International Immunology

This Article Abstract FREE Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (44) Request Permissions Google Scholar Articles by Udono, H. Articles by Yui, K. Search for Related Content PubMed PubMed Citation Articles by Udono, H. Articles by Yui, K. Social Bookmarking          What's this?

International Immunology, Vol. 13, No. 10, 1233-1242, October 2001
© 2001 Japanese Society for Immunology

Generation of cytotoxic T lymphocytes by MHC class I ligands fused to heat shock cognate protein 70

Heiichiro Udono, Taketoshi Yamano, Yuko Kawabata, Masakatsu Ueda and Katsuyuki Yui

Department of molecular medicine, Division of Immunology, Nagasaki University School of Medicine, 1-12-4 Sakamoto, Nagasaki 852-8523, Japan

Correspondence to: Correspondence to: H. Udono

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Immunization with gp96 and heat shock cognate protein 70 (hsc70) purified with in vivo bound naturally occurring peptides or bound to synthetic peptides by in vitro reconstitution has been shown to induce peptide-specific cytotoxic T lymphocytes (CTL). In addition, mycobacterial heat shock protein 70 covalently fused to ovalbumin (OVA)-derived fragments has been shown to generate MHC class I-restricted CTL responses. Here, we genetically fused five different CTL epitopes, including peptides derived from Plasmodium yoelii circumsporozoite protein, tumor antigens, HY antigen and OVA, to either the N- or C-terminus of murine hsc70 and expressed the resulting proteins in Escherichia coli. Vaccination with all five fusion proteins induced peptide-specific CTL, indicating that no cognate flanking regions of CTL epitopes are necessary for the immune response. The point of injection was crucial for CTL induction. CD4⁺ T cells were not required for the priming of CD8⁺ T cells and vaccination with bone marrow-derived dendritic cells pulsed with hsc70 fusion proteins also elicited CTL responses. Furthermore, by using deletion mutants of hsc70, we identified amino acid residues 280–385 of hsc70 as the region most critical for inducing the CTL response.

Keywords: antigen presentation, cellular immunity, peptide, stress protein, vaccine

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Immunization with endogenous peptides bound in vivo to heat shock proteins (hsps), or with synthetic peptides reconstituted with hsps in vitro, primes antigen-specific CD8⁺ T cells in an adjuvant-free manner (1–5). The priming of CD8⁺ T cells is thought to be mediated by a subset of macrophages or dendritic cells through receptor-mediated internalization of the hsp–peptide complex (6,7). The endogenous peptides associated with hsps seem to be final-sized MHC class I ligands or their precursors (8,9) and the interaction is ATP-sensitive in the case of heat shock cognate protein 70 (hsc70) (10,11). Thus, ATP-treated hsc70 loses its immunogenicity (10,11).

A similar, but conceptually different approach of vaccination with hsp peptide complexes has been reported by Suzue et al. They showed that mycobacterial hsp70 fused to ovalbumin (OVA) 161–276 elicits cytotoxic T lymphocyte (CTL) responses specific to K^b-restricted OVA257–264 (12). It has been suggested that the immune response is not brought about by the ATPase nor the peptide-binding function of hsp70, but is directly associated with a 200-amino-acid sequence located in the C-terminal region of the ATPase domain (13). Although hsp70 is highly conserved across eukaryotes, there is <50% homology between the amino acid sequences of mycobacterial hsp70 and the murine heat shock cognate protein (hsc70). We therefore considered whether the immune-response properties of mycobacterial hsp70 would be shared by murine hsc70.

It is also unclear whether either the N- or C-terminal flanking regions of CTL epitopes are necessary for the priming of CD8⁺ T cells by hsp fusion proteins. These flanking regions have been shown to affect antigen presentation in some cases (14,15). It is well known that both gp96 and hsc70 reconstituted with CTL epitopes in vitro elicit specific CTL (2). However, More et al. have reported that, in contrast to gp96 purified from cells expressing antigens, recombinant gp96 fused to CTL epitopes at the C-terminus without any flanking region has limited success in CTL priming in vivo (16). Peptides associated with gp96 in the endoplasmic reticulum are passed through TAP (transporter associated with antigen processing) molecules (17,18), indicating that their sizes must be very close to those of final-stage MHC class I ligands. Hence, peptides bound to gp96 that have been purified from cells do not need further processing by the proteasome after internalizaton by APC, regardless of whether they are released by protease digestion of gp96 or by an ATP-sensitive mechanism. In contrast, CTL epitopes that are fused to gp96 must be enzymatically processed to become MHC class I ligands. It has been demonstrated that the 20S proteasome is required in cross-priming by protein antigens in vivo (19). If this is the case for hsp70 fusion proteins, either the N- or C-terminal, or both cognate flanking regions of CTL epitopes may be essential for the production of precise epitopes. Thus, it remains unclear how the maximum priming of CD8⁺ T cells can be effected in vivo through the use of hsps.

Here, we have constructed fusion genes comprising murine hsc70 and five different CTL epitopes of exact size, and have expressed the proteins in Escherichia coli. Strong CTL specific to the fused epitopes were generated by vaccination with all five hsc70 fusion proteins, suggesting that no epitope-flanking regions are required. In addition, we carried out experiments with fusion proteins comprising deletion mutants of hsc70 to determine the region(s) of hsc70 involved in CTL generation.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Cell lines
EL4 is a methylchoranthrene-induced thymoma of C57BL/6 (H-2^b) origin (20). E.G7 is an OVA cDNA transfected EL4 cell line (21). RL1 is a radiation-induced leukemia of BALB/c origin (H-2^d) (22). B16 is a melanoma cell line derived from C57BL/6 (23). P815 is a mast cell cytoma derived from DBA/2 (H-2^d) (24).

Media and cell culture
RPMI 1640 was supplemented with glutamine, non-essential amino acids, sodium pyruvate, antibiotics (all from Gibco/BRL, Tokyo, Japan), 10% FCS and 5x10^-5 M 2-mercaptoethanol. This complete RPMI media was used for CTL induction and tumor cell culture. E.G7 was cultured in the presence of 400 µg/ml G418.

Reagents
Carrageenan (type II) was purchased from Sigma (St Louis, MO). Synthetic peptides OVA257–264 (SIINFEKL) (25), HY (KCSRNRQ) (26), TRP2 (VYDFFVWL) (27) and Plasmodium yoelii circumsporozoite (CS) protein-derived peptide (SYVPSAEQI) (28) were purchased from Sawady (Tokyo, Japan), and had 90% purity. Their sequences were confirmed by a 490 Procise protein sequencer (Perkin-Elmer, Tokyo, Japan). pRL1a was a kind gift from Dr. E. Nakayama (Okayama University Medical School, Japan).

Expression and purification of hsc70 and its deletion mutants fused to CTL epitopes
Murine cDNA of hsc70 and PA28 was generated by RT-PCR of mRNA obtained from spleen cells. Total RNA was extracted from mouse spleen cells by an Isogen kit (Wako, Osaka, Japan) according to the manufacturer's protocol. The RNA was transcribed to cDNA with oligo(dT)₁₆ primer by AMV reverse transcriptase (Promega, Tokyo, Japan). cDNA encoding hsc70 was amplified by LA Taq polymerase (Takara, Tokyo, Japan) using the primers ATGGATCCCATGTCTAAGGGACCT (forward) and ATGGTACCATGGACTGACTTAATCC (reverse). cDNA encoding PA28 was also amplified by LA Taq polymerase using the primers ATGGATCCCATGGCCACACTGAGGG (forward) and ATGGTACCTCAATAGATCATTCCCTTTG (reverse). The amplified cDNA was cloned into pQE31 expression vector (Qiagen, Tokyo, Japan) at 5' BamHI and 3' KpnI restriction sites. For fusion proteins of hsc70, PA28 and CTL epitopes, all mini-genes encoding CTL epitopes were incorporated in either forward or reverse primers containing 5' BamHI and 3' KpnI restriction sites. E. coli strain M15 was transformed by the constructed plasmids, and grown in LB medium containing ampicillin (50 µg/ml) and kanamycin (20 µg/ml). Protein expression was induced by 0.1 M isopropyl-ß-D-thiogalactoside. The protein was solubilized in buffer B (8 M urea, 0.1 M sodium phosphate, 0.01 M Tris–HCl, pH 8.0), and after centrifugation of the lysate at 10,000 g, the supernatant was applied to an Ni²⁺-NTA (nitrilotriacetic acid) agarose column and extensively washed with buffer C (8 M urea, 0.1 M sodium phosphate, 0.01 M Tris–HCl, pH 6.3). The Ni²⁺-NTA resin-bound 6xHis-tagged protein was refolded rapidly by washing with 15 column volumes of urea-free Tris buffer (pH 7.5) and eluted with Tris buffer containing 200 mM imidazole. The eluate was extensively dialyzed against PBS (pH 7.4) to remove imidazole and concentrated by an Ultrafree-15 centrifugal filter device (Millipore, Bedford, MA) before being used for vaccination.

Vaccination and induction of CTL
B6 or BALB/c mice were immunized twice with a 1-week interval with 1 to 10 µg of either wild-type hsc70 or different hsc70-deletion mutants fused to a CTL epitope, or hsc70 reconstituted with a peptide in vitro as described previously (2). Intravenous injection of fusion proteins was found to be a better route of vaccination than either s.c. or i.d. injection, as shown in Fig. 3. In some cases, mice were immunized i.p. with 1x10⁶ bone marrow-derived dendritic cells pulsed with either 1.2 µg/ml peptides or 100 µg/ml hsc70 fusion proteins for 2 h at 37°C with 5% CO₂.

View larger version (21K): [in this window] [in a new window]   Fig. 3. Intravenous injection is the most effective route for inducing CTL. BALB/c mice were immunized twice with a 1-week interval with hsc70–PYE (a, c, e, g and i) or PYE–hsc70 (b, d, f, h and j) via different injection routes, as indicated (for s.c. and i.v., the first immunization was s.c. and the second was i.v.). (k) Mice were immunized 11 times with irradiated salivary sporozoites and eventually became resistant to the substantial challenge of 50 live sporozoites. (l) Mice were immunized with wild-type hsc70.

 
Dendritic cells were obtained by culturing bone marrow cells with 500 U/ml granulocyte macrophage colony stimulating factor in 24-well plates (1.5x10⁶ cells/well/2ml) for 8 days. This procedure produced up to 70% CD11c⁺ cells, as detected by FACS analysis (data not shown). Between 1 and 2 weeks after the second immunization, the spleen cells were stimulated in vitro with each peptide at 10^–6 M final concentration for 6 days at 37°C with 5% CO₂.

Depletion of T cells or macrophages in vivo
Ascites fluid containing anti-CD4 (GK1.5) mAb (50 µl) was diluted 1:4 with PBS and injected into the retro-orbital sinuses of mice. The depletion of CD4⁺ T cells using this procedure is immediate and lasts for 2 weeks, after which the T cell subsets gradually recover. The recovery of CD4⁺ T cells was >50% of the original CD4⁺ population at day 45, as described previously (29). For functional inhibition of macrophages, 1 mg of carrageenan was injected i.p. as described previously (29).

⁵¹Cr-release and ELISPOT assay
The cytolytic activity of the induced CTL was determined by a standard ⁵¹Cr-release assay. Target cells were labeled with 50 µCi ⁵¹Cr-labeled sodium chromate in RPMI with 10% FCS for 1 h at 37°C and then washed twice with plain RPMI. Target cells (5x10³) were added to a titration of CTL effectors in 96-well round-bottom plates in a final volume of 200 µl RPMI with 10% FCS, centrifuged to promote cell contact and incubated at 37°C for 4 h. Then 100 µl of supernatant in each well was harvested manually. Radioactivity released into the supernatant was measured in a -counter, and the percent specific release was calculated from the mean of duplicate cultures according to the following formula: percent specific release = (experimental release – spontaneous release)x100/[maximal release (1% NP-40) – spontaneous release]. For ELISPOT assay, HA-Multiscreen plates (Millipore, Burlington, MA) were coated with 50 µl of anti-mouse IFN- antibody (10 µg/ml; RMMG1) in PBS, incubated overnight at 4°C, washed with PBS/0.25% Tween 20 to remove unbound antibody and blocked with 100 µl/well PBS containing 5% BSA for 1 h at 37°C. Spleen cells were pulsed with or without 10 µg/ml peptides for 2 h in a serum-free medium and plated in triplicates at a concentration of 1x10⁶/well in the presence of 1 µg/ml final concentration of peptides and 10% FCS. After incubation for 40 h at 37°C with 5% CO₂, the plates were extensively washed with PBS/0.25% Tween 20 and 100 µl/well biotinylated detecting antibody against mouse IFN- (1 µg/ml; R46A2) was added. After 2 h incubation at room temperature, the plate was washed with PBS/0.25% Tween 20, and 50 µl/well avidin solution (alkaline phosphatase conjugated) was added and incubated for 2 h. Spot development was performed using NBT/BCIP. Spots were counted using a stereomicroscope at x40 magnification.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Determination of the optimal fusion end of hsc70 and of the most effective vaccine route for generating CTL
Five different CTL epitopes fused to hsc70 are shown in Table 1. Initially, we determined whether the N- or C-terminus of hsc70 was a better site for the fusion of CTL epitopes; we also determined which route of vaccination was more effective for inducing CTL. The gene construct for encoding fusion proteins comprising a CTL epitope and hsc70 is shown in Fig. 1(A). CS protein-derived, K^d-restricted epitope (PYE) was fused to either the N- or C-terminus of hsc70 (PYE–hsc70 and hsc70–PYE ) and expressed in E. coli. The recombinant proteins were purified with Ni²⁺-NTA column as described in Methods. Figure 2(A) shows the Coomassie-stained SDS–PAGE gels of purified hsc70, hsc70–PYE and PYE–hsc70 proteins.

View this table: [in this window] [in a new window]   Table 1. CTL epitope used in this study.

 

View larger version (21K): [in this window] [in a new window]   Fig. 1. Construction of plasmids encoding hsc70-CTL epitope fusion genes and vaccination protocol for the fusion proteins. A mini-gene encoding a CTL epitope (PYE) was incorporated between a 6xHis-tag and the hsc70 gene; in addition, five different mini-genes encoding CTL epitopes (see Table 1) were fused to the C-terminus of the hsc70 gene. These fusion genes were inserted into the pQE31 expression vector via 5' BamHI and 3' KpnI restriction sites. BALB/c mice were immunized twice with a 1-week interval with 1 or 10 µg of each fusion protein. Between 1 and 2 weeks after the second immunization, spleen cells were removed and stimulated in vitro for 6 days with the corresponding peptides. Cytolytic activities were determined by a standard 51Cr-release assay. The number of IFN--producing CD8+ T cells was measured by ELISPOT assay, for which spleen cells were stimulated with the corresponding peptide for 40 h.

 

View larger version (48K): [in this window] [in a new window]   Fig. 2. SDS–PAGE of hsc70 fusion proteins. Wild-type and deletion mutants of hsc70 fused to CTL epitopes were separated on 10% SDS–PAGE gels and the proteins were visualized with Coomassie blue. (A) Lane 1, hsc70; lane 2, PYE–hsc70; lane 3, hsc70–PYE; M, marker. (B) Lane 1, ATPase domain of hsc70; lane 2, peptide-binding domain of hsc70; lanes 3–5, hsc70 lacking the N-terminal 100, 200 and 300 amino acids respectively. The hsc70 deletion mutants were fused to PYE at their C-terminus.

 
As shown in Fig. 1(B), BALB/c mice were immunized by different administrative route: s.c., i.d. or i.v. The mice received two 1-µg injections of the fusion protein at a 1-week interval and 1–2 weeks after the second injection the spleen cells were stimulated in vitro with PYE peptide for 6 days. Cytolytic activity against P815 cells pulsed with or without PYE peptide was determined by a standard ⁵¹Cr-release assay. Surprisingly, i.v. injection was the most powerful route of vaccination (Fig. 3i and j) and the C-terminus of hsc70 seemed a better fusion site for the CTL epitope (Fig. 1c and d). Repetitive immunization with irradiated salivary-derived sporozoites, through which the mice became resistant to challenge of 50 live sporozoites, showed only marginal CTL activity (Fig. 3k). Injection of hsc70 did not confer CTL activity at all (Fig. 3l). We confirmed that i.v. vaccination was the best route for administration by ELISPOT assay. As shown in Fig. 4, the number of IFN--producing CD8⁺ T cells by i.v. injection was higher than that by s.c. injection. In addition, immunization seemed to be dose dependent between 10 and 1 µg of fusion protein (Fig. 4). Notably, i.p. injection also generated IFN--producing CD8⁺ T cells very efficiently (Fig. 4). Taking these results together, we determined the best vaccination route to be i.v. and the best fusion site for CTL epitopes to be the C-terminus of hsc70, which we used in the following experiments.

View larger version (20K): [in this window] [in a new window]   Fig. 4. IFN--producing cells are generated by i.v. and i.p. injection of hsc70 fusion proteins. Mice were immunized twice with 10 or 1 µg hsc70–PYE via different injection routes, as indicated. ELISPOT assay was used to determine the number of IFN--producing cells/106 spleen cells, which were either unstimulated or stimulated with peptide. Spleen cells were divided into two portions: half (3x107 cells) were pulsed with 10 µg/ml peptides for 2 h, and then 1x106 of these cells were seeded in 96-well plates with 1 µg/ml peptide/150 µl and incubated for 40 h. The other half were not pulsed with peptides.

 
CTL induced by tumor antigen peptides fused to hsc70 recognize the original tumor cells
We examined the induction of CTL against a number of tumor antigens. pRL1a and TRP2 are L^d- and K^b-restricted leukemia and melanoma antigens respectively (22,27). E.G7 is an EL4 cell line transfected with cDNA of chicken OVA (21). The two tumor antigen peptides and the OVA-derived K^b-restricted epitope OVA257–264 were genetically fused to the C-terminus of hsc70 as shown in Fig. 1(A). BALB/c and C57BL/6 mouse were immunized with hsc70–pRL1a and hsc70–TRP2 or hsc70–OVA257–264 fusion proteins respectively. The immunized spleen cells were stimulated with peptides in vitro and their cytolytic activities were determined by ⁵¹Cr-release assay. As shown in Fig. 5, the original tumor cells, as well as the peptide-pulsed target cells, were killed by the induced CTL in each tumor model. Although the number of K^b molecules was very small on the cell surface of B16 melanoma (as determined by FACS analysis; data not shown), CTL killed the tumor. With respect to the in vitro stimulation of immunized cells, mitomycin-treated tumor cells and peptides were equally effective in generating specific CTL (data not shown). Thus, CD8⁺ T cells that had been primed by hsc70 fusion proteins were sensitive enough to recognize endogenously processed tumor antigen peptides.

View larger version (20K): [in this window] [in a new window]   Fig. 5. Immunization with hsc70 fusion proteins induces tumor-specific CTL, which can lyse tumor cells as well as third-party cells pulsed with peptides. BALB/c (H-2d) and C57BL/6 (H-2b) mice were immunized with hsc70–pRL1a, and hsc70–TRP2 or hsc70–OVA257–264 respectively. Spleen cells were stimulated with corresponding peptide for 6 days, and their cytolytic activities were determined by a standard 51Cr-release assay.

 
Comparison of hsc70 fusion protein with non-hsp fusion protein and hsc70–peptide complex
To compare the effect of hsc70 with non-hsp proteins upon CTL generation, we have produced IFN--inducible proteasome activator subunit, PA28 fused to OVA257–264 at its C-terminus. As shown in Fig. 6(A), hsc70 was absolutely superior to PA28 as a fusion partner, although moderate cytolytic activity was obtained by immunization with PA28 fusion protein. Next, as hsc70 associated with peptides have been shown to be useful for the generation of CTL (2,3), recombinant hsc70 was reconstituted in vitro with OVA248–269 (22mer) containing OVA257–264 as described previously (2) and injected into mice through the route of either s.c. or peritoneal cavity. Interestingly, both injection routes were equally effective for the generation of specific CTL (Fig. 6B), which was in contrast to the vaccination with hsc70 fusion protein as shown in Figs 3 and 4. The result suggests that the mechanism by which CD8⁺ T cells are primed in vivo is different between hsc70 fusion protein and hsc70–peptide complex.

View larger version (29K): [in this window] [in a new window]   Fig. 6. Comparison of hsc70 fusion protein with non-hsp fusion protein and hsc70 reconstituted with a peptide in vitro upon generation of specific CTL. (A) B6 mice were i.p. immunized twice with 10 µg each of hsc70–OVA257–264 fusion protein (squares) or PA28-OVA257–264 fusion protein (circles) with a 1-week interval. (B) hsc70 (10 µg) reconstituted with OVA248–269 in vitro was injected into B6 mice either through the peritoneal cavity (squares) or s.c. (circles), twice with a 1-week interval. Peptide reconstitution of hsc70 was carried with 100 µg hsc70 with 10 µg OVA248–269 (~3 times excess mol compared to that of hsc70) in a 100 µl PBS for 1 h at 37°C and then free peptides were extensively washed out by using Centricon 10. Spleen cells of these mice were stimulated with OVA257–264 in vitro for 6 days and their cytolytic activities against E.G7 (open squares and open circles) and EL4 (closed squares and closed circles) were determined.

 
Carrageenan-sensitive cells but not CD4⁺ T cells are required for priming CD8⁺ T cells in vivo
Next, we examined the cellular requirements for priming CD8⁺ T cells in vivo. B6 female mice were i.v. administered anti-CD4 mAb at day –1 to deplete CD4⁺ T cells in vivo and vaccinated with male spleen cells or hsc70–HY fusion protein at day 0. After a 1-week interval, anti-CD4 mAb was injected again, followed by immunization either with male spleen cells or with hsc70–HY fusion proteins. Two weeks after the final immunization, spleen cells were stimulated with HY peptide in vitro and the cytolytic activities against peptide-pulsed targets were determined. CTL specific to HY peptide were generated by vaccination with both male spleen cells and the hsc70–HY fusion protein (Fig. 7Ba and c). The depletion of CD4⁺ T cells in vivo completely abolished the generation of CTL by male spleen cells. In contrast, vaccination with hsc70 fusion protein still produced CTL, although some reduction of the activity was observed (Fig. 7Bb and d). In addition, CTL were generated against PYE and OVA epitopes by hsc70 fusion proteins in the absence of CD4⁺ T cells during the vaccination (Fig. 7Ab and Cb). These results indicate that CD4⁺ T cells are not required for the priming of CD8⁺ T cells in vivo by hsc70-CTL epitopes, in contrast to their requirement following vaccination with cellular components such as spleen cells. Notably, injection of carrageenan completely abolished the generation of CTL (Fig. 7Ac), in contrast to its lack of effect on the primary allogeneic CTL response (Fig. 7Ae). These results indicate that carrageenan does not affect T cell function and that APC sensitive to carrageenan are involved in the priming of CD8⁺ T cells by hsc70, in agreement with previous findings in which gp96 (grp94) was used for vaccine vehicles (29).

View larger version (31K): [in this window] [in a new window]   Fig. 7. CD4+ T cell-independent priming of CD8+ T cells by hsc70 fusion proteins. (A) BALB/c mice were injected with anti-CD4 mAb (b) or carrageenan (c) and vaccinated with hsc70–PYE on the following day. Vaccination was carried out twice with a 1-week interval. One week after the second immunization, spleen cells were stimulated with peptides. (a) Mice were immunized with hsc70–PYE without injection of anti-CD4 mAb or carrageenan. (d and e) The alloreactive CTL that were induced by co-culture of BALB/c spleen cells and irradiated C57BL/6 spleen cells, i.e. haplotype d anti-b responses. (e) Responder cells were derived from BALB/c mice treated with carrageenan. (B) B6 female mice were immunized twice as described in (A) with male spleen cells (a and b) or hsc70–HY fusion protein (c and d). In (b) and (d), mice were simultaneously injected with anti-CD4 mAb as described in (A). Spleen cells were stimulated with HY peptide and their cytolytic activities towards HY peptide-pulsed EL4 cells were determined. Induction of HY-specific CTL by male spleen cells but not by hsc70–HY fusion protein requires CD4+ T cells. (C) B6 mice were immunized with hsc70–OVA257–264. In (b), mice were simultaneously injected with anti-CD4 mAb as described in (A).

 
We next examined dendritic cells, as these cells are thought to be the most powerful APC for generating adaptive immunity. Bone marrow-derived immature dendritic cells were pulsed with equivalent concentrations of OVA257–264 peptide, hsc70–OVA257–264 or hsc70–PYE for 2 h at 37°C, 5% CO₂ and, after washing-off the free peptide or proteins, the dendritic cells were transferred i.p. into mice. CTL were generated by in vitro peptide stimulation and the activity was higher after vaccination with dendritic cells pulsed with hsc70 fusion protein than after vaccination with dendritic cells pulsed with peptide alone (Fig. 8). This result indicates that dendritic cells may be one of the APC targeted by hsc70 in vivo, although macrophages cannot be ruled out at this stage.

View larger version (22K): [in this window] [in a new window]   Fig. 8. Injection of bone marrow-derived dendritic cells pulsed with hsc70 fusion proteins induces specific CTL. Bone marrow-derived dendritic cells (5x106) of B6 (a and b) and BALB/c (c) origin were pulsed with equivalent concentrations of OVA257–264 peptide (1.2 µg /ml), hsc70–OVA257–264 (100 µg/ml) or hsc70–PYE (100 µg/ml) for 2 h at 37°C, 5% CO2; the free peptide or protein was then washed off. These pulsed dendritic cells (1x106) were i.p. injected into a syngeneic mouse twice with a 1-week interval. One week after the second immunization, spleen cells were stimulated with the corresponding peptides and the cytolytic activities were determined.

 
Identification of the most important region of hsc70 for the priming of CD8⁺ T cells in vivo.
We constructed genes encoding a variety of hsc70-deletion mutants that were fused at their C-terminus to the PYE epitope. We found that the ATPase domain was more competent than the peptide-binding domain at inducing CTL (Table 2). To locate the region of the ATPase domain (residues 1–385) of hsc70 that is critical for CTL induction, we expressed the deletion mutants hsc70[101–385], hsc70[201–385], hsc70[301–385] and hsc70[1-285] in E. coli. However, these proteins failed to refold on the Ni²⁺-NTA column in urea-free buffer, and could not be used for vaccination (Table 2). To retain solubility in urea-free buffer, hsc70 molecules lacking only the N-terminal 100, 200 and 300 residues were expressed and successfully refolded on the Ni²⁺-NTA column.

View this table: [in this window] [in a new window]   Table 2. Summary of CTL induction by hsc70-deletion mutants

 
hsc70[101–647] and hsc70[201–647] had comparable CTL inducing activities, whereas hsc70[301–647] had significantly lower activity (Fig. 9A). hsc70[101–647] could still bind ATP and was able to induce CTL (Fig. 9A and B). In contrast, hsc70[301–647] neither bound ATP nor induced high CTL activity (Fig. 9A and B). Although it seemed that ATP binding and CTL induction were linked, this was not the case as the hsc70[201–647] mutant lacked ATP-binding ability but retained the effectiveness of the wild-type protein in inducing CTL (Fig. 9A and B). These results indicate that the critical region is located among the N-terminal 200–300 residues and that the ATPase activity is not associated with T cell-priming ability.

View larger version (34K): [in this window] [in a new window]   Fig. 9. The ATP-binding ability of hsc70 is not required for induction of CTL. Mice were immunized twice with hsc70 deletion mutants, lacking the N-terminal 100, 200 or 300 amino acids, fused to the PYE peptide. hsc70 deletion mutants fused to PYE (hsc70[101–647]–PYE, hsc70[201–647]–PYE and hsc70[301–647]–PYE) were applied to an ATP–agarose column, and the flow through and eluate with ATP were analyzed by SDS–PAGE.

 
In order to map the critical region more precisely, we expressed hsc70 mutants lacking the N-terminal 220–280 residues and used these for vaccination. The deletion of 300, but not 280 residues from the N-terminus significantly reduced CTL induction (Fig. 10). As the ATPase domain (residues 1–385) could induce CTL more readily than the peptide-binding domain (residues 386–647), we conclude that residues 281–385 comprise the most important region for priming CD8⁺ T cells in vivo. These results are summarized in part in Table 2.

View larger version (23K): [in this window] [in a new window]   Fig. 10. The N-terminal 280 amino acids are not required for hsc70 to generate CTL. Mice were immunized twice with hsc70 deletion mutants (hsc70[221–647], hsc70[241–647], hsc70[261–647], hsc70[281–647], hsc70[301–647] and hsc70[385–647]; the peptide-binding domain) fused to PYE. One week after the second immunization, spleen cells were stimulated in vitro with peptide for 6 days and the resulting cytolytic activities were determined by a standard 51Cr-release assay.

 

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
The priming of specific CD8⁺ T cells by mycobacterial hsp70 covalently fused to OVA fragment has been demonstrated previously (12). It is thought that processing enzymes, such as the proteasome, would be essential to re-present K^b-restricted OVA257–264 in vivo. However, it has not been determined whether both the N- and C-terminal flanking regions of the CTL epitope are essential for this processing. In this study, we have shown that specific CTL are generated by vaccination with CTL epitopes fused to hsc70 in an adjuvant-free manner. Neither N- nor C-terminal cognate flanking regions were required for any of the five different CTL epitopes that were fused to the C-terminus, or the one epitope, PYE, that was fused to N-terminus of hsc70. Thus, all of the epitopes, which represent a variety of restriction molecules (K^b, D^b, K^d, L^d), are preserved in the APC during processing after internalization. The 20S proteasome is thought to be involved in the C-terminal processing of MHC class I ligands (30); therefore, the fusion of MHC class I ligands to the C-terminus of hsc70 may bypass the requirement of the 20S proteasome, although amino-peptidases are necessary for the N-terminal processing (31). The precise processing pathway of hsc70 fusion proteins following internalization is currently under investigation.

Binder et al. have demonstrated that CD91 is a receptor for gp96–peptide complexes during cross-presentation (32), although it may not be the receptor that activates APC. CD91 has also been shown to be a receptor for ₂-macroglobulin, which suggests that in the circulating blood gp96 and ₂-macroglobulin may compete for receptors. If this is the case, it would support the finding that i.d. injection of gp96 is the most effective route for tumor regression (33). In regard to APC for hsc70 fusion proteins, dendritic cell are at least one of the candidates, as bone marrow-derived dendritic cells pulsed with fusion proteins effectively induced CTL (Fig. 8). It is intriguing that i.v. injection induces a more favorable response than s.c. or i.d. injection (Fig. 3); perhaps splenic dendritic cells rather than i.d. Langerhans cells are the primary APC responsible for internalizing hsc70 fusion proteins. As hsc70 reconstituted with peptide in vitro is still effective in the route of s.c. (Fig. 6B), hsc70 fusion protein is likely working through a different receptor than CD91 which was suggested by Basu et al. as a common receptor for gp96, hsp90 and hsp70 (34). We found that CD4⁺ T cells could be canceled for the generation of CTL by hsc70 fusion protein. This may be linked to evidence that APC such as CD11c⁺ cells are activated by hsps, as found recently (35–37); thus, activation of APC, followed by production of pro-inflammatory cytokines, bypasses the requirement of CD4⁺ T cells.

With respect to the purification of hsc70 fusion protein and its potential to induce CTL, we found that the rapid refolding of recombinant hsc70 on the Ni²⁺-NTA column (see Methods) gave rise to a higher and more stable ATPase activity than the conventional method, which is to gradually refold proteins by dialyzing away the urea and gives rise to negligible ATPase activity. Both methods produced water-soluble hsc70 that could not be differentiated by SDS–PAGE analysis (data not shown); however, the ATPase activity of rapidly refolded hsc70 was consistently higher than that of gradually refolded hsc70. CTL induction by hsc70 with a high ATPase activity was more stable than that of hsc70 with a low or negligible ATPase activity (unpublished observation). It seemed that ATPase activity might be necessary for priming of CD8⁺ T cells; however, hsc70 that lacked the N-terminal 200 amino acids and so could not bind ATP still induced CTL effectively (Fig. 9). Although the exact structures of hsc70 refolded by the different methods are not known, the conformation of hsc70 that gives rise to high ATPase activity, rather than the ATPase activity itself, might be important for T cells-priming in vivo.

The critical region of hsc70 for peptide re-presentation was mapped to residues 280–385 in the ATPase domain (Figs 9 and 10, and Table 2), which coincides with the priming region identified in mycobacterial hsp70 fusion protein (13). Although the homology of amino acid sequence in this section between mouse hsc70 and mycobacterial hsp70 is not very high, the tertiary structure of these proteins may be similar. The C-terminal half of the hsc70 (hsp70) ATPase domain might interact with a putative receptor for either peptide re-presentation or activation of APC. If so, this putative receptor might be a type of pattern-recognition receptor such as Toll-like receptors, which recognize the overall structures of the pathogens rather than a specific amino acid sequence (38). Although the ATPase domain seemed to be more important for the inducing CTL, the peptide-binding domain also induces CTL, albeit less effectively than the ATPase domain. The C-terminal 100 amino acids of the peptide-binding domain was previously shown to be important for exogenous hsp70 to translocate the cell surface and nuclear membrane, resulting in localization inside certain types of cells (39). This mechanism might be involved in representation of peptide by the peptide-binding domain of hsc70.

In summary, we have demonstrated that vaccination of murine hsc70 fused to CTL epitopes lacking both N- and C-terminal flanking sequences is useful for the priming of CD8⁺ T cells, in a process that is independent of CD4⁺ T cells. This does not mean necessarily that CD4⁺ T cells do not play a role in the immune response, and future studies should investigate whether MHC class II ligands (helper epitopes) carried by hsps might be useful in the eradication of cancers or infectious pathogens.

	Acknowledgments

 
This work was supported by a Grant-in-Aid for Scientific Research on Priority Areas from the Ministry of Education, Science, Sports and Culture, Japan.

	Abbreviations

 

APC antigen-presenting cell

CTL cytotoxic T lymphocyte

hsc70 heat shock cognate protein 70

hsp heat shock protein

OVA ovalbumin

	Notes

 
Transmitting editor: T. Hamaoka

Received 9 April 2001, accepted 25 June 2001.

	References

Top Abstract Introduction Methods Results Discussion References

 

1. Arnold, D., Faath, S., Rammensee, H. and Schild, H. 1995. Cross-priming of minor histocompatibility antigen-specific cytotoxic T cells upon immunization with the heat shock protein gp96. J. Exp. Med. 182:885.[Abstract/Free Full Text]
2. Blachere, N. E., Li, Z., Chandawarkar, R. Y., Suto, R., Jaikaria, N. S., Basu, S., Udono, H. and Srivastava, P. K. 1997. Heat shock protein–peptide complexes, reconstituted in vitro, elicit peptide-specific cytotoxic T lymphocyte response and tumor immunity. J. Exp. Med. 186:1315.[Abstract/Free Full Text]
3. Ciupitu, A. M., Petersson, M., O'Donnell, C. L., Williams, K., Jindal, S., Kiessling, R. and Welsh, R. M. 1998. Immunization with a lymphocytic choriomeningitis virus peptide mixed with heat shock protein 70 results in protective antiviral immunity and specific cytotoxic T lymphocytes. J. Exp. Med. 187:685.[Abstract/Free Full Text]
4. Heikema, A., Agsteribbe, E., Wilschut, J. and Huckriede, A. 1997. Generation of heat shock protein-based vaccines by intracellular loading of gp96 with antigenic peptides. Immunol. Lett. 57:69.[Web of Science][Medline]
5. Moroi, Y., Mayhew, M., Trcka, J., Hoe, M. H., Takechi, Y., Hartl, F. U., Rothman, J. E. and Houghton, A. N. 2000. Induction of cellular immunity by immunization with novel hybrid peptides complexed to heat shock protein 70. Proc. Natl Acad. Sci. USA 97:3485.[Abstract/Free Full Text]
6. Suto, R. and Srivastava, P. K. 1995. A mechanism for the specific immunogenicity of heat shock protein-chaperoned peptides. Science 269:1585.[Abstract/Free Full Text]
7. Binder, R. J., Harris, M. L., Menoret, A. and Srivastava, P. K. 2000. Saturation, competition, and specificity in interaction of heat shock proteins (hsp) gp96, hsp90, and hsp70 with CD11b⁺ cells. J. Immunol. 165:2582.[Abstract/Free Full Text]
8. Ishii, T., Udono, H., Yamano, T., Ohta, H., Uenaka, A., Ono, T., Hizuta, A., Tanaka, N., Srivastava, P. K. and Nakayama, E. 1999. Isolation of MHC class I-restricted tumor antigen peptide and its precursors associated with heat shock proteins hsp70, hsp90, and gp96. J. Immunol. 162:1303.[Abstract/Free Full Text]
9. Breloer, M., Marti, T., Fleischer, B. and von Bonin, A. 1998. Isolation of processed, H-2K^b-binding ovalbumin-derived peptides associated with the stress proteins HSP70 and gp96. Eur. J. Immunol. 28:1016.[Web of Science][Medline]
10. Udono, H. and Srivastava, P. K. 1993. Heat shock protein 70-associated peptides elicit specific cancer immunity. J. Exp. Med. 178:1391.[Abstract/Free Full Text]
11. Tamura, Y., Peng, P., Liu, K., Daou, M. and Srivastava, P. K. 1997. Immunotherapy of tumors with autologous tumor-derived heat shock protein preparations. Science 278:117.[Abstract/Free Full Text]
12. Suzue, K., Zhou, X., Eisen, H. N. and Young, R. A. 1997. Heat shock fusion proteins as vehicles for antigen delivery into the major histocompatibility complex class I presentation pathway. Proc. Natl Acad. Sci. USA 94:13146.[Abstract/Free Full Text]
13. Huang, Q., Richmond, J. F., Suzue, K., Eisen, H. N. and Young, R. A. 2000. In vivo cytotoxic T lymphocyte elicitation by mycobacterial heat shock protein 70 fusion proteins maps to a discrete domain and is CD4(+) T cell independent. J. Exp. Med. 191:403.[Abstract/Free Full Text]
14. Theobald, M., Ruppert, T., Kuckelkorn, U., Hernandez, J., Haussler, A., Ferreira, E. A., Liewer, U., Biggs, J., Levine, A. J., Huber, C., Koszinowski, U. H., Kloetzel, P. M. and Sherman, L. A. 1998. The sequence alteration associated with a mutational hotspot in p53 protects cells from lysis by cytotoxic T lymphocytes specific for a flanking peptide epitope. J. Exp. Med. 188:1017.[Abstract/Free Full Text]
15. Shimbara, N., Nakajima, H., Tanahashi, N., Ogawa, K., Niwa, S., Uenaka, A., Nakayama, E. and Tanaka, K. 1997. Double-cleavage production of the CTL epitope by proteasomes and PA28: role of the flanking region. Genes Cells 2:785.[Abstract]
16. More, S., Breloer, M., Fleischer, B. and von Bonin, A. 1999. Activation of cytotoxic T cells in vitro by recombinant gp96 fusion proteins irrespective of the `fused' antigenic peptide sequence. Immunol. Lett. 69:275.[Web of Science][Medline]
17. Lammert, E., Arnold, D., Nijenhuis, M., Momburg, F., Hammerling, G. J., Brunner, J., Stevanovic, S., Rammensee, H. G. and Schild, H. 1997. The endoplasmic reticulum-resident stress protein gp96 binds peptides translocated by TAP. Eur. J. Immunol. 27:923.[Web of Science][Medline]
18. Spee, P. and Neefjes, J. 1997. TAP-translocated peptides specifically bind proteins in the endoplasmic reticulum, including gp96, protein disulfide isomerase and calreticulin. Eur. J. Immunol. 27:2441.[Web of Science][Medline]
19. Kovacsovics-Bankowski, M. and Rock, K. L. 1995. A phagosome-to-cytosol pathway for exogenous antigens presented on MHC class I molecules. Science 267:243.[Abstract/Free Full Text]
20. Kedar, E., Schwartzbach, M., Raanan, Z. and Hefetz, S. 1977. In vitro induction of cell-mediated immunity to murine leukemia cells. II. Cytotoxic activity in vitro and tumor-neutralizing capacity in vivo of anti-leukemia cytotoxic lymphocytes generated in macrocultures. J. Immunol. Methods 16:39.[Web of Science][Medline]
21. Moore, M. W., Carbone, F. R. and Bevan, M. J. 1988. Introduction of soluble protein into the class I pathway of antigen processing and presentation. Cell 54:777.[Web of Science][Medline]
22. Uenaka, A., Ono, T., Akisawa, T., Wada, H., Yasuda, T. and Nakayama, E. 1994. Identification of a unique antigen peptide pRL1 on BALB/c RL1 leukemia recognized by cytotoxic T lymphocytes and its relation to the Akt oncogene. J. Exp. Med. 180:1599.[Abstract/Free Full Text]
23. Heath, W. and Boyle, W. 1985. In vivo and in vitro analyses of the immunogenicity of B16 melanoma cells. Aust. J. Exp. Biol. Med. Sci. 63:163.
24. Thomas, K., Engers, H. D., Cerottini, J. C. and Brunner, K. T. 1976. Enzymatic removal of H-2 alloantigens from the surface of P815-(X2) mouse tumor cells. Eur. J. Immunol. 6:257.[Web of Science][Medline]
25. Falk, K., Rotzschke, O., Stevanovic, S., Jung, G. and Rammensee, H. G. 1991. Allele-specific motifs revealed by sequencing of self-peptides eluted from MHC molecules. Nature 351:290.[Medline]
26. Markiewicz, M. A., Girao, C., Opferman, J. T., Sun, J., Hu, Q., Agulnik, A. A., Bishop, C. E., Thompson, C. B. and Ashton-Rickardt, P. G. 1998. Long-term T cell memory requires the surface expression of self-peptide/major histocompatibility complex molecules. Proc. Natl Acad. Sci. USA 95:3065.[Abstract/Free Full Text]
27. Bloom, M. B., Perry-Lalley, D., Robbins, P. F., Li, Y., el-Gamil, M., Rosenberg, S. A. and Yang, J. C. 1997. Identification of tyrosinase-related protein 2 as a tumor rejection antigen for the B16 melanoma. J. Exp. Med. 185:453.[Abstract/Free Full Text]
28. Weiss, W. R., Mellouk, S., Houghten, R. A., Sedegah, M., Kumar, S., Good, M. F., Berzofsky, J. A., Miller, L. H. and Hoffman, S. L. 1990. Cytotoxic T cells recognize a peptide from the circumsporozoite protein on malaria-infected hepatocytes. J. Exp. Med. 171:763.[Abstract/Free Full Text]
29. Udono, H., Levey, D. L. and Srivastava, P. K. 1994. Cellular requirements for tumor-specific immunity elicited by heat shock proteins: tumor rejection antigen gp96 primes CD8⁺ T cells in vivo. Proc. Natl Acad. Sci. USA 91:3077.[Abstract/Free Full Text]
30. Rock, K. L. and Goldberg, A. L. 1999. Degradation of cell proteins and the generation of MHC class I-presented peptides. Annu. Rev. Immunol. 17:739.[Web of Science][Medline]
31. Mo, X. Y., Cascio, P., Lemerise, K., Goldberg, A. L. and Rock, K. 1999. Distinct proteolytic processes generate the C and N termini of MHC class I-binding peptides. J. Immunol. 163:5851.[Abstract/Free Full Text]
32. Binder, R. J., Han, D. K. and Srivastava, P. K. 2000. CD91: a receptor for heat shock protein gp96. Nat. Immunol. 1:151.[Web of Science][Medline]
33. Chandawarkar, R. Y., Wagh, M. S. and Srivastava, P. K. 1999. The dual nature of specific immunological activity of tumor-derived gp96 preparations. J. Exp. Med. 189:1437.[Abstract/Free Full Text]
34. Basu, S., Binder, R. J., Ramalingam, T. and Srivastava, P. K. 2001. CD91 is a common receptor for heat shock proteins gp96, hsp90, hsp70, and calreticulin. Immunity 14:303.[Web of Science][Medline]
35. Asea, A., Kraeft, S. K., Kurt-Jones, E. A., Stevenson, M. A., Chen, L. B., Finberg, R. W., Koo, G. C. and Calderwood, S. K. 2000. HSP70 stimulates cytokine production through a CD14-dependent pathway, demonstrating its dual role as a chaperone and cytokine. Nat. Med. 6:435.[Web of Science][Medline]
36. Basu, S., Binder, R. J., Suto, R., Anderson, K. M. and Srivastava, P. K. 2000. Necrotic but not apoptotic cell death releases heat shock proteins, which deliver a partial maturation signal to dendritic cells and activate the NF-B pathway. Int. Immunol. 12:1539.[Abstract/Free Full Text]
37. Binder, R. J., Anderson, K. M., Basu, S. and Srivastava, P. K. 2000. Cutting edge: heat shock protein gp96 induces maturation and migration of CD11c(+) cells in vivo. J. Immunol. 165:6029.[Abstract/Free Full Text]
38. Medzhitov, R. and Janeway, C. 2000. Innate immunity. N. Engl. J. Med. 343:338.[Free Full Text]
39. Fujihara, S. M. and Nadler, S. G. 1999. Intranuclear targeted delivery of functional NF-kappaB by 70 kDa heat shock protein. EMBO J. 18:411.[Web of Science][Medline]

CiteULike    Connotea    Del.icio.us    What's this?

This article has been cited by other articles:

				R. J. Binder CD40-Independent Engagement of Mammalian hsp70 by Antigen-Presenting Cells J. Immunol., June 1, 2009; 182(11): 6844 - 6850. [Abstract] [Full Text] [PDF]

				T. Yamano, S. Mizukami, S. Murata, T. Chiba, K. Tanaka, and H. Udono Hsp90-mediated Assembly of the 26 S Proteasome Is Involved in Major Histocompatibility Complex Class I Antigen Processing J. Biol. Chem., October 17, 2008; 283(42): 28060 - 28065. [Abstract] [Full Text] [PDF]

				T. Yamano, H. Sugahara, S. Mizukami, S. Murata, T. Chiba, K. Tanaka, K. Yui, and H. Udono Allele-Selective Effect of PA28 in MHC Class I Antigen Processing J. Immunol., August 1, 2008; 181(3): 1655 - 1664. [Abstract] [Full Text] [PDF]

				J.-E. Park, J. Facciponte, X. Chen, I. MacDonald, E. A. Repasky, M. H. Manjili, X.-Y. Wang, and J. R. Subjeck Chaperoning Function of Stress Protein grp170, a Member of the hsp70 Superfamily, Is Responsible for its Immunoadjuvant Activity Cancer Res., January 15, 2006; 66(2): 1161 - 1168. [Abstract] [Full Text] [PDF]

				A. Kebba, J. Stebbing, S. Rowland, R. Ingram, J. Agaba, S. Patterson, P. Kaleebu, N. Imami, and F. Gotch Expression of the common heat-shock protein receptor CD91 is increased on monocytes of exposed yet HIV-1-seronegative subjects J. Leukoc. Biol., July 1, 2005; 78(1): 37 - 42. [Abstract] [Full Text] [PDF]

				A. A. R. Tobian, C. V. Harding, and D. H. Canaday Mycobacterium tuberculosis Heat Shock Fusion Protein Enhances Class I MHC Cross-Processing and -Presentation by B Lymphocytes J. Immunol., May 1, 2005; 174(9): 5209 - 5214. [Abstract] [Full Text] [PDF]

				H. Li, M. Zhou, J. Han, X. Zhu, T. Dong, G. F. Gao, and P. Tien Generation of Murine CTL by a Hepatitis B Virus-Specific Peptide and Evaluation of the Adjuvant Effect of Heat Shock Protein Glycoprotein 96 and Its Terminal Fragments J. Immunol., January 1, 2005; 174(1): 195 - 204. [Abstract] [Full Text] [PDF]

				K. Ohkusu-Tsukada, N. Tominaga, H. Udono, and K. Yui Regulation of the Maintenance of Peripheral T-Cell Anergy by TAB1-Mediated p38{alpha} Activation Mol. Cell. Biol., August 15, 2004; 24(16): 6957 - 6966. [Abstract] [Full Text] [PDF]

				B. Rodriguez-Iturbe, N. D. Vaziri, J. Herrera-Acosta, and R. J. Johnson Oxidative stress, renal infiltration of immune cells, and salt-sensitive hypertension: all for one and one for all Am J Physiol Renal Physiol, April 1, 2004; 286(4): F606 - F616. [Abstract] [Full Text] [PDF]

				K. Fleischer, B. Schmidt, W. Kastenmuller, D. H. Busch, I. Drexler, G. Sutter, M. Heike, C. Peschel, and H. Bernhard Melanoma-Reactive Class I-Restricted Cytotoxic T Cell Clones Are Stimulated by Dendritic Cells Loaded with Synthetic Peptides, but Fail to Respond to Dendritic Cells Pulsed with Melanoma-Derived Heat Shock Proteins In Vitro J. Immunol., January 1, 2004; 172(1): 162 - 169. [Abstract] [Full Text] [PDF]

				Y. Kawabata, H. Udono, K. Honma, M. Ueda, H. Mukae, J.-i. Kadota, S. Kohno, and K. Yui Merozoite Surface Protein 1-Specific Immune Response Is Protective against Exoerythrocytic Forms of Plasmodium yoelii Infect. Immun., November 1, 2002; 70(11): 6075 - 6082. [Abstract] [Full Text] [PDF]

				T. Yamano, S. Murata, N. Shimbara, N. Tanaka, T. Chiba, K. Tanaka, K. Yui, and H. Udono Two Distinct Pathways Mediated by PA28 and hsp90 in Major Histocompatibility Complex Class I Antigen Processing J. Exp. Med., July 15, 2002; 196(2): 185 - 196. [Abstract] [Full Text] [PDF]

This Article Abstract FREE Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (44) Request Permissions Google Scholar Articles by Udono, H. Articles by Yui, K. Search for Related Content PubMed PubMed Citation Articles by Udono, H. Articles by Yui, K. Social Bookmarking          What's this?

Online ISSN 1460-2377 - Print ISSN 0953-8178

Copyright © 2010 Japanese Society for Immunology

Oxford Journals Oxford University Press

• Site Map
• Privacy Policy
• Frequently Asked Questions

Other Oxford University Press sites: Oxford University Press Oxford Journals China Oxford Journals Japan American National Biography Booksellers' Information Service Children's Fiction and Poetry Children's Reference Corporate & Special Sales Dictionaries Dictionary of National Biography Digital Reference English Language Teaching Higher Education Textbooks Humanities International Education Unit Law Medicine Music Online Products Oxford English Dictionary Reference Rights and Permissions Science School Books Social Sciences Very Short Introductions World's Classics