermann, U., Hauschildt, S., Krause, S. W., Riedel, D., Bessler, W. and Andreesen, R. 1997. A comparative analysis of cytokine production and tolerance induction by bacterial lipopeptides, lipopolysaccharides and Staphylococus aureus in human monocytes. Immunology 92:396.[Web of Science][Medline]
- Zhang, H., Peterson, J. W., Miesel, D. W. and Klimpel, G. R. 1997. Bacterial lipoprotein and lipopolysaccharide act synergistically to induce lethal shock and proinflammatory cytokine production. J. Immunol. 159:4868.[Abstract]
-
Sato, S., Nomura, F., Kawai, T., Takeuchi, O., Muhlradt, P. F., Takeda, K. and Akira, S. 2000. Synergy and cross-tolerance between toll-like receptor (TLR) 2- and TLR4-mediated signaling pathways. J. Immunol. 165:7096.
[Abstract/Free Full Text] -
Gao, J. J., Xue, Q., Papasian, C. J. and Morrison, D. C. 2001. Bacterial DNA and lipopolysaccharide induce synergistic production of TNF-
through a post-transcriptional mechanism. J. Immunol. 166:6855.[Abstract/Free Full Text] -
Han, J., Brown, T. and Beutler, B. 1990. Endotoxin-responsive sequences control cachectin/TNF biosynthesis at the translational level. J. Exp. Med. 171:465.
[Abstract/Free Full Text] - Lee, J. C., Laydon, J. T., McDonnell, P. C., Gallagher, T. F., Kumar, S., Green, D., McNulty, D., Blumenthat, M. J., Heys, J. R., Sandvatter, S. W., Strickler, J. E., McLaughlin, M. M., Siemens, I. R., Fisher, S. M., Livi, G. P., White, J. R., Adams, J. L. and Young, P. R. 1994. A protein kinase involved in the regulation of inflammatory cytokine biosynthesis. Nature 372:739.[Medline]
- Stacey, K. J., Sweet, M. J. and Hume, D. A. 1996. Macrophages ingest and are activated by bacterial DNA. J. Immunol. 157:2116.[Abstract]
- Takeshita, F., Ishii, K. J., Ueda, A., Ishigatsubo, Y. and Klinman, D. M. 2000. Positive and negative regulatory elements contribute to CpG oligonucleotide-mediated regulation of human IL-6 gene expression. Eur. J. Immunol. 30:108.[Web of Science][Medline]
-
Hartmann, G, and Krieg, A. M. 2000. Mechanism and function of a newly identified CpG DNA motif in human primary B cells. J. Immunol. 164:944.
[Abstract/Free Full Text] -
Rhoades, K. L., Golub, S. and Economou, J. 1992. The regulation of the human tumor necrosis factor promoter region in macrophage, T cell, and B cell lines. J. Biol. Chem. 267:22102.
[Abstract/Free Full Text] - Takashiba, S., Shapira, L., Salomon, A. and Van Dyke, T. 1993. Cloning and characterization of human TNF promoter region. Gene 131:307.[Web of Science][Medline]
- Tsai, E. Y., Yie, J., Thanos, D. and Goldfeld, A. E. 1996. Cell type specific regulation of the human tumor necrosis factor alpha gene in B cells and T cells by NF-ATp and ATF-2/JUN. Mol. Cell. Biol. 16:5232.[Abstract]
- Trede, N. S., Tsytsykova, A. V., Chatila, T., Goldfeld, A. E., Geha, R. S. 1995. Transcriptional activation of the human TNF-alpha promoter by superantigen in human monocytic cells: role of NF-kappa B. J. Immunol. 155:902.[Abstract]
-
Swantek, J., Cobb, M. and Geppert, T. 1997. Jun N-terminal kinase/stress-activated protein kinase (JNK/SAPK) is required for lipopolysaccharide stimulation of tumor necrosis factor alpha (TNF-
) translation: glucocorticoids inhibit TNF-
translation by blocking JNK/SAPK. Mol. Cell. Biol. 17:6274.[Abstract]
This article has been cited by other articles:
![]() |
S. M. Makela, M. Strengell, T. E. Pietila, P. Osterlund, and I. Julkunen Multiple signaling pathways contribute to synergistic TLR ligand-dependent cytokine gene expression in human monocyte-derived macrophages and dendritic cells J. Leukoc. Biol., April 1, 2009; 85(4): 664 - 672. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Liu, G. P. Anderson, and S. Bozinovski DNA Vector Augments Inflammation in Epithelial Cells via EGFR-Dependent Regulation of TLR4 and TLR2 Am. J. Respir. Cell Mol. Biol., September 1, 2008; 39(3): 305 - 311. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wang, H. Zhou, J. Zheng, J. Cheng, W. Liu, G. Ding, L. Wang, P. Luo, Y. Lu, H. Cao, et al. The Antimalarial Artemisinin Synergizes with Antibiotics To Protect against Lethal Live Escherichia coli Challenge by Decreasing Proinflammatory Cytokine Release. Antimicrob. Agents Chemother., July 1, 2006; 50(7): 2420 - 2427. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Dalpke, J. Frank, M. Peter, and K. Heeg Activation of Toll-Like Receptor 9 by DNA from Different Bacterial Species Infect. Immun., February 1, 2006; 74(2): 940 - 946. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Kim, N. I. Kim, Y.-K. Oh, Y.-J. Kim, J. Youn, and M.-J. Ahn CpG oligodeoxynucleotides induce IL-8 expression in CD34+ cells via mitogen-activated protein kinase-dependent and NF-{kappa}B-independent pathways Int. Immunol., December 1, 2005; 17(12): 1525 - 1531. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Li, Z. Ma, Z.-L. Tang, T. Stevens, B. Pitt, and S. Li CpG DNA-mediated immune response in pulmonary endothelial cells Am J Physiol Lung Cell Mol Physiol, September 1, 2004; 287(3): L552 - L558. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Scheller, A. Ullrich, K. McPherson, B. Hefele, J. Knoferle, S. Lamla, A. R. M. Olbrich, H. Stocker, K. Arasteh, V. t. Meulen, et al. CpG Oligodeoxynucleotides Activate HIV Replication in Latently Infected Human T Cells J. Biol. Chem., May 21, 2004; 279(21): 21897 - 21902. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. F. Passos, E. S. Fernandes, M. M. Campos, J. G. V. C. Araujo, J. L. Pesquero, G. E. P. Souza, M. C. W. Avellar, M. M. Teixeira, and J. B. Calixto Kinin B1 Receptor Up-Regulation after Lipopolysaccharide Administration: Role of Proinflammatory Cytokines and Neutrophil Influx J. Immunol., February 1, 2004; 172(3): 1839 - 1847. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. L. Hertoghs, J. H. Ellis, and I. R. Catchpole Use of locked nucleic acid oligonucleotides to add functionality to plasmid DNA Nucleic Acids Res., October 15, 2003; 31(20): 5817 - 5830. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Xu, H. An, Y. Yu, M. Zhang, R. Qi, and X. Cao Ras Participates in CpG Oligodeoxynucleotide Signaling through Association with Toll-like Receptor 9 and Promotion of Interleukin-1 Receptor-associated Kinase/Tumor Necrosis Factor Receptor-associated Factor 6 Complex Formation in Macrophages J. Biol. Chem., September 19, 2003; 278(38): 36334 - 36340. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-J. Yeo, D. Gravis, J.-G. Yoon, and A.-K. Yi Myeloid Differentiation Factor 88-dependent Transcriptional Regulation of Cyclooxygenase-2 Expression by CpG DNA: ROLE OF NF-{kappa}B AND p38 J. Biol. Chem., June 13, 2003; 278(25): 22563 - 22573. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bjerre, B. Brusletto, R. Ovstebo, G. B. Joo, P. Kierulf, and P. Brandtzaeg Identification of meningococcal LPS as a major monocyte activator in IL-10 depleted shock plasmas and CSF by blocking the CD14-TLR4 receptor complex Innate Immunity, June 1, 2003; 9(3): 155 - 163. [Abstract] [PDF] |
||||
![]() |
W. Zou, A. Amcheslavsky, and Z. Bar-Shavit CpG Oligodeoxynucleotides Modulate the Osteoclastogenic Activity of Osteoblasts via Toll-like Receptor 9 J. Biol. Chem., May 2, 2003; 278(19): 16732 - 16740. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-K. Yi, J.-G. Yoon, and A. M. Krieg Convergence of CpG DNA- and BCR-mediated signals at the c-Jun N-terminal kinase and NF-{kappa}B activation pathways: regulation by mitogen-activated protein kinases Int. Immunol., May 1, 2003; 15(5): 577 - 591. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-K. Yi, J.-G. Yoon, S.-J. Yeo, S.-C. Hong, B. K. English, and A. M. Krieg Role of Mitogen-Activated Protein Kinases in CpG DNA-Mediated IL-10 and IL-12 Production: Central Role of Extracellular Signal-Regulated Kinase in the Negative Feedback Loop of the CpG DNA-Mediated Th1 Response J. Immunol., May 1, 2002; 168(9): 4711 - 4720. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

) or absence (
) of 0.6 µg/ml of CpG DNA for 6 h. (B) J774 cells (5x106 cells/ml) were stimulated with various concentrations of CpG DNA (030 µg/ml) in the presence (
) of 5 ng/ml of LPS for 6 h. (B) RAW264.7 cells were stimulated with various concentrations of control non-CpG DNA in the presence (














