Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Ritz, U.
Right arrow Articles by Seliger, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ritz, U.
Right arrow Articles by Seliger, B.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 13, No. 1, 31-41, January 2001
© 2001 Japanese Society for Immunology

Identification of sequences in the human peptide transporter subunit TAP1 required for transporter associated with antigen processing (TAP) function

Ulrike Ritz, Frank Momburg1, Hans-Peter Pircher2, Dennis Strand3, Christoph Huber and Barbara Seliger

Third Department of Internal Medicine, Johannes Gutenberg-University, Langenbeckstrasse 1 , 55131 Mainz, Germany
1 German Cancer Research Center, 69120 Heidelberg, Germany
2 Department of Immunology, University of Freiburg, 79104 Freiburg, Germany
3 First Department of Internal Medicine, Johannes Gutenberg-University, Mainz, Germany

Correspondence to: B. Seliger


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The heterodimeric peptide transporter associated with antigen processing (TAP) consisting of the subunits TAP1 and TAP2 mediates the transport of cytosolic peptides into the lumen of the endoplasmic reticulum (ER). In order to accurately define domains required for peptide transporter function, a molecular approach based on the construction of a panel of human TAP1 mutants and their expression in TAP1–/– cells was employed. The characteristics and biological activity of the various TAP1 mutants were determined, and compared to that of wild-type TAP1 and TAP1–/– control cells. All mutant TAP1 proteins were localized in the ER and were capable of forming complexes with the TAP2 subunit. However, the TAP1 mutants analyzed transported peptides with different efficiencies and displayed a heterogeneous MHC class I surface expression pattern which was directly associated with their susceptibility to cytotoxic T lymphocyte-mediated lysis. Based on this study, the TAP1 mutants can be divided into three categories: those expressing a similar phenotype compared to TAP1–/– or wild-type TAP1 cells respectively, and those representing an intermediate phenotype in terms of peptide transport rate, MHC class I surface expression and immune recognition. Thus, the results provide evidence that specific regions in the TAP1 subunit are crucial for the proper processing and presentation of cytosolic antigens to MHC class I-restricted T cells, whereas others may play a minor role in this process.

Keywords: antigen presentation, antigen processing, MHC, peptide transporter, T cell response


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The MHC class I antigens bind and present antigenic peptides to CD8+ cytotoxic T lymphocytes (CTL). These peptides are mainly generated from the degradation of cytosolic proteins by the multicatalytic proteasome complex (1). The yielded peptides are then transported from the cytosol into the endoplasmic reticulum (ER) via the ATP-dependent transporter associated with antigen processing (TAP) (2,3). The newly synthesized peptide-receptive MHC class I heavy chain/ß2-microglobulin (ß2m) dimer forms a transient loading complex with TAP and a set of molecular chaperones (47). Nucleotide binding by TAP mediates an association of the MHC class I molecules with peptide, followed by release of the trimeric MHC class I–ß2m–peptide complex from the ER and its subsequent transport to the cell surface (810).

TAP, a member of the large family of ATP-binding cassette transporters, is a heterodimeric complex consisting of two subunits (TAP1 and TAP2) (1113). It has the capacity to transport peptides preferentially with a length of 8–15 amino acids. In addition, TAP displays a considerable substrate preference, which affects the antigenic repertoire presented by MHC class I molecules.

TAP-mediated peptide translocation requires two steps: the ATP-independent peptide binding to the cytosolic part of TAP and the ATP-dependent transport into the ER (2,1416). Analyses of cells with structural alterations in TAP (17,18) and of TAP1 knockout (TAP1–/–) mice (19) as well as the administration of viral TAP inhibitors (20) underscore the crucial role of this molecule in the antigen-processing pathway. Lack of TAP expression resulted in impaired assembly and intracellular transport of MHC class I heavy chain–ß2m heterodimers, severely reduced levels of MHC class I surface antigens and inefficient generation of CD4CD8+ T cells (19).

It is apparent that TAP is involved in numerous interactions inside the ER and the cytosol, but the exact features of TAP have not been defined in detail. Based on structure and functional analyses, different topology models for TAP have been proposed (2123). Depending on the predicted model, both subunits consist of six to 10 transmembrane segments containing the pore-forming and nucleotide-binding domains in addition to the C-terminal ATP-binding domain located in the cytoplasm (2124). Functional analysis of C-terminal deletion mutants as well as peptide cross-linking experiments to the human peptide transporter defined multiple regions in both TAP subunits which putatively contribute to the peptide-binding site (2527). Although these models provide some information about the dynamics of peptide binding and translocation, the TAP domains absolutely required for transporter function have still to be elucidated. In order to define sequences of the human TAP1 molecule responsible for TAP function, a series of human TAP1 mutants was designed, expressed in TAP1–/– cells, and subsequently analyzed in terms of peptide transport efficiency, stability of MHC class I surface expression and specific lysis by MHC class I-restricted CTL.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Construction of TAP deletion mutants
The 2.6 kb BamHI–NotI fragment of the human TAP1A cDNA (28) was cloned into the polylinker region of the vector pBluescript SK+ (pBS; Stratagene, Amsterdam, The Netherlands). This template was used for the generation of specific deletions according to the method of Kunkel (29). Standard PCR reactions were performed with the native Pfu polymerase (Stratagene) in a Biometra cycler using two TAP1-specific primer sets (Fig. 1Go). Primer 1 (5'-ACCATGGGCCACGTGCACAGCCAC-3') and primer 4 (5'-CAACAGACCACTGGGTGGGCAGCG-3') contained a BbrPI or a DraIII restriction site (marked in bold letters) respectively. The series of primers 2 linked DNA sequences flanking specific deletions of 30–183 bp, whereas corresponding primers 3 overlapped 15 bp with the 3' terminus of the specific primers 2. The complete list of primers is summarized in Table 1Go.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1. Strategy of PCR mutagenesis employed for construction of TAP1 deletion mutants. PCR mutagenesis was performed as described in Methods. The first PCR reaction yielded amplification product 1a (primers 1 and 2), containing the BbrPI restriction site and the deletion, and the product 1b (primers 3 and 4), which overlapped product 1a and contained the DraIII restriction site. In the second PCR reaction, the overlapping products 1a and 1b were used as templates resulting in fragments containing the respective deletions of 30–183 bp.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Primers 2 and 3 used for PCR mutagenesis
 
For the generation of the TAP1 deletion constructs del1, del2, del3, del3a, del3b and del1–3, two subsequent PCR reactions were performed (Fig. 1Go): the first resulted in the amplification product 1a flanked by primers 1 and 2, and product 1b employing the primers 3 and 4 respectively. The following PCR conditions were used: 50 pmol of each primer; 95°C for 5 min denaturing; followed by 30 cycles: denaturing at 95°C for 1 min, annealing at 54°C for 1 min 30 s and extension at 72°C for 1 min 30 s. The amplification products 1a and 1b served as templates in a subsequent second PCR reaction (95°C for 5 min, 58°C for 2 min), plus reaction mix (containing reaction buffer, dNTPs and native Pfu polymerase), 58°C for 2 min, followed by 30 cycles (see above) employing an annealing temperature of 58°C. The resulting amplification products of 571–669 bp lacking the specific regions were then reintroduced into their original positions of the TAP1 cDNA. The mutant TAP1 del4 was constructed using primer 1 in combination with a 3' primer spanning the deletion site and carrying the restriction site DraIII [AGTCAACAGACCACTGGGTGGGCA (1393–1461, del 69 bp) GATGGAGAGCAGTACCTC] as marked in bold letters. In addition, two substitution mutants were cloned containing the fragment del1 instead of the elements of del2 and del3 respectively.

Upon confirmation of the integrity of the mutated/deleted segments by sequencing, the generated TAP1 mutants were cloned into the EcoRV site of the expression vector pIRES-Hyg (Clontech, Palo Alto, CA).

Cell lines and culture
TAP1–/– cells kindly provided by H.-G. Ljunggren (Karolinska, Stockholm) were established from a methylcholanthrene (MCA)-induced tumor of a TAP1–/– C57BL/6 (B6) mouse (H-2b; 20). Cells were maintained in RPMI medium (Seromed, Frickenhausen, Germany) supplemented with 10% FCS (Greiner, München, Germany), 2 mM L-glutamine, 100 µg/ml streptomycin and 100 U/ml penicillin.

Stable transfection of TAP1–/– cells
Gene transfer of TAP1–/– cells was performed by lipofection with different TAP1 mutants and control constructs. TAP–/– cells were seeded in six-well plates at 1x105 cells/well and transfected after 24 h with 0.5–1 µg linearized plasmid DNA using LipofectAMINE (Gibco/BRL, Gaithersburg, MD) according to the manufacturer's instructions. Cells were selected in RPMI medium supplemented with 100 µg/ml hygromcin B (Roche, Mannheim, Germany). At 2–3 weeks posttransfection, hygromycin-resistant (hygR) cell clones were isolated, checked in genomic PCR for genome integration of the transfected cDNA and expanded for further analysis.

Immunofluorescence
For immunofluorescence, 1x105 cells/well were seeded on sterile cover slips in six-well plates for 24 h, then washed twice with PBS followed by fixation with 4% paraformaldehyde in PBS for 10 min. After blocking in PBS/0.1% Tween/3% BSA for 2 h, coverslips were incubated with the appropriate concentration of the human anti-TAP1 (30) and/or anti-calnexin (Affinity, Golden, UK) mAb respectively. Cells were then extensively washed followed by incubation with Hoechst stain (Roche) and goat anti-mouse Ig–FITC as a secondary antibody. Images were obtained using a confocal laser microscope (Leica, Buffalo, NY).

Flow cytometry
For indirect immunofluorescence analysis, 5x105 cells were incubated with the appropriate concentration of the primary antibody (anti-H-2KbDb; Cedarlane, Hornby, Ontario, Canada) for 30 min on ice, then washed twice with PBS before being incubated with a FITC-conjugated goat anti-mouse Ig (Coulter/Beckman, Krefeld, Germany) as a secondary antibody for an additional 30 min at 4°C. Cells stained with the isotypic control antibody served as a reference. Upon washing of the labeled cells with PBS, 10,000 viable cells were analyzed on a flow cytometer (Coulter Epics XL MCL using System II 3.0; Beckman/Coulter).

Immunoprecipitation
Cells (2x106) cells were lysed with buffer containing 1% NP-40 before adding an anti-TAP2 mAb (kindly provided by K. Früh, San Diego, CA) overnight at 4°C followed by the addition of Protein A–Sepharose for 4 h. After two washing steps, the bound proteins were eluted, precipitated with TCA and then analyzed by Western blotting (see below).

ATP-binding assays
ATP-binding assays were performed as recently described (10). Briefly, cells were disrupted by freezing and thawing, and the resulting cell suspension was centrifuged at 1000 g for 10 min at 4°C. The supernatant was spun at 100,000 g for 1 h. Membrane pellets were resuspended in lysis buffer (TBS/MgCl2/2% CHAPS), incubated for 30 min on ice and centrifuged at 10,000 g for 30 min. Proteins were incubated with ATP–agarose (Sigma, Deisenhofen, Germany), eluted with elution buffer and analyzed by Western blotting.

Western blot analysis
For the detection of TAP proteins, samples from the immunoprecipitation and the ATP-binding assay respectively were size fractionated by 10% SDS–polyacrylamide gels, visualized by Ponceau S and transferred onto nitrocellulose membranes (Schleicher & Schüll, Dassel, Germany) in 50 mM Tris, 0.5% SDS, 400 mM glycine using a tank blot system (BioRad, Hercules, CA). Then, the membranes were blocked with Tris-buffered saline (TBS)/10% horse serum/5% milk powder/0.1% Tween 20 for 2 h, briefly rinsed with TBS/0.1% Tween 20 before incubation with the anti-human mAb TAP1 148.3 recognizing the C-terminus of TAP1 (30) for 2 h. After rinsing twice in TBS/0.1% Tween 20, membranes were incubated with an horse radish peroxidase-conjugated rabbit anti-mouse Ig-specific antibody (Dako, Hamburg, Germany) for an additional 1 h. After two washing steps the membranes were then developed using NBT/X phosphate as substrate or employing the ECL determination kit (Amersham Pharmacia, Freiburg, Germany).

Peptide transport assay
The peptide translocation experiments were performed essentially as described by Momburg et al. (2). The peptides #63 (RYWANATRI) and #600 (TNKTRIDGQY) were radiolabeled with 125I by the chloramine T method using 10 nmol peptide, 1.0 mCi 125I and Sephadex G-10 columns for removal of unincorporated iodine (31). After trypsinization, 2.5x106 TAP1–/– cells or transfectants were permeabilized with 2 IU streptolysin O (SLO; Welcome Reagent, Beckenham, UK) in 50 µl incubation buffer (130 mM KCl, 10 mM NaCl, 1 mM CaCl2, 2 mM EGTA, 2 mM MgCl2 and 5 mM HEPES, pH 7.3) for 5 min at 37°C followed by the addition of 10 µl ATP (10 mM; Roche) and 2.5 µl of radioiodinated peptides (0.5 µM) in a final volume of 160 µl, and incubated at 37°C for 20 min. Subsequent to cell lysis in 1% Nonidet P-40 (Sigma), glycosylated peptides were recovered by adding concanavalin A (Con A)–Sepharose beads (Pharmacia, Uppsala, Sweden) overnight and after extensive washing the radioactivity associated with the beads was measured by {gamma} counting. Translocation efficiencies were calculated according to the formula: c.p.m. (glycosylated labeled peptides bound to Con A beads)/ c.p.m. (total label of peptides)x100.

Infection with the lymphocytic choriomeningitis virus (LCMV) and cytotoxicity assay
Virus stocks of the WE strain of the LCMV were originally obtained by R. Zinkernagel (Zürich, Switzerland). Mice were infected i.v. with 200 p.f.u. LCMV-WE on day –8. On day 0, LCMV-infected spleen cells were isolated and resuspended in complete modified DMEM supplemented with 10% FCS and subsequently their cytolytic activity was tested by a 4 h standard 51Cr-release assay using LCMV-infected target cells as previously described (32).

Subconfluent monolayers (2x106) of TAP1–/– cells and/or transfectants expressing different TAP1 deletion mutants or the wild-type TAP1 were infected for 48 h at 37°C with LCMV-WE with a multiplicity of infection of 0.1–0.01. Proper LCMV infection of the target cells was confirmed by flow cytometry using LCMV glycoprotein (gp33)-specific antibodies. Cells were labeled with 200 µCi 51Cr for 2 h at 37°C, washed 3 times with DMEM supplemented with 5% FCS and counted. Target cells (5x104) were then incubated for 5 h in 96-well round-bottom plates with LCMV-WE C57BL6 splenocytes as effector cells at various E:T ratios (200:1, 77:1, 22:1, 7:1, 2:1 and 0.6:1) in a final volume of 200 µl. Spontaneous 51Cr-release rates ranged from 20 to 30% of the total counts incorporated into cells. Specific cytotoxicity was calculated as: percentage of specific 51Cr release = 100x(experimental c.p.m. – spontaneous c.p.m.)/(maximum c.p.m. – spontaneous c.p.m.). Each E:T cell ratio was tested in duplicates and the experiments were repeated at least twice.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Construction of TAP1 variants
A molecular approach targeting distinct regions of the human TAP1 subunit was used to determine sequences required for functional peptide transport. Based on the predicted transporter model published by Nijenhuis and Hämmerling (22), a set of TAP1 deletion mutants was constructed resulting in a complete (del1–3; 183 bp) or partial deletion (del1, del2, del3 and del 4; 60–69 bp) of potential peptide-binding domains. Deletion 3 was further subdivided into two parts generating the mutants del3a and del3b (each 30 bp). The cloning strategy used for introducing these serial deletions is summarized in Fig. 1Go, whereas Fig. 2Go schematically demonstrates the localization of the deletions in the hydrophobicity model of TAP1.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2. Schematic diagram of the generated series of TAP1 mutants. TAP1 del1: 63 bp (21 amino acids) deletion in TAP1 (amino acids 345–365). TAP1 del2: 60 bp (20 amino acids) deletion in TAP1 (amino acids 366–385). TAP1 del3: 60 bp (20 amino acids) deletion in TAP1 (amino acids 386–405); in addition this region was divided into two halves, which were also deleted, generating the constructs TAP1 del3a and TAP1 del3b. TAP1 del4: 69 bp (23 amino acids) deletion in TAP1 (amino acids 465–487). TAP1 amino acids 366–385 (region del2) were replaced by amino acids 345–365 (region del1) using PCR mutagenesis (TAP1 subst.2). The same approach was employed to create TAP1 subst.3, where TAP1 amino acids 386–405 (region del3) were replaced by amino acids 345–365 (region del1) using PCR mutagenesis.

 
To ensure whether the properties of the human TAP1 mutants were due to the specificity of deleted sequences, two substitution constructs were generated by replacing the region TAP1 del2 (1096–1155 bp) with the region del1 (subst.2; 1033–1095 bp) and the region del3 with region del1 (subst.3; 1156–1215 bp).

Stable expression and ER localization of TAP1 mutants in TAP1–/– cells
In order to characterize the function of the human TAP1 deletion/substitution mutants, the constructs were stably expressed in murine TAP1–/– cells. Transfection with the human wild-type TAP1 construct served as control. The genomic integration of the respective transgene(s) was determined in the hygR transfectants by genomic PCR (data not shown). Transgene-positive clones and bulk cultures were selected for further analyses. Since the data of at least five independently derived clones and one bulk culture obtained by transfection of the respective TAP1 construct were comparable, results of only one selected transfectant are representatively shown.

The transfectants carrying the human wild-type TAP1 or its deletion/substitution mutants were evaluated for TAP1 protein expression by Western blot analysis using the human anti-TAP1-specific mAb 148.3 (30). In contrast to the parental TAP1–/– cell line, all transfectants analyzed displayed a similar level of TAP1 protein expression (data not shown). To investigate whether the mutant and wild-type TAP1 proteins are inserted in the ER membrane, immunohistochemistry was performed using the anti-TAP1 mAb 148.3. Analysis of the ER-resident chaperone calnexin served as control. The staining of mutant TAP1 and wild-type TAP1 proteins closely matched that of calnexin with a typical reticular fluorescence pattern, indicating their ER localization (Fig. 3Go).



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 3. ER localization of human mutant and wild-type TAP1 proteins in TAP1–/– cells. TAP1–/– cells (1x105) transfected with the respective TAP1 mutants were seeded onto six-well plates. After 24 h cells were fixed and stained with anti-calnexin or anti-TAP1 antibodies as described in Methods. (A) TAP1–/– cells stained with anti-calnexin antibody. (B) TAP1–/– cells stained with anti-TAP1 antibody. (C) Wild-type TAP1 transfectants stained with anti-TAP1 antibody. (D) TAP1 del1 transfectants stained with anti-TAP1 antibody. (E) Wild-type TAP1del 3 transfectants stained with anti-TAP1 antibody.

 
Dimerization of mutant TAP1 proteins with TAP2
A prerequisite for peptide binding and translocation is the formation of a heterodimer consisting of TAP1 and TAP2 (13,14,17). Lysates from TAP1–/– transfectants expressing wild-type TAP2 together with the mutant TAP1 or wild-type TAP1 were immunoprecipitated with a TAP-specific antibody and probed for the presence of mutant TAP1 proteins with the anti-TAP1 mAb 148.3. As expected, wild-type TAP1 protein is associated with TAP2. Furthermore, the mutant TAP1 proteins were also capable of forming a complex with TAP2 (Fig. 4aGo) suggesting a dimerization of the different TAP1 mutants with TAP2. The distinct migration pattern of del1, del2, del3, del4 and del1–3 could be explained by the respective amino acid deletions.



View larger version (80K):
[in this window]
[in a new window]
 
Fig. 4. Co-precipitation of TAP1 deletion mutants with wild-type TAP2. Lysates of mutant TAP1 transfectants and control cells were analyzed for the TAP complex formation (A) and ATP-binding capacity (B). Proteins were separated by 10% SDS–PAGE, blotted onto nitrocellulose filters, and probed with the mAb TAP1 148.3 and mAb TAP2 respectively. Bound mAb was visualized using the ECL kit as described in Methods. Migration position of the wild-type TAP1/TAP2 is indicated.

 
Functional analysis of the TAP1 deletion mutants
The lack of an efficient peptide transport in TAP1–/– cells indicated that TAP1 is important for the activity of the peptide transporter (20). To analyze whether total or partial deletions of two predicted peptide-binding sites of TAP1 (22) exhibit functional consequences, the various transfectants were screened for ATP-binding activity as well as TAP-mediated peptide transport (2,10). As shown in Fig. 4Go(b), ATP-binding activity was demonstrated for wild-type as well as for all mutant TAP1 proteins. In addition, translocation assays performed with two iodinated reporter peptides (peptide #63 and #600) in the presence and absence of ATP revealed an ATP-dependent peptide transport in wild-type TAP1 transfectants, which was completely abolished in the parental TAP1–/– cells. The different TAP1 mutants displayed a heterogeneous peptide transport activity: TAP1 del1 and TAP1 del4 transfectants were capable of transporting peptides, but with a lower efficiency than wild-type TAP1 transfectants. TAP1 del 3a transported peptide #63 at a hardly detectable rate, whereas peptide #600 was not transported at all. All other mutants (del2, del3 and 3b) lack peptide transport (Table 2Go), suggesting that these regions are essential for peptide binding and/or translocating function of TAP.


View this table:
[in this window]
[in a new window]
 
Table 2. Selective peptide transport of different TAP1 mutants and control cells
 
Distinct MHC class I surface expression profile in TAP1 mutants
To test whether the different peptide transport rates correlate with the levels of MHC class I surface antigens, flow cytometry of the set of TAP1 mutants was performed using a mAb recognizing H-2Kb and H-2Db surface molecules. Parental TAP1–/– cells and wild-type TAP1 transfectants served as controls. As expected, TAP1–/– totally lack MHC class I surface expression, whereas wild-type TAP1 transfectants expressed high levels of MHC class I surface antigens with a mean specific fluorescence intensity of ~8.5. The various TAP1 mutants displayed a heterogeneous MHC class I profile: TAP1 del1 and TAP1 del4 showed levels of MHC class I expression almost similar to that of the wild-type TAP1 transfectants. In contrast, TAP1 del2, del3 and del1–3 transfectants expressed very low amounts of MHC class I surface antigens with mean specific fluorescence intensities ranging from 2.5 to 4, depending on the transfectant analyzed (Fig. 5Go). Furthermore, a heterogeneous expression pattern of MHC class I surface antigens exists in the transfectants TAP1 del3a and TAP1 del3b: TAP1 del3b showed slightly lower MHC class I expression levels than TAP1 del3 transfectants, whereas TAP1 del3a transfectants expressed higher levels of MHC class I surface antigens than TAP1 del3, indicating that the region deleted in TAP1 del3b (amino acids 386–395) appears to be more essential for peptide binding and/or transport than region del3a (amino acids 396–405; Fig. 5Go and Table 2Go). Both substitution transfectants exhibit similar levels of MHC class I antigen expression compared to TAP del2 and TAP del3 mutants respectively.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 5. MHC class I surface expression of wild-type TAP1 and TAP1 deletion mutant-transfected TAP1–/– cells. The series of TAP1 mutants was analyzed for MHC class I surface expression by flow cytometry using the mAb H-2KbDb. The results are expressed as mean specific fluorescence intensity.

 
Influence of TAP1 mutants on the presentation of the LCMV-specific antigens to LCMV-specific CTL
The infection of mice with the LCMV induces a strong CTL response specific for viral peptides which are presented on MHC class I molecules in a TAP-dependent manner (33). Therefore, this system was chosen to investigate whether LCMV-infected transfectants containing the various TAP1 mutants were capable of presenting viral antigen in the context of H-2b MHC molecules to LCMV-specific CTL. Both uninfected and LCMV-infected TAP1 mutants and parental cells were used as targets in a standard 4 h 51Cr-release assay, and were incubated with spleen cells from LCMV-infected C57BL/6 mice. As expected, all uninfected TAP1 variants, wild-type TAP1 and TAP1–/– cells as well as the virus-infected TAP1–/– cells were resistant to LCMV-specific lysis, whereas the wild-type TAP1 transfectants were efficiently lysed by these CTL. Cell-mediated lysis of the different LCMV-infected TAP1 deletion mutants correlated with the level of MHC class I surface expression: the transfectants TAP1 del1 and TAP1 del4 were as susceptible to lysis as wild-type TAP1 cells. The infected TAP1 del3a transfectants showed a reduced sensitivity to LCMV-specific lysis when compared to that of wild-type TAP1 transfectants, but the specific lysis was still relatively high. All other transfectants (TAP1 del2, del3 and del3b) were not recognized by these virus-specific CTL (Fig. 6Go).



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 6. Recognition of LCMV-infected TAP1 mutant transfectants by LCMV-specific CTL. LCMV-infected transfectants served as targets in a standard 4 h 51Cr-release assay; splenocytes obtained from day –8 with LCMV-infected C57BL/6 mice were used as effector cells. Lines with closed circles represent virus-infected cells. Target cells not infected with LCMV served as controls and are shown as closed diamonds.

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The goal of this study was to identify sequences in the putative cytosolic region of the TAP1 subunit of the human TAP transporter which are important for its function. Thus, possible peptide-binding sites were totally or partially deleted (Fig. 2Go). In order to accurately define the role of these sequences, MCA-induced cells from TAP1–/– mice were used as a model system, and stably transfected with a series of TAP1 deletion and wild-type TAP1 constructs respectively. A protein product of the expected size, an ER-specific localization, complex formation with TAP2 and ATP-binding was detected in all transfectants, whereas the parental TAP1–/– cells were negative for TAP1 protein expression (data not shown, Figs 3 and 4GoGo).

Apart from the analyses of the membrane localization, dimerization with TAP2 and ATP-binding capacity, the determination of the peptide transport rate in association with the MHC class I surface expression and CTL-mediated provided information about the sequences in the TAP1 subunit necessary for efficient antigen processing and presentation. The crucial observation was that the TAP1 mutants possess distinct functional activities, such as efficiency of peptide transport. The TAP1 del1 ({Delta}345–365) and del4 ({Delta}465–487) transfectants were capable of transporting both reporter peptides #63 and #600 in an ATP-dependent manner, whereas the TAP1 mutants with deletions between residues 366 and 405 (del2/3) were defective in peptide transport (Table 2Go). These data underscore the importance of specific segments in TAP1 for TAP function. However, the possibility that other regions of TAP1 can modify the peptide transport efficiency cannot been ruled out. Based on the structure of the multidrug resistance gene, it may be speculated that sequences/base pairs in other cytosolic loops and transmembrane regions of TAP1 may also affect TAP function (34). Furthermore, several examples have recently demonstrated that critical mutations or frame shifts due to deletions in human TAP alleles could prevent peptide transport (3538). Since sequence alterations can have a potential impact on the protein folding, TAP1 variants del2 and del3 may also affect the protein conformation. Although it cannot be totally excluded, this possibility was reduced by the analysis of substitution constructs (Fig. 1Go), demonstrating a transporter activity comparable to that of TAP1 del2 and TAP1 del3 transfectants (Table 2Go). Taken together, we conclude that functional and/or structural relevant sequence information is contained in the putative loop sequences of amino acid residues 366–405.

Antigen-processing mutants, including TAP1–/– cells, are known to lack stable MHC class I surface expression levels and are partially resistant to lysis by allo-specific CTL (18,20,37). In order to demonstrate the biological significance of the highly variable peptide transport capacity, the series of TAP1 deletion transfectants was further screened for both MHC class I antigen expression levels and for T cell-mediated immune recognition. For analysis of T cell responses, the advantage of the TAP-dependent processing and presentation of LCMV-specific CD8+ T cell epitopes was taken (33). The efficient peptide transport of TAP1 del1 and TAP1 del4 transfectants is accompanied by significant levels of MHC class I surface antigens as well as recognition by antigen-specific CTL, which was comparable to that of wild-type TAP1 transfectants. The impaired TAP function of the TAP1 deletion mutants del2 and del3 was associated with heterogeneous, but markedly reduced levels of MHC class I surface antigens and in most cases also with resistance to LCMV-specific CTL lysis. This underscores the existence of a significant correlation between the density of MHC class I surface antigens and the strength of immune response (Figs 5 and 6GoGo). An explanation of the residual presentation of LCMV-specific antigens by various deletion mutants may be due to a peptide transport rate in TAP1 del2 or TAP1 del3 which is not detectable in the translocation assay, suggesting that this method may not be applicable for the detection of extremely low/minimal peptide transport rates. Indeed, several groups demonstrated the presentation of viral antigens by MHC class I molecules circumventing the deficiencies of virus-infected mutant cell lines (40,41).

TAP1 del1 and del3a transfectants show moderate to high levels of MHC class I surface expression directly associated with the susceptibility to LCMV-specific CTL-mediated lysis, but a relatively low or minimal TAP function. The structural alterations of the TAP1 mutants may influence the peptide specificity of the TAP transporter, which could be due to changes in the direct interaction with the bound peptide. While the importance of specific TAP1 domains for transporter function was demonstrated, the selectivity of peptide transport has not been evaluated in this study. The human TAP2 subunit has been shown to influence transport specificity (27). Consistently, Uebel et al. (42) demonstrated a selectivity of human TAP by defining residues at different positions affecting the peptide-binding efficiency. The use of combinatorial peptide libraries will provide information about the influence of the TAP1 domains defined in this study on the peptide selectivity.

In conclusion, our data have important implications for the positioning of segments responsible for peptide binding which partially differ from that previously postulated (22), but are localized in the cytosolic domain of the TAP topology model recently suggested by Vos et al. (23,24). The TAP1 sequences defined in this study to contribute to transport function provide the basis of further investigations towards the understanding of the architecture of the TAP complex and the functional significance of specific TAP domains, which may allow the development of a TAP designer molecule with defined specificities in the future.


    Acknowledgments
 
We thank Dr R. Tampé (Marburg, Germany) for supplying us with mAb 148.3 and Dr K. Früh (San Diego, CA) for supplying us with mAb TAP2. This publication represents a substantial part of the PhD thesis of U. R.


    Abbreviations
 
ß2m ß2-microglobulin
Con A concanavalin A
CTL cytotoxic T lymphocytes
ER endoplasmic reticulum
LCMV lymphocytic choriomeningitis virus
MCA methylcholanthrene
SLO streptolysin O
TAP transporter associated with antigen processing
TBS Tris-buffered saline

    Notes
 
Transmitting editor: K. Eichmann

Received 29 February 2000, accepted 26 September 2000.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Goldberg, A. L. and Rock, K. L. 1992. Proteolysis, proteasomes and antigen presentation. Nature 357:375.[Medline]
  2. Neefjes, J. J., Momburg, F. and Hämmerling, G. J. 1993. Selectivity and ATP-dependent translocation of peptides by the MHC-encoded transporter. Science 261:769.[Abstract/Free Full Text]
  3. Momburg, F., Roelse, J., Hämmerling, G. and Neefjes, J. 1994. Peptide size selection by the major histocompatibility complex-encoded peptide transporter. J. Exp. Med. 179:1613.[Abstract/Free Full Text]
  4. Sadasivan, B., Lehner, P. J., Ortmann, B., Spiess, T. and Cresswell, P. 1996. Roles for calreticulin and a novel glycoprotein, tapasin, in the interaction of MHC class I molecules with TAP. Immunity 5:103.[Web of Science][Medline]
  5. Degen, E. and Williams, D. B. 1991. Participation of a novel 88-kD protein in the biogenesis of murine class I histocompatibility molecules. J. Cell. Biol. 112:1099.[Abstract/Free Full Text]
  6. Lewis, J. W. and Elliott, T. 1998. Evidence for successive peptide binding and quality control stages during MHC class I assembly. Curr. Biol. 8:717.[Web of Science][Medline]
  7. Schoenhals, G., Krishna, R., Grandea, A. G., Spies, T., Peterson, P. A., Yang, Y. and Früh, K. 1999. Retention of empty MHC class I molecules by tapasin is essential to reconstitute antigen presentation in invertebrate cells. EMBO 18:743.[Web of Science][Medline]
  8. Ortmann, B., Androlewicz, M. J. and Cresswell, P. 1994. MHC class I/ß2-microglobulin complexes associate with TAP transporters before peptide binding. Nature 368:864.[Medline]
  9. Suh, W.-K., Cohen-Doyle, M. F., Fruh, K., Wang, K., Peterson, P. A. and Williams, D. B. 1994. Interaction of MHC class I molecules with the transporter associated with antigen processing. Science 264:1322.[Abstract/Free Full Text]
  10. Knittler, M. R., Alberts, P., Deverson, E. V. and Howard, J. C. 1999. Nucleotide binding by TAP mediates association with peptide and release of assembled MHC class I molecules. Curr. Biol. 9: 999[Web of Science][Medline]
  11. Spies, T., Bresnahan, M., Bahram, S., Arnold, D., Blanck, G., Mellins, E., Pious, D. and DeMars, R. 1990. A gene in the human major histocompatibility complex class II region controlling the class I antigen presentation pathway. Nature 348:744.[Medline]
  12. Trowsdale, J., Hanson, I., Mockridge, I., Beck, S., Townsend, A. and Kelly, A. 1990. Sequence encoded in the class II region of the MHC related to the ABC superfamily of transporters. Nature 348:741.[Medline]
  13. Bahram, S., Arnold, D., Bresnahan, M., Strominger, J. L. and Spies, T. 1991. Two putative subunits of a peptide pump encoded in the human major histocompatibility complex class II region. Proc. Natl Acad. Sci. USA 88:10094.[Abstract/Free Full Text]
  14. van Endert, P. M., Tampe, R., Meyer, T. H., Tisch, R., Bach, M. and McDevitt, H. O. 1994. A sequential model for peptide binding and transport by the transporters associated with antigen processing. Immunity 1:491.[Web of Science][Medline]
  15. Androlewicz, M. J., Anderson, K. S. and Cresswell, P. 1993. Evidence that the transporter associated with antigen processing translocate a major histocompatibility complex class I binding peptide into the endoplasmic reticulum in an ATP-dependent manner. Proc. Natl Acad. Sci USA, 90:9130.[Abstract/Free Full Text]
  16. Müller, K., Ebensberger, C. and Tampé, R. 1994. Nucleotide binding to the hydrophobic C-terminal domain of the transporter associated with antigen processing (TAP). J. Biol. Chem. 269:14032.[Abstract/Free Full Text]
  17. Powis, S. J., Townsend, A. R., Deverson, E. V., Bastin, J., Butcher, G. W. and Howard, J. C. 1991. Restoration of antigenic presentation to the mutant cell line RMA-S by an MHC-linked transporter. Nature 354:528.[Medline]
  18. Spies, T., Cerundolo, V., Colonna, M., Cresswell, P., Townsend, A. and DeMars, R. 1992. Presentation of viral antigen by MHC class I molecules is dependent on a putative peptide transporter heterodimer. Nature 355:644.[Medline]
  19. van Kaer, L., Ashton-Rickardt, P. G., Ploegh, H. L. and Tonegawa, S. 1992. TAP1 mutant mice are deficient in antigen presentation, surface class I molecules, and CD48+ T cells. Cell 71:1205.[Web of Science][Medline]
  20. Früh, K., Ahn, K., Djaballah, H., Sempe, P., van Endert, P.M., Tampe, R., Peterson, P.A. and Yang, Y. 1995. A viral inhibitor of peptide transporters for antigen presentation. Nature 375:415.[Medline]
  21. Gileadi, U. and Higgins, C. E. 1997. Membrane topology of the ATP-binding cassette transporter associated with antigen presentation (TAP1) expressed in Escherichia coli. J. Biol. Chem. 272:11103.[Abstract/Free Full Text]
  22. Nijenhuis, M. and Hämmerling, G. J. 1996. Multiple regions of the transporter associated with antigen processing (TAP) contribute to its peptide binding site. J. Immunol. 157:5467.[Abstract]
  23. Vos, J. C., Reits, E. A., Wojcik-Jacobs, E. and Neefjes, J. 2000. Head–head/tail–tail relative orientation of the pore-forming domains of the heterodimeric ABC transporter TAP. Curr. Biol. 10:1.[Web of Science][Medline]
  24. Vos, J. C., Spee, P., Momburg, F. and Neefjes, J. 1999. Membrane topology and dimerization of the two subunits of the transporter associated with antigen processing reveal a three-domain structure. J. Immunol. 163: 6679.[Abstract/Free Full Text]
  25. Reits, E. A., Vos, J. C., Gromme, M. and Neefjes, J. 2000. The major substrates for TAP in vivo are derived from newly synthesized proteins. Nature 404: 774.[Medline]
  26. Momburg, F., Armandola, E., Post, M. and Hämmerling, G. J. 1996. Residues in TAP2 peptide transporters controlling substrate specificity. J. Immunol. 156:1756.[Abstract]
  27. Armandola, E., Momburg, F., Nijenhuis, M., Bulbuc, N., Früh, K. and Hämmerling, G. J. 1995. A point mutation in the human transporter associated with antigen processing (TAP2) alters peptide transport specificity. Eur. J. Immunol. 26: 1748.
  28. Kallfelz, M., Jung, D., Hilmes, C., Knuth, A., Jaeger, E., Huber, C. and Seliger, B. 1999. Induction of immunogenicity of a human renal-cell carcinoma cell line by TAP-gene transfer. Int. J. Cancer 81:125.[Web of Science][Medline]
  29. Kunkel, T. A. 1985. Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Natl Acad. Sci USA 82:88.[Abstract/Free Full Text]
  30. Meyer, T., van Endert, P. M., Uebel, S., Ehring, B. and Tampé, R. 1994. Functional expression and purification of the ABC transporter complex associated with antigen processing (TAP) in insect cells. FEBS Lett. 351:443.[Web of Science][Medline]
  31. Gatfield, J., Lammert, E., Nickolaus, P., Münz, C., Rothenfusser, S., Fisch, P., Stevanovic, S., Schild, H., Rammensee, H. G. and Arnold, D. 1998. Cell lines transfected with the TAP inhibitor ICP47 allow testing peptide binding to a variety of HLA class I molecules. Int. Immunol. 10:1665.[Abstract/Free Full Text]
  32. Zinkernagel, R. M., Leist, T. P., Hengartner, H. and Althage, A. 1985. Susceptibility to lymphocytic choriomeningitis virus isolates correlates directly with early and high cytotoxic T cell activity, as well as with footpad swelling, and all three are regulated by H-2D. J. Exp. Med. 162:2125.
  33. Hombach, J., Pircher, H., Tonegawa, S. and Zinkernagel, R. P. 1995. Strictly transporter of antigen presentation (TAP)-dependent presentation of an immunodominant cytotoxic T lymphocyte epitope in the signal sequence of a virus protein. J. Exp. Med. 182:1615.[Abstract/Free Full Text]
  34. Zhou, Y., Gottesman, M. M. and Pastan, I. 1999. Studies of human MDR1–MDR2 chimeras demonstrate the functional exchange- ability of a major transmembrane segment of the multidrug transporter and phosphatidylcholine flippase. Mol. Cell. Biol. 19:1450.[Abstract/Free Full Text]
  35. Chen, H. L., Gabrilovich, D., Tampe, R., Girgis, K. R., Nadaf, S. and Carbone, D. P. 1996. A functionally defective allele of TAP1 results in loss of MHC class I antigen presentation in a human lung cancer. Nat. Genet. 13:210.[Web of Science][Medline]
  36. de la Salle, H., Hanau, D., Fricker, D., Urlacher, A., Kelly, A., Salamero, J., Powis, S. H., Donato, L., Bausinger, H., Laforet, M., Spehner, D., Fralkenrodt, A., Cazenave, J. P., Trowsdale, P. and Tongio, M. M. 1994. Homozygous human TAP transporter mutation in HLA class I deficiency. Science 265:237.[Abstract/Free Full Text]
  37. de la Salle, H., Zimmer, J., Fricker, D., Angenieux, C., Cazenave, J. P., Okubo, M., Meada, H., Plebani, A., Tongio, M. M., Dormoy, A. and Hanau, D. 1999. HLA class I deficiencies due to mutations in subunit 1 of the peptide transporter TAP1. J. Clin. Invest. 103:R9.
  38. Furukawa, H., Murata, S., Yabe, T., Shimbara, N., Keicho, N., Kashiwase, K., Watanabe, K., Ishikawa, Y., Akaza, T., Tadokoro, K., Tohma, S., Inoue, T., Tokunaga, K., Yamamoto, K., Tanaka, K. and Juji, T. 1999. Splice acceptor site mutation of the transporter associated with antigen processing-1 gene in human bare lymphocyte syndrome. J. Clin. Invest. 103:755.[Web of Science][Medline]
  39. Ossevoort, M. A., Sijts, A. J., van-Veen, K. J., Momburg, F., Hämmerling, G. J., Seelig, A., Butcher, G. W., Howard, J. C., Kast, W. M. and Melief, C. J. 1993. Differential effect of transporter TAP2 gene introduction into RMA-S cells on viral antigen processing. Eur. J. Immunol. 23:3082.[Web of Science][Medline]
  40. Hosken, N. A. and Bevan, M. J. 1992. An endogenous antigenic peptide bypasses the class I antigen presentation defect in RMA-S. J. Exp. Med. 23: 1796.
  41. Zhou, X., Glas, R., Momburg, F., Hämmerling, G. J., Jondal, M. and Ljunggren, H. G. 1993. TAP2 defective RMA-S cells present Sendai virus antigen to cytotoxic T lymphocytes. Eur. J. Immunol. 23:1796.[Web of Science][Medline]
  42. Uebel, S., Kraas, W., Kienle, S., Wiesmüller, K. H., Jung, G. and Tampé, R. 1997. Recognition principle of the TAP transporters disclosed by combinatorial peptide libraries. Proc. Natl Acad. Sci. USA 94:8976.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
G. Oancea, M. L. O'Mara, W. F. D. Bennett, D. P. Tieleman, R. Abele, and R. Tampe
Structural arrangement of the transmission interface in the antigen ABC transport complex TAP
PNAS, April 7, 2009; 106(14): 5551 - 5556.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Zhao, W. Haase, R. Tampe, and R. Abele
Peptide Specificity and Lipid Activation of the Lysosomal Transport Complex ABCB9 (TAPL)
J. Biol. Chem., June 20, 2008; 283(25): 17083 - 17091.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K. Kono, E. Sato, H. Naganuma, A. Takahashi, K. Mimura, H. Nukui, and H. Fujii
Trastuzumab (Herceptin) Enhances Class I-Restricted Antigen Presentation Recognized by HER-2/neu-Specific T Cytotoxic Lymphocytes
Clin. Cancer Res., April 1, 2004; 10(7): 2538 - 2544.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
U. Ritz, I. Drexler, D. Sutter, R. Abele, C. Huber, and B. Seliger
Impaired Transporter Associated with Antigen Processing (TAP) Function Attributable to a Single Amino Acid Alteration in the Peptide TAP Subunit TAP1
J. Immunol., January 15, 2003; 170(2): 941 - 946.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
B. Lankat-Buttgereit and R. Tampe
The Transporter Associated With Antigen Processing: Function and Implications in Human Diseases
Physiol Rev, January 1, 2002; 82(1): 187 - 204.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
B. Seliger, U. Ritz, R. Abele, M. Bock, R. Tampe, G. Sutter, I. Drexler, C. Huber, and S. Ferrone
Immune Escape of Melanoma: First Evidence of Structural Alterations in Two Distinct Components of the MHC Class I Antigen Processing Pathway
Cancer Res., December 1, 2001; 61(24): 8647 - 8650.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Ritz, U.
Right arrow Articles by Seliger, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ritz, U.
Right arrow Articles by Seliger, B.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?