Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (4)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Torres-Nagel, N.
Right arrow Articles by Hünig, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Torres-Nagel, N.
Right arrow Articles by Hünig, T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 13, No. 1, 63-73, January 2001
© 2001 Japanese Society for Immunology

Genetic control of peripheral TCRAV usage by representation in the preselection repertoire and MHC allele-specific overselection

Nora Torres-Nagel, Beatrix Mehling, Anne-France LeRolle, Etienne Joly, and Thomas Hünig

Institute for Virology and Immunobiology, University of Würzburg, Versbacher Strasse 7, 97078 Würzburg, Germany
1 Immunogenetics Laboratory, Babraham Institute, Cambridge CB2 4AT, UK
2 Present Address: UPCM, Unite CNRS 1590, CHU Purpan, 31300 Toulouse, France

Correspondence to: T. Hünig


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
TCRAV segments contribute significantly to MHC restriction as illustrated by their general preference for either the CD4 or CD8 T cell subset and additional, MHC allele-specific overselection during T cell differentiation. The 10-fold over-representation of the TCRAV8S2 (VA8S2) segment in CD8 over CD4 T cells by the RT1f haplotype of LEW.1F rats provides the most striking example of MHC allele-specific overselection of a VA segment reported so far. Also in alloreactivity, VA8S2+ CD8 cells from RT1f– rats are preferentially expanded by RT1f+ stimulators. We have identified the class I molecule, Af, mediating VA8S2 overselection and report that it differs only in four amino acids at the MHC–TCR interface from the class I molecule Aa, which is neutral with regard to selection of VA8S2. We also provide an extensive survey of the TCRAV8 family and show that among 14 functional VA8 segments in LEW rats, the dramatic Af-dependent overselection is unique for VA8S2. Surprisingly, VA8S2 expression in CD8 T cells of RT1f+ rats derived from a Sprague-Dawley stock was only 3% as compared to the 12% observed in LEW.1F. The VA8S2 segment of Sprague-Dawley (VA8S2SD) differs from VA8S2 of the LEW background (VA8S2l) in only two amino acids, one of which is located in CDR2 and could thus participate in allele-specific recognition of Af. However, analysis of the pre- and postselection thymic repertoires of Sprague-Dawley and LEW.1F rats and of the repertoire of CD8 cells from both strains expanded in the alloreactive response to RT1f revealed that the difference in VA8S2 representation between the two backgrounds is explained by differential availability in the preselection repertoires and not by a difference in overselection. Sequence comparisons of Af and Aa and of both VA8S2 segments suggest a predominant role of CDR1 in hyper-reactivity to Af. Thus, the VA composition of the mature TCR repertoire is influenced by Tcra locus polymorphisms at two levels: the regulation of VA usage in the preselection repertoire and the composition of structural elements which contribute to specific VA–MHC interactions during thymic selection.

Keywords: alloreactivity, MHC recognition, rat, RT1, T cell repertoire, thymic selection


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
MHC-restricted antigen recognition by the TCR is the net result of multiple interactions of the amino acid side chains of the three complementarity-determining regions (CDR) of each of the two TCRV domains with the two {alpha} helices forming the peptide-binding groove of the MHC molecule and with the bound peptide itself (14). Crystal structures obtained for MHC I-restricted TCR and their cognate MHC–peptide complexes indicate that the germline-encoded CDR1 and CDR2 of the VA segments provide the majority of interactions with the MHC molecule itself by contacting both conserved and polymorphic residues of the {alpha}1 and {alpha}2 helices (14). These structural data have provided a theoretical basis for the pronounced effects of MHC class and allele on the selection of T cells utilizing particular VA segments during thymic development (57) and in alloreactive responses (5,8,9). Indeed, the CD4/CD8 subset distribution of every VA segment thus far examined has revealed a bias towards one or the other subset which is imposed by thymic selection on MHC I or II of most haplotypes, but can be strongly boosted by a particular MHC allele (10). In mice, direct evidence for MHC class-specific selection through CDR1{alpha} and CDR2{alpha} has been provided by mutational analysis in transgenic animals in which the CD4/CD8 bias was transferred from one closely related VA segment to another by transplanting a single amino acid residue (11). Furthermore, the distinct CD4/CD8 ratios of two congenic mouse strains were shown by segregation analysis to be strongly linked to the Tcra locus (12). Together, these findings obtained by structural, mutational and repertoire analysis support an important role for class- and allele-specific MHC recognition by VA segments, and thus for the phenomenon of MHC-restricted antigen recognition.

The most striking example identified to date for an MHC allele-specific overselection of a VA segment superimposed on a weak class-specific bias is the very high expression of the VA8S2 segment among CD8 T cells of the LEW.1F strain, an RT1f-congenic strain of the Lewis (LEW) rat (5). Whereas RT1f– LEW strains of the a, c, d, k and l haplotypes show moderate (2- to 3-fold) CD8 skewing of VA8S2, ~10-fold more CD8 than CD4 T cells of LEW.1F utilize this segment, resulting in a contribution of 11–13% to the repertoire. Since no restrictions in J segment usage or CDR3 composition are apparent among the overselected VA8S2+ CD8 T cells (13), the dramatic impact of the RT1f haplotype on the selection of this VA segment is most likely due to a particularly good fit between a class I molecule of RT1f and CDR1/2 of VA8S2. Given an estimated 63 functional VA genes in the rat (14), the genetic basis for such a striking over-representation of a single VA segment may provide insights into the generation of the multitude of functional TCR repertoires expressed within a species.

In the present study, we have identified the polymorphic RT1.A molecule of the f haplotype which preferentially interacts with VA8S2, report the expressed VA8 family of the LEW rat and analyze its contribution to Af recognition, and describe a novel VA8S2 form which is expressed in RT1f+ rats at a much lower level than VA8S2l. Sequence comparisons of VA8S2-hyper-reactive RT1.Af and closely related, `neutral' RT1.A molecules, and of VA8 family members and VA8S2 segments narrow down the likely contact points between VA8S2 and Af. Together with the expression of VA8S2 segments in the preselection and mature T cell repertoires, these results suggest a model in which individual profiles of VA segment usage within a species are controlled by both VA availability in the preselection repertoire and MHC-specific recognition during positive selection.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Animals
LEW and LEW.1F rats were bred in our animal facilities. One Sprague-Dawley female carrying the RT1f MHC haplotype was initially identified by serological typing in a cohort of 12 Crl:CD(SD)BR rats purchased from Charles River (Margate, UK). Sprague-Dawley rats homozygous for this RT1f haplotype were then obtained by successive brother/sister matings. The RT1f haplotype was also bred onto the LEW background by four successive backcross matings onto LEW rats and subsequently bred to homozygocity by brother/sister matings. DA rats were purchased from Harlan Winkelmann (Borchen, Germany) and LEW.1A rats obtained from Dr Hedrich (Institute for Laboratory Animal Science, Medical School Hannover, Germany). These and all crosses were bred under conventional housing conditions.

Antibodies and flow cytometry
W3-25 (anti-CD4), OX44 (anti-CD53) and FITC-conjugated OX8 (anti-CD8) were purchased from Serotec (Oxford, UK), OX18 (anti-RT1.A) from PharMingen (San Diego, CA), and phycoerythrin–F(ab')2 fragments of donkey anti-mouse IgG from Dianova (LOCATION???). G177 (anti-VA8S2) (15), 341 (anti-CD8ß) (16) and R73 (anti-{alpha}ßTCR) (17) were generated in this laboratory. Two-color staining and flow cytometry were performed as described previously (5). Analysis was carried out on a FACScan flow cytometer (Becton Dickinson, Mountain View, CA). The cytometer was calibrated `by eye' using negative controls and single-color stainings of rat lymphocytes. CellQuest software (Becton Dickinson) was used for acquisition and analysis of samples. Viable lymphocytes are shown in plots after gating on forward and side scatter.

Preparation of CD8 cells and depletion of VA8S2 cells
CD8 cells were purified from LEW or LEW.1F nylon wool-passed lymph node (LN) cells by depletion of CD4+ cells by using Cedarlane T cell recovery columns according to the manufacturer's procedure (Cedarlane, Hornby, Ontario, Canada) (purity >95%). Depletion of VA8S2-expressing cells was carried out by incubation of CD8+ cells for 60 min at 4°C in G177-coated tissue culture flasks. Unbound cells (purity > 97%) were collected and stimulated in R73-coated plates in the presence of 100 U/ml IL-2 during 2 days.

Preparation of G177+ cells
Sprague-Dawley nylon wool-passed LN cells were incubated for 60 min at 4°C in G177-coated tissue culture flasks. Bound cells were incubated for 3 days in supplemented RPMI medium containing 20% supernatant from concanavalin A-stimulated rat spleen cells and 20 U/ml IL-2 (purity >95% G177+).

Northern blot analysis
RNAs were prepared using Trizol reagent (Life Technologies, Eggenstein, Germany) according to the manufacturer's instructions. Total RNAs (20 µg) were electrophoresed and transferred to a Hybond-N+ membrane (Amersham Pharmacia Biotech, Freiburg, Germany). The membrane was hybridized with an [{alpha}-32P]dATP-labeled probe 252 bp long (obtained by PCR amplification of G177+ T cell hybridoma cDNA with the 5'-primer: GGAGACTCCGTGACCCAGA and 3'-primer: GACAGCTGTGCTGAGGGCT) specific for AV8 in Quikhyb solution (Stratagene, Amsterdam, The Netherlands) at 55°C for 3 h, washed twice for 20 min at 65°C with 2xSSPE/0.1% SDS, once for 30 min at 65°C with 1xSSPE/0.1% SDS, once for 15 min at room temperature with 0.1% SSPE/0.1% SDS and then analyzed either with a phosphor imager or after exposure to a film. The same membrane was washed 3 times for 30 min at 100°C with 0.1% SDS, exposed to a film to verify wash out of radioactivity and rehybridized with an [{alpha}-32P]dATP -labeled probe 358 bp long (obtained by PCR amplification of G177+ T cell hybridoma cDNA with the 5'-primer: CTGTGTACCAGCTGAAAGATCC and 3'-primer: AGGTTAAATCCGGCCACTTTCAG) specific for the constant segment of the TCRA chain (CA) as described above.

PCR amplification, cloning and sequencing of VA8 family members
cDNA prepared by standard procedures from LN T cells or thymocytes of the LEW background was amplified by PCR with Taq polymerase (MBI Fermentas, St Leon-Rot, Germany). The 5' primer used (GGAGACTCCGTGACCCAG) binds at the beginning of AV8 segments and the 3' primer (GGCTCTGGGTCTGTGACA) at the beginning of the CA segment. Products of 20 PCR tubes were pooled to minimize amplifications of Taq polymerase errors. The PCR fragments were cloned in pBluescript II SK+/– vector, Escherichia coli XLI-Blue MRF' bacteria were transformed and plasmid DNAs were prepared by the Qiagen Plasmid kit (Qiagen, Hilden, Germany). Nucleotide sequences were obtained using the ABI Prism dye terminator sequencing kit FS and a 373A DNA sequencer (Applied Biosystems, Weiterstadt, Germany). More than 100 clones were analyzed. Each sample was sequenced in both directions. Translations and multiple alignments were carried out with the programs Mac Vector (International Biotechnologies, New Haven, CT) and the Wisconsin sequence analysis package (Genetics Computer Group, University Research Park, Madison, WI).

Cloning and sequencing of VA8S2 from Sprague-Dawley
cDNA from G177+ Sprague-Dawley T cell blasts was amplified by PCR with Taq polymerase (MBI Fermentas) using the same primers specific for VA8 and CA specified above. Products of 20 PCR tubes were pooled, purified and cloned in pBluescript II SK+/– vector. Preparation of plasmid DNAs and sequencing was performed as above. Twenty clones were analyzed. Each sample was sequenced in both directions.

PCR amplification, cloning and sequencing of rat MHC I molecules
RNAs from LEW.1F splenocytes were reverse transcribed and MHC class I cDNAs amplified by PCR with PowerScript-PAN polymerase (PAN Biotech, Aidenbach, Germany) using specific oligonucleotides. RT1.Af was obtained using the oligonucleotides previously described by Wang et al. (18) and RT1.A2f using the downstream oligonucleotide described by Joly et al. (19) and a slightly modified upstream oligonucleotide, Af2us: GCTGGCGGCCGCCCTGGCCCCGACCCAGACC. These PCR fragments and RT1.Al (20) cDNA were cloned into the pCMUIV expression vector (21,22).

The cDNA for RT1.Aa was derived from pBS-331 (23) by insertion of an XbaI linker in the PvuII site found immediately downstream of the stop codon. The RT1.Aa cDNA was then inserted into pCMU-IV in place of the H2-Db cDNA after digestion with NotI and XbaI, as previously described (19).

Recombinant plasmid clones were prescreened by fragment-length analysis and used for transient transfection of COS cells (24). Transfected cells were analyzed for class Ia phenotype by staining with mAb cross-reactive to LEW.1F, LEW.1A or LEW rat cells (25). DNA from positive clones was sequenced in both directions as described previously. Translations and sequence comparisons were carried out with the Wisconsin sequence analysis package.

For cloning into the retroviral vector pLEN (pLAEN vector without ADA cDNA (26), cloned Af, A2f and Aa fragments were amplified by PCR with PowerScript-PAN polymerase using oligonucleotides at each extremity of the open reading frame, the 5' primer (TAG AAT TCG CCA CCA TGG GGG CGA TGG CAC) introducing an EcoRI site and at the 3' primer (TCA TGG ATC CAC TCC AGG CAG CTG TCT TCA) introducing a BamHI site. After digestion with EcoRI and BamHI, the PCR product was cloned in the pLEN vector. After screening by enzymatic digestion, DNA from all selected clones was checked by sequencing.

Transfections and retroviral transductions
L929 cells were transfected with Al, Af, A2f or Aa by standard Ca2PO4 transfection.

For transduction of rCD80-P815 cells [mouse mastocytoma cells transfected with rat CD80; a kind gift of Dr K. Okumura (27)] viral supernatants were generated by triple transient transfections (Ca2PO4 method) of 293 T cells with pLEN containing Af, A2f or Aa, pHIT60 and pHIT123 according to the method described by Soneoka et al. (28). rCD80-P815 cells were transduced by 2 h of centrifugation (2300 r.p.m.) with viral supernatants in the presence of 8 µg/ml polybrene. After centrifugation supernatants were removed and cells were incubated in supplemented RPMI. After 48 h expression of MHC molecules was analyzed by FACS. Cells were cloned by limiting dilution and positive clones were selected.

Cytotoxicity assays
Effector cells were generated by incubation of 2x10 7 LEW LN cells and 2x10 7 irradiated LEW.1F LN stimulator cells for 5 days in supplemented RPMI.

Serial dilutions of effector cells were incubated in triplicates with 104 51Cr-labeled targets (L929 or rCD80-P815 cells expressing Al, Af, A2f or Aa) in 96-well V-bottom plates for 4 h at 37°C (total volume 200 µl). The plates were centrifuged, radioactivity of 100 µl of supernatants was determined and percentage of specific lysis was calculated.

Mixed lymphocyte reactions
LEW nylon-wool-purified LN cells (105) were incubated either with 105 LEW.1F-irradiated LN cells (2000 rad) or with 105 mitomycin C-treated RT1.A-expressing rCD80-P815 cells in round-bottom microtiter plates in supplemented RPMI.

After 5 days, the proportion of VA8S2-expressing responder cells was analyzed by immunostaining and FACS analysis.

Modeling of a VA8S2l TCRA chain and Af molecules.
Protein modeling of a VA8S2l TCRA chain and Af was done with help of the Automated Protein Modeling server `Swiss-Model' (www.expasy.ch) by using coordinates of known TCRA and MHC class I molecules as templates. For visualization the free molecular visualization software `RasMol' (www.umass.edu/microbio/rasmol) was used.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The minimum size of the rat VA8 family
Using the mAb G177 specific for the VA8S2 segment in LEW rats, we had previously observed a dramatic overselection of CD8 T cells expressing this VA segment by the RT1f haplotype, resulting in 11–13% usage in the periphery of LEW.1F (RT1f ) as compared to 2% in LEW congenic rats expressing other RT1 alleles. This strong allele-specific MHC reactivity of a VA8 segment could either be a common feature of the structurally highly related VA8 family or be dependent on a few amino acid residues unique to the CDR1 and CDR2 of VA8S2. Since mAb G177 does not react with other members of the VA8 family, their overselection by RT1f would have remained undetected by serological analysis. In order to establish the minimum size of the expressed VA8 family in LEW rats, >100 VA8 cDNAs obtained with pan VA8 primers were sequenced. Eight new sequences were obtained (Fig. 1AGo), bringing the known VA8 segments expressed in LEW rats to 14, close to the 15 VA8 family members reported in mice (29). The minimum size of the expressed VA8 family thus defined excludes the possibility that even half of its members are expressed in CD8 T cells at the same high frequency of 11–13% observed for VA8S2. Sequence alignment of the rat VA8 family reveals that the CDR1 sequence of VA8S2 is shared with another three family members (S10, 11 and 14), its CDR2 with one (S3).



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 1. Alignment of VA8 peptide sequences. (A) VA8 LEW family members aligned with the consensus sequence. (B) VA8S2 sequences from LEW and Sprague Dawley. The numbering system for amino acid residues and location of CDR1 and CDR2 are as in (29). The nomenclature of TCR genes used in this paper was published by the WHO–IUIS Nomenclature Sub-Committee on TCR (39). Nucleotide sequence accession numbers (EMBL): VA8S2–VA8S7, X80509–X80514; VA8S8–VA8S12, AJ277663–AJ277667; VA8S13, Y09185; VA8S14, Y09187; VA8S15, Y09186; VA8S2 (Sprague–Dawley), AJ277668.

 
Contribution of VA8S2 CD8 T cells to RT1f-mediated selection of VA8 segments
The representation of VA8 segments other than VA8S2 in CD8 T cells from non-overselecting (LEW) and overselecting (LEW.1F) rats was estimated by Northern analysis of CD8 T cells with an VA8-pan-reactive probe with or without prior depletion of VA8S2-expressing cells. As shown in Fig. 2Go, this analysis reveals that >50% of the VA8 mRNA observed in CD8 T cells from LEW.1F rats is accounted for by VA8S2. Furthermore, VA8S2-negative transcripts of the VA8 family are only 2-fold more frequent in LEW.1F as compared to LEW. Accordingly, other family members participate only modestly in allele-specific overselection (2-fold on average), either through cumulative small contributions of several or through a more pronounced overselection of one as yet undefined, and probably VA8S2-like, member.




View larger version (89K):
[in this window]
[in a new window]
 
Fig. 2. Northern Blot analysis of VA8 transcripts. (A) RNA from: CD8 LN cells from LEW or LEW.1F, depleted or not of VA8S2+ cells and T cell hybridomas (THO) containing or not TCRAV8S2 transcripts was hybridized with either a CA probe or a VA8 probe. (B) Densitometric analysis of VA8 signals. To compensate for variations of amounts loaded between samples, optical densities of VA8 signals were normalized to the CA signal in each lane. The optical density of the CD8 LEW.1F probe was set at 100%.

 
This experiment shows that the over-representation of VA8S2 in CD8 T cells of RT1f rats of the LEW background is due to an exceptionally efficient selection of the VA8S2 family member rather than of the VA8 family as a whole.

Identification of the RT1f class I molecule mediating VA8S2 hyper-reactivity
In order to characterize the genetic basis for VA8S2 overselection in CD8 T cells of LEW.1F rats, cDNA clones encoding MHC I molecules of the polymorphic locus RT1.A were isolated using specific primers for RT-PCR amplification (30). Two RT1 class I molecules were isolated, and termed Af and A2f (Fig. 3Go). Transfection of Af and A2f into mouse L929 fibroblasts and serological typing with a panel of mAb directed to polymorphic determinants on RT1.A molecules revealed that the previously defined serologic characteristics of MHC I in the RT1f haplotype was fully accounted for by the Af molecule, whereas only a subset of RT1f-reactive mAb also bound to A2f (Table 1Go). Moreover, cytotoxic T lymphocytes (CTL) generated in mixed lymphocyte responses of LEW against LEW.1F lysed L929 cells transfected with Af but not those expressing A2f to similar expression levels (Fig. 4Go). Together, these results indicate that Af is the major target of MHC I allorecognition in the RT1f haplotype.



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 3. Alignment of MHC class I protein sequences. The {alpha}1 to {alpha}3 domains of Af, Al, A2f and Aa are displayed. Asterisks represent identity to the Af sequence.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Antibody reactivity of MHC class I molecules
 


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 4. Differential recognition of Af and A2f by RT1f-activated LEW effector cells. (A) L929 cells transfected with Af, Al, A2f and Aa were used as targets in a cytotoxicity assay of LEW LN cells pre-stimulated with LEW.1F. Untransfected L929 cells were also used as controls. (B) MHC class I expression level on transfected L929 cells. Transfectants were stained with OX18 and analyzed by flow cytometry.

 
In order to establish whether Af interacts preferentially with the VA8S2 segment, we made use of our previous observation that overselection of CD8 T cells expressing this segment by RT1f is not only observed in thymic T cell development but also in alloreactivity of RT1f– congenic LEW strains against LEW.1F (5). Although this effect is considerably smaller than that observed in thymic development (~3-fold), it is highly reproducible and provides a convenient means for screening VA8S2 selection without the need to generate transgenic rat strains. Accordingly, CD8 T cells from LEW rats were stimulated with mouse P815 mastocytoma cells transfected with the CD28 ligand CD80 to provide co-stimulation (31) and retrovirally transduced with Af or A2f or, as an additional control, Aa. Aa was chosen because its extracellular portion differs from that of Af by only seven amino acid residues (Fig. 3Go), only four of which are exposed for TCR recognition (62, 65, 69 and 167) (see Fig. 8AGo), but does not mediate overselection in thymic development or enhanced alloreactivity of CD8 T cells expressing VA8S2 (5). As can be seen in Fig. 5Go, the presence of Af, but not of A2f or Aa at the surface of transduced stimulator cells resulted in an increase in the frequency of VA8S2-expressing cells among the CD8 T cell blasts thus generated. In all other groups, stimulation with P815 tumor cells actually resulted in a decrease in VA8S2-expressing cells among the activated CD8 T cell population, probably due to the preferential usage of other VA segments in the xenoresponse against mouse H-2d. Accordingly, the newly identified Af molecule mediates overselection of VA8S2-expressing CD8 T cells in alloreactivity and most likely also in thymic development.



View larger version (49K):
[in this window]
[in a new window]
 
Fig. 8. (A) Footprint of the TCRA CDR1 and CDR2 on Af. Af was modeled by using known MHC class I coordinates and the RasMol program. The seven amino acids differing between Aa and Af are indicated by dark areas on the helices. The positions of the potential TCR-contact residues are numbered. The footprint of the TCRA CDR was drawn according to the published TCR–MHC structures (2–4). (B) Model of a VA8S2l+ TCRA chain. An RT1f-alloreactive VA8S2l+ TCRA chain was modeled by using known TCRA coordinates and the RasMol program. Only the variable domain is displayed. View looking from above the CDR loops which are shadowed for orientation. Amino acids A27 and D30 are indicated by dark areas on CDR1.

 


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 5. Preferential expansion of VA8S2+ CD8 cells by Af. LEW LN cells were incubated for 5 days with irradiated LEW.1F LN cells or P815-rCD80 mastocytoma cells transduced with Af, Aa or A2f. The bars represent the mean percentage (n = 6) ± SD of VA8S2+ cells among small CD8 cells (shaded bars) or CD8 blasts (open bars).

 
Apparent lack of VA8S2 overselection in another RT1f strain
To confirm the results obtained using LEW congenic strains in another background, we looked for VA8S2 expression in rats of the Sprague-Dawley outbred strain, which had been serologically typed as expressing the RT1f haplotype. To our surprise, peripheral CD8 T cells of Sprague-Dawley rats contained only 3% (2.99 ± 0.02, n = 3) VA8S2-expressing CD8 T cells rather than the 12 % (12.6 ± 0.8, n = 4) observed in LEW.1F (Fig. 6Go). As a most obvious possibility for this discrepancy, we considered that although serologically cross-reactive, the VA8S2 segment and/or the RT1.A regions of Sprague-Dawley and LEW.1F were not identical. Accordingly, VA8S2 cDNA from the Sprague-Dawley strain was isolated and sequenced. As shown in Fig. 1Go(B), the VA8S2 segment expressed by Sprague-Dawley T cells reactive with mAb G177 differs from the LEW sequence in only two nucleotides resulting in two amino acid differences. One of these (A -> T at position 65) is located proximal to the HV4{alpha} region (residues 67–72) (32) which has been reported to participate in TCR recognition of MHC class II (33) and MHC class I (2) molecules. The other amino acid difference, a consensus N instead of the S found in VA8S2, is located in CDR2 and thus could more directly affect recognition of RT1.Af.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 6. Expression of VA8S2+ cells in peripheral CD8 cells. Phenotype of (A) LN cells from LEW.1F (20,000 events), (B) LN cells from Sprague-Dawley (20,000 events) and (C) peripheral blood lymphocytes from rats generated by four backcrosses of Sprague-Dawley to LEW (LEW.1FSD) (10,000 events). Numbers indicate percentage of total events contained in the corresponding quadrants and percentages in parentheses represent the frequency of VA8S2+ cells among CD8 T cells.

 
The ability of the Sprague-Dawley-derived RT1f haplotype to overselect the LEW form of the VA8S2 segment was tested by its introduction into the LEW background through four generations of backcrossing and breeding to homozygocity. As can be seen in Fig. 6Go(C), co-expression of LEW TCRA genes with RT1f derived from Sprague-Dawley leads to the same dramatic over-representation of VA8S2-expressing CD8 T cells in the periphery previously observed in LEW.1F.

In summary, the different usage of VA8S2 in Sprague-Dawley as compared to LEW.1F maps to the Tcra locus containing distinct VA8S2 segments and not to the MHC.

Comparable RT1f reactivity of both `high-expressor' and `low-expressor' VA8S2 forms
In order to investigate more directly the MHC I-restricted overselection of TCR carrying the Sprague-Dawley form of VA8S2 (VA8S2SD), frequencies of G177-reactive immature thymocytes and mature CD8 T cells were compared in the two RT1f strains, Sprague-Dawley and LEW.1F, which express VA8S2SD and VA8S2l respectively. As shown in Fig. 7Go, there was a dramatic difference in the representation of the two VA8S2 segments in immature CD4/CD8 double-positive thymocytes: while ~4% of TCRlow double-positive cells in the LEW background expressed VA8S2 (3.5 ± 0.4, n = 4), this figure was only 0.8 % in Sprague-Dawley (0.86 ± 0.08, n = 3). Based on these frequencies in the preselection repertoire, the different representation among mature, TCRhigh thymocytes (8.4 ± 1.2, n = 4 versus 1.73 ± 0.06, n = 3; Fig. 7Go) and peripheral CD8 T cells (12 versus 3%; Fig. 6Go) are sufficiently explained on the basis of precursor availability. Thus, both VA8S2l and VA8S2SD are overselected in the thymus of RT1f+ rats, presumably by the Af molecule presently identified as being preferentially recognized by VA8S2l using T cells. Accordingly, the expression of VA8S2SD, like that of VA8S2l, should show a CD8 bias in peripheral T cells. This was indeed found to be the case: VA8S2SD is 5-fold more frequent in CD8 than in CD4 T cells of Sprague-Dawley rats (data not shown).



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 7. Expression of VA8S2 in the thymus of LEW.1F and Sprague-Dawley. Thymocytes were stained with either anti-{alpha}ßTCR or anti-VA8S2 mAb and analyzed by flow cytometry. Only VA8S2 expression in total thymocytes is shown. The boxes define the TCRlow and TCRhigh compartments, and the numbers indicate the events that they contain. Percentages in parentheses represent the frequency of VA8S2+ cells among total TCRlow or TCRhigh thymocytes.

 
The notion that VA8S2l and VA8S2SD both code for VA segments which are hyper-reactive to RT1f was then tested by overselection in alloreactivity. First, rats expressing either VA8S2l or VA8S2SD and homozygous for RT1a were obtained by breeding to the DA strain which itself does not express a VA segment reactive with mAb G177 (N. Torres-Nagel, unpublished). T cells from these RT1a/a responder strains were then stimulated with RT1f-expressing stimulators and frequencies of G177-reactive CD8 T cells among the resulting blasts were compared to those of the starting population. Similar expansion factors (10- and 16-fold) were observed for both populations of responding CD8 T cells (Table 2Go).


View this table:
[in this window]
[in a new window]
 
Table 2. Expression of VA8S2 among CD8 blasts generated by RTf activation
 
Together, these results indicate that, contrary to our expectations, both VA8S2 segments are overselected by Af to a similar degree and that the dramatic overexpression of VA8S2 in the LEW background is the combined result of two factors, i.e. RT1 allele-specific overselection and a high representation in the preselection repertoire of LEW rats.


    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Through the identification of the Af molecule as the one responsible for overselection of VA8S2-expressing CD8 T cells, and repertoire analysis of novel VA8 family members and a new VA8S2 form, the present results narrow down the likely points of interaction between Af and VA8S2. In addition, they show that specific regulation of VA segment expression prior to repertoire selection has a similarly strong impact on VA usage in the mature repertoire as MHC-directed selection.

Two class I molecules were cloned using PCR primers designed to amplify preferentially polymorphic A locus molecules of the rat. The expression of two polymorphic RT1.A molecules by a given haplotype is not unusual (34,35). With regard to the present analysis of VA8S2/ RT1f interactions, it became clear, however, that Af, and not A2f is the one recognized by this VA segment: Af but not A2f transfectants stimulated the preferential activation of VA8S2-expressing CD8 T cells. It is possible that A2f does not participate in MHC-restricted or alloreactive responses at all, since A2f transfection did not sensitize target cells for killing by CTL from LEW rats raised against RT1f stimulator cells. The importance of the A2f molecule for T cell recognition thus remains to be determined.

Interestingly, Af is highly related to Aa (35), allowing some speculations about which molecular details are recognized by VA8S2 in overselection by Af. Based on the crystal structures of human MHC I molecules, the peptide selectivity of Aa and Af are expected to be very similar. Thus, pockets D, E and F are identical in both molecules (F being important for TAP selectivity); however, two amino acid differences (63 and 70) may alter the B pocket requirements (36,37). The strong overselection of VA8S2 by Af and not by Aa is, therefore, unlikely to be secondary to the binding of a different set of peptides. With regard to the potential interaction sites of polymorphic residues of the {alpha}1 and {alpha}2 helices, modeling of Af and Aa and search for potential contact sites with CDR1 or CDR2 of VA8S2 according to the published TCR–MHC crystal structures (24) suggests that the Af-specific amino acid residues E62 and S167 are potential contact sites for CDR1 (Fig. 8AGo). In contrast, none of the residues differing between the two molecules is described as a potential CDR2 or HV4{alpha} contact site. In addition, VA8S2 differs from the VA8 consensus in the CDR2 region only by a substitution of N53 by S, and VA8S2SD, which is also overselected by Af, expresses the consensus N53. Accordingly, this amino acid residue is unlikely to specifically recognize Af, a notion in line with the absence of MHC contacts at that position of CDR2 in the published TCR/MHC crystal structures (14). Therefore, we favor the hypothesis that allele-specific recognition of Af by VA8S2 is primarily mediated by CDR1, where both VA8S2l and VA8S2SD differ from the VA consensus by two amino acid residues (T -> A 27 and N -> D 30) (Fig. 8BGo). These could be involved in recognizing the two amino acid differences between Af and Aa which are predicted to point from the MHC helices towards the TCR, i.e. E62 and S167 in Af versus Q62 and W167 in Aa.

Importantly, the CDR1 sequence of both VA8S2 forms is shared with another three VA8l family members (Fig. 1Go), i.e. S10, S11 and S14. Although Northern analysis of VA8 family-specific mRNA after elimination of VA8S2-expressing CD8 T cells indicates that on average, VA8 segments other than VA8S2 are only 2-fold overselected in an allele-specific manner by Af (Fig. 2Go), it is impossible to estimate the degree of overselection for individual family members without segment-specific reagents. Thus, as will be further discussed below, strong allele-specific overselection from a very low representation in the preselection repertoire would hardly be visible in the combined analysis of all VA8 family members without VA8S2. Nevertheless, it is noteworthy that those three VA8 family members sharing the CDR1 sequence with VA8S2 form a subfamily of their own by sharing an additional set of amino acids distinct from the consensus sequence, which together might disfavor Af recognition.

The findings obtained regarding VA8S2 expression in the RT1f+ Sprague-Dawley strain illustrate that Tcra-haplotype specific regulation of VA expression during thymocyte differentiation has a strong impact on the composition of the post selection repertoire. Thus in both the LEW.1F and the Sprague-Dawley strains, allele-specific overselection by Af amplifies the frequency of VA8S2-utilizing CD8 T cells by a factor of 3.5 as compared to the preselection repertoire, but the 4-fold lower frequency of VA8S2-expressing precursors in Sprague-Dawley as compared to LEW.1F (0.8 versus 3.5%) also results in a 4-fold lower representation among peripheral CD8 T cells (3 versus 12%). The mechanism leading to the low number of VA8S2+ precursors in Sprague-Dawley strains is unknown. A possibility would be poor pairing of VA8S2SD with ß chains. However the Vß repertoire of VA8S2+ cells is essentially the same as that of total T cells in both the LEW.1F and the Sprague-Dawley strains (data not shown). Alternatively a set of peptides differing between the LEW and the Sprague-Dawley backgrounds might participate in a selection event leading to the low number of VA8S2 precursors observed in the Sprague-Dawley strain. While this possibility was not formally ruled out by backcrossing of VA8S2l into the Sprague-Dawley background due to the genetic heterogeneity of the Sprague-Dawley outbred strain, the following two observations argue against distinct MHC–peptide complexes being responsible for the differences in immature VA8S2 precursor frequency between both strains. First, introduction of the Sprague-Dawley Tcra locus into the DA background, which lacks mAb G177-reactive cells, also resulted in a low frequency of VA8S2+ TCRlow thymocytes regardless of the thymic MHC (`neutral' RT1a or hyper-reactive RT1f). Second, the ability of Af expressed by murine tumor cells to overselect VA8S2 in alloreactivity indicates that recognition of rat strain-specific peptides is not required. Taken together these observations suggest that a preselection event, most likely a difference in rearrangement frequencies, is responsible for the different usage of VA8S2 in the LEW versus the Sprague-Dawley backgrounds.

In mice a preferential expression of VA segments in CD4+ or CD8+ cells independent of MHC haplotype has been extensively reported (10). This is in agreement with structural data which revealed that a high proportion of the TCR–MHC contacts are with non-polymorphic MHC residues and that the TCR{alpha} chain has more contacts with the MHC molecule than the TCRß chain (38). Hence the VA segment seems to play an important role in determining MHC class restriction. Similarly, the rat VA8S2 segment is more frequently expressed by CD8+ than by CD4+ cells in several MHC haplotypes indicating a general preference of this VA segment for MHC class I molecules. In addition, however, it is strongly overselected by Af (5) through interaction with polymorphic residues. This particular interaction between a VA segment and an MHC allele may reflect a more general phenomenon not previously reported in mice in the same magnitude due to either the limited availability of VA-specific reagents or the analysis of the peripheral repertoire without considering the preselection repertoire. Alternatively, the combination of a high representation of a VA segment in the preselection repertoire and its preferential interaction with polymorphic and non-polymorphic MHC residues described here may represent a rare case observed only in selected inbred strains. In any event, the dramatic subset-specific over-representation of a VA segment observed in LEW.1F provides a useful tool for the analysis of a general, if usually less prominent, feature of repertoire generation.

In summary, our results show that through random combination of alleles of polymorphic MHC and the Tcra loci, dramatic distortions of TCRVA usage from the expected 1% for each segment are possible for individual members of a species. These dramatic distortions are genetically controlled by both variations in VA segment availability in the preselection repertoire, and MHC class- and allele-specific selection events.


    Acknowledgments
 
We thank Beate Geyer for excellent technical assistance, Dr Thomas Herrmann for critical review of the manuscript and K. Okumura for the P815 cells transfected with CD80. This work was supported by SFB 479 and by Fonds der chemischen Industrie. E. J. was supported by a BBSRC fellowship.


    Abbreviations
 
CDR complementarity-determining region
CTL cytotoxic T lymphocyte
LN lymph node

    Notes
 
The first two authors contributed equally to this work

Transmitting editor: H. R. MacDonald

Received 15 May 2000, accepted 28 September 2000.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Garcia, K. C., Degano, M., Stanfield, R. L., Brunmark, A., Jackson, M. R., Peterson, P. A., Teyton, L. and Wilson, I. A. 1996. An {alpha}ß T cell receptor structure at 2.5 A and its orientation in the TCR–MHC complex. Science 274:209.[Abstract/Free Full Text]
  2. Garboczi, D. N., Ghosh, P., Utz, U., Fan, Q. R., Biddison, W. E. and Wiley, D. C. 1996. Structure of the complex between human T cell receptor viral peptide and HLA-A2. Nature 384:134.[Medline]
  3. Garcia, K. C., Degano, M., Pease, L. R., Huang, M., Peterson, P. A., Teyton, L. and Wilson, I. A. 1998. Structural basis of plasticity in T cell receptor recognition of a self peptide–MHC antigen. Science 279:1166.[Abstract/Free Full Text]
  4. Ding, Y. H., Smith, K. J., Garboczi, D. N., Utz, U., Biddison, W. E. and Wiley, D. C. 1998. Two human T cell receptors bind in a similar diagonal mode to the HLA-A2/Tax peptide complex using different TCR amino acids. Immunity 8:403.[Web of Science][Medline]
  5. Torres-Nagel, N., Herrmann, T., Giegerich, G., Wonigeit, K. and Hünig, T. 1994. Preferential TCR V usage in positive repertoire selection and alloreactivity of rat T-lymphocytes. Int. Immunol. 6:1367.[Abstract/Free Full Text]
  6. Sim, B. C., Travers, P. J. and Gascoigne, N. R. 1997. V alpha 3.2 selection in MHC class I mutant mice: evidence for an alternate orientation of TCR–MHC class I interaction. J. Immunol. 159:3322.[Abstract]
  7. Sim, B. C. and Gascoigne, N. R. 1999. Reciprocal expression in CD4 or CD8 subsets of different members of the V alpha 11 gene family correlates with sequence polymorphism. J. Immunol. 162:3153.[Abstract/Free Full Text]
  8. Barber, D. F., Lopez, D. and Lopez de Castro, J. A. 1995. T cell receptor diversity in alloreactive responses against HLA-B27 (B*2705) is limited by multiple-level restrictions in both alpha and beta chains. Eur. J. Immunol. 25:2479.[Web of Science][Medline]
  9. Li, Y. Y., Smith, K. D., Shi, Y. and Lutz, C. T. 1996. Alloreactive anti-HLA-B7 cytolytic T cell clones use restricted T cell receptor genes. Transplantation 62:954.[Web of Science][Medline]
  10. Sim, B. C., Lo, D. and Gascoigne, N. R. 1998. Preferential expression of TCR V alpha regions in CD4/CD8 subsets: class discrimination or co-receptor recognition? Immunol. Today 19:276.[Web of Science][Medline]
  11. Sim, B.-C., Zerva, L., Greene, M. I. and Gascoigne, N. R. J. 1996. Control of MHC restriction by TCR V{alpha} CDR1 and CDR 2. Science 273:963.[Abstract]
  12. Sim, B. C., Aftahi, N., Reilly, C., Bogen, B., Schwartz, R. H., Gascoigne, N. R. and Lo, D. 1998. Thymic skewing of the CD4/CD8 ratio maps with the T cell receptor alpha-chain locus. Curr. Biol. 8:701.[Web of Science][Medline]
  13. Torres-Nagel, N., Deutschländer, A., Herrmann, T., Arden, B. and Hünig, T. 1997. Control of TCRV{alpha}-mediated positive repertoire selection and alloreactivity by differential J{alpha} usage and CDR3{alpha} composition. Int. Immunol. 9:1441.[Abstract/Free Full Text]
  14. Torres-Nagel, N. E., Herrmann, T. and Hünig, T. 1998. The rat T cell receptor. In Pastoret, P. P., Griebel, P., Bazim, H. and Govaerts. A., eds, Handbook of Vertebrate Immunology, p. 162. Academic Press, New York.
  15. Torres-Nagel, N., Giegerich, G., Gold, D. P. and Hünig, T. 1994. Identification of rat Tcra V 4 and 8 gene products by monoclonal antibodies and cDNA sequence. Immunogenetics 39:367.[Web of Science][Medline]
  16. Torres-Nagel, N., Kraus, E., Brown, M. H., Tiefenthaler, G., Mitnacht, R., Williams, A. F. and Hünig, T. 1992. Differential thymus dependence of rat CD8 isoform expression. Eur. J. Immunol. 22:2841.[Web of Science][Medline]
  17. Hünig, T., Wallny, H.-J., Hartley, J. K., Lawetzky, A. and Tiefenthaler, G. 1989. A monoclonal antibody to a constant determinant of the rat T cell antigen receptor that induces T cell activation. J. Exp. Med. 169:73.[Abstract/Free Full Text]
  18. Wang, M., Stepkowski, S. M., Tian, L., Langowski, J. L., Yu, J. and Kahan, B. D. 1996. Nucleotide-sequences of 3 distinct clones coding for rat heavy-chain class-I major histocompatibility antigens. Immunogenetics 43:318.[Web of Science][Medline]
  19. Joly, E., Clarkson, C., Howard, J. C. and Butcher, G. W. 1995. Isolation of a functional cDNA encoding the RT1.Au MHC class I heavy-chain by a novel PCR-based method. Immunogenetics 41:326.[Web of Science][Medline]
  20. Salgar, S. K., Sawai, H., Kunz, H. W. and Gill, T. J. 1994. Cloning and expression of the rat class-I MHC gene RT1.Al. Immunogenetics 39:447.[Web of Science][Medline]
  21. Joly, E. and Oldstone, M. B. A. 1991. Manufacture of a functional cDNA for the H-2Db molecule using a retroviral shuttle vector. Immunogenetics 34:62.[Web of Science][Medline]
  22. Joly, E. and Oldstone, M. B. A. 1991. Generation of a functional cDNA encoding the Ld H2 class-I molecule by using a single-LTR retroviral shuttle vector. Gene 97:213.[Web of Science][Medline]
  23. Rada, C., Lorenzi, R., Powis, S. J., van den Bogaerde, J., Parham, P. and Howard, J. C. 1990. Concerted evolution of class I genes in the major histocompatibility complex of murine rodents. Proc. Natl Acad. Sci. USA 87:2167.[Abstract/Free Full Text]
  24. Gonzalez, A. L. and Joly, E. 1995. A simple procedure to increase efficiency of DEAE–dextran transfection of COS cells. Trends Genet. 11:216.[Web of Science][Medline]
  25. Butcher, G. W. 1987. A list of monoclonal antibodies specific for alloantigens of the rat. J. Immunogenet. 14:163.[Web of Science][Medline]
  26. Adam, M. A., Ramesh, N., Miller, A. D. and Osborne, W. R. 1991. Internal initiation of translation in retroviral vectors carrying picornavirus 5' nontranslated regions. J. Virol. 65:4985.[Abstract/Free Full Text]
  27. Maeda, K., Sato, T., Azuma, M., Yagita, H. and Okumura, K. 1997. Characterization of rat CD80 and CD86 by molecular cloning and mAb. Int. Immunol. 9:993.[Abstract/Free Full Text]
  28. Soneoka, Y., Cannon, P. M., Ramsdale, E. E., Griffiths, J. C., Romano, G., Kingsman, S. M. and Kingsman, A. J. 1995. A transient three-plasmid expression system for the production of high titer retroviral vectors. Nucleic Acids Res. 23:628.[Abstract/Free Full Text]
  29. Arden, B., Clark, S. P., Kabelitz, D. and Mak, T. W. 1995. Mouse T cell receptor variable gene segment families. Immunogenetics 42:501.[Medline]
  30. Wang, M., Stepkowski, S. M., Tian, L., Langowski, J. L., Yu, J. and Kahan, B. D. 1996. Nucleotide sequences of three distinct clones coding for rat heavy chain class I major histocompatibility antigens. Immunogenetics 43:318.
  31. Nakajima, A., Watanabe, N., Yoshino, S., Yagita, H., Okumura, K. and Azuma, M. 1997. Requirement of CD28–CD86 co-stimulation in the interaction between antigen-primed T helper type 2 and B cells. Int. Immunol. 9:637.[Abstract/Free Full Text]
  32. Manning, T. C., Schlueter, C. J., Brodnicki, T. C., Parke, E. A., Speir, J. A., Garcia, K. C., Teyton, L., Wilson, I. A. and Kranz, D. M. 1998. Alanine scanning mutagenesis of an alphabeta T cell receptor: mapping the energy of antigen recognition. Immunity 8:413.[Web of Science][Medline]
  33. Thatte, J., Qadri, A., Radu, C. and Ward, E. S. 1999. Molecular requirements for T cell recognition by a major histocompatibility complex class II-restricted T cell receptor: the involvement of the fourth hypervariable loop of the Valpha domain. J. Exp. Med. 189:509.[Abstract/Free Full Text]
  34. Joly, E., Leong, L., Coadwell, J. W., Clarkson, C. and Butcher, G. W. 1996. The rat MHC haplotype RT1c expresses two classical class molecules. J. Immunol., 162:743.[Abstract/Free Full Text]
  35. Joly, E., Le Rolle, A. F., González, A. L., Mehling, B., Stevens, J., Coadwell, W. J., Hünig, T., Howard, J. C. and Butcher, G. W. 1998. Co-evolution of rat TAP transporters and MHC class I RT1-A molecules. Curr. Biol., 8:169.[Web of Science][Medline]
  36. Matsumura, M., Fremont, D. H., Peterson, P. A. and Wilson, I. A. 1992. Emerging principles for the recognition of peptide antigens by MHC class I molecules. Science 257:927.[Abstract/Free Full Text]
  37. Fremont, D. H., Stura, E. A., Matsumura, M., Peterson, P. A. and Wilson, I. A. 1995. Crystal structure of an H-2Kb–ovalbumin peptide complex reveals the interplay of primary and secondary anchor positions in the major histocompatibility complex binding groove. Proc. Natl Acad. Sci. USA 92:2479.[Abstract/Free Full Text]
  38. Garboczi, D. N. and Biddison, W. E. 1999. Shapes of MHC restriction. Immunity 10:1.[Web of Science][Medline]
  39. WHO–IUIS Nomenclature Sub-Committee on TCR Designation. 1995. Nomenclature for T cell receptor (TCR) gene segments of the immune system. Immunogenetics 42:451.[Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
P. Marrack, J. Bender, M. Jordan, W. Rees, J. Robertson, B. C. Schaefer, and J. Kappler
Presidential Address to The American Association of Immunologists : Major Histocompatibility Complex Proteins and TCRs: Do They Really Go Together Like a Horse and Carriage?
J. Immunol., July 15, 2001; 167(2): 617 - 621.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (4)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Torres-Nagel, N.
Right arrow Articles by Hünig, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Torres-Nagel, N.
Right arrow Articles by Hünig, T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?