International Immunology, Vol. 12, No. 9, 1255-1265,
September 2000
© 2000 Japanese Society for Immunology
Reconstitution of conformationally dependent epitopes on the N-terminal extracellular domain of the human muscle acetylcholine receptor
subunit expressed in Escherichia coli: implications for myasthenia gravis therapeutic approaches
Department of Biochemistry, Hellenic Pasteur Institute, 127 Vas. Sofias Avenue, 11521 Athens, Greece
Correspondence to: S. J. Tzartos
| Abstract |
|---|
|
|
|---|
Myasthenia gravis (MG) is an autoimmune disease, caused by autoantibodies against the muscle acetylcholine receptor (AChR), an oligomeric transmembrane glycoprotein composed of
2ß
subunits. The
subunit carries in its N-terminal extracellular domain the main immunogenic region (MIR), a group of conformationally dependent epitopes that seems to be a major target for the anti-AChR antibodies in MG patients. Detailed epitope studies on pathogenic anti-AChR antibodies have been hindered because the binding of most of these antibodies is conformationally dependent, which precludes the use of denatured AChR fragments. The N-terminal extracellular fragment, residues 1207, of the human AChR
subunit was expressed in Escherichia coli in a denatured form, solubilized in a guanidinium hydrochloride-containing buffer, purified, and renatured using a refolding approach which employs a detergent and a cyclodextrin as `artificial chaperones'. Compared with the non-refolded protein, the refolded molecule exhibited a dramatic improvement in terms of the binding of all anti-MIR mAb tested. Anti-MIR mAb that normally bind weakly to the denatured
subunit bound ~30100 times better to the refolded polypeptide and other anti-MIR mAb that bind exclusively to completely conformationally dependent epitopes also bound quite efficiently. These results, in addition to providing a means for the thorough investigation of the antigenic structure of the AChR, show that the conformationally dependent MIR epitopes do not require the participation of the oligosaccharide moiety of the
subunit nor the contribution of neighboring subunits for antibody binding. Such AChR fragments may be used in structural studies of the AChR autoantigen, and should prove valuable in the understanding and development of therapeutic approaches for MG.
Keywords: acetylcholine receptor, artificial chaperones, conformationally dependent epitopes, main immunogenic region, myasthenia gravis, renaturation
| Introduction |
|---|
|
|
|---|
The nicotinic acetylcholine receptor (AChR) found at the neuromuscular junction is the autoantigen involved in the autoimmune disease myasthenia gravis (MG) (13). Owing to its dual importance as a model autoantigen and as a model neurotransmitter receptor, its general and antigenic structures have been extensively studied over the last 25 years. The AChR molecule is a transmembrane glycoprotein (Mr ~290,000) consisting of five homologous subunits in the stoichiometry
2ß
(embryonic) or
2ß
(adult), which form the cation channel (46). Each subunit assumes a characteristic topology, with a long N-terminal extracellular domain, four transmembrane regions, a long cytoplasmic domain between the third and fourth transmembrane regions, and a short C-terminal extracellular tail (7,8).
The N-terminal extracellular domain (amino acids 1210) of the
chain contains both the binding sites for cholinergic ligands (4,5,9) and the main immunogenic region (MIR), an area against which most experimentally induced antibodies (from animals immunized with native AChR) and a high proportion of the anti-AChR antibodies of MG patients seem to be directed (1012). Anti-MIR antibodies have a high pathogenetic potential, because they are very efficient in causing AChR loss in muscle cell cultures (1315) and their injection into rats causes severe myasthenic symptoms (1618). Although part of the epitopes for some anti-MIR mAb seems to be restricted to a small loop at the
subunit (amino acid residues
6776) (1921), the MIR is clearly not a single epitope, but rather a group of mutually overlapping epitopes (22). It has been suggested that residues remote from
6776 contribute to the epitopes for some anti-MIR antibodies (23), whereas the contribution of the oligosaccharide moiety or of residues at neighboring subunits is unknown. The MIR is a conformationally dependent antigenic region, since approximately half of all anti-MIR mAb bind very weakly to the denatured
subunit, whereas the binding of the remainder seems to be completely dependent on the native conformation of the subunit (10,2426).
If large amounts of the human AChR or of its main antigenic fragments in the native conformation could be obtained, these would be invaluable for the study and development of novel treatment approaches of experimental and human MG. They could be used for the development of experimental MG against human antigen (rather than Torpedo), for the extracorporeal immunoabsorption of the MG antibodies and possibly for detailed structural studies. The extracellular parts of mammalian AChR
subunits with apparently the correct conformation have been expressed as recombinant proteins in CHO K1 cells (27) and Xenopus oocytes (28), but the small amounts produced prohibit their use in the above studies. Large amounts of such polypeptides can be expressed in Escherichia coli, but these are usually in the denatured form as inclusion bodies and appropriate renaturation approaches are needed. Recently, Schrattenholz et al. (29) developed a method for renaturation of the extracellular part of AChR
subunit from electric organs of the fish Torpedo. The renatured polypeptide exhibited high ligand binding activity, suggesting that it acquired a near-native conformation. However, the conformation of other regions of the polypeptide, e.g. that of conformationally dependent epitopes, was not studied. Alexeev et al. (30) also expressed the extracellular region of the Torpedo AChR
subunit in E. coli. The recombinant polypeptide bound
-bungarotoxin (
-Bgt) with high affinity and also bound some mAb directed against the toxin-binding site and mAb to conformationally independent sites (since they also bind to the
subunit on western blots). No refolding of bacterially expressed mammalian AChR polypeptides or of conformational AChR epitopes in general has been reported.
Recently, Rozema and Gellman developed the `artificial chaperone' refolding method (31) which mimics the two-step mechanism of the natural GroEL/GroES chaperone-assisted protein folding system. This method employs small molecules, a detergent and a cyclodextrin (CD), to guide the folding process. In the first step, the non-native target protein is captured by the detergent under conditions that would normally lead to irreversible protein aggregation (denaturant removal). The protein cannot spontaneously refold from the detergent-complexed state, but, in the second step, removal of detergent from the protein is triggered by addition of the CD, allowing the protein to refold. Using this approach, Rozema and Gellman have successfully refolded three structurally diverse proteins, i.e. carbonic anhydrase B, citrate synthase and lysozyme, after their deliberate denaturation (3234).
In this study, we present the reconstitution of conformationally dependent epitopes on a recombinant fragment corresponding to the extracellular region
1207 of the human muscle AChR using the `artificial chaperone' approach. This is the first time, to our knowledge, that this approach has been applied to a bacterially expressed protein fragment. We demonstrate the binding of all tested anti-MIR mAb to the renatured molecule, some of which are known to bind exclusively to the native AChR and not to denatured AChR fragments, thus showing that neither the oligosaccharide moiety nor non-
subunit segments of the AChR are required for binding to the conformationally dependent MIR epitopes. Such AChR fragments with intact conformational epitopes can have many applications.
| Methods |
|---|
|
|
|---|
Construction of the recombinant plasmid
The whole N-terminal extracellular region (a 630 bp fragment) of the human muscle nicotinic AChR
subunit was enzymatically amplified by PCR from a full-length cDNA clone (kindly provided by Dr J. Lindstrom). The primer at the 5' end, TGCCGCGCGGCAGCCATATGCTCGAGTCCGAACATGAGACCCGTCTGG, corresponded to nucleotides 122 of the human AChR
subunit sequence, and the primer at the 3' end, TCGGCGAGCAGCCGGATCCTCGAGCAGGCGCTACATGACGAAGTGGTAGGT, was complementary to nucleotides 604630 and contained a G
A substitution (shown in bold) in order to introduce a T nucleotide at position 622, thus creating a TAG stop codon. The primers used were constructed to contain an XhoI restriction site (underlined). Using the appropriate restriction endonuclease, the purified cDNA fragment was cloned into the expression vector, pET-15b (Novagen, Madison, WI), thus adding a polyhistidine tag (6xHis) to the N-terminal of the polypeptide.
Expression and solubilization of the recombinant protein
BL21(DE3)pLysS bacteria transformed with the pET-15b construct were grown at 37°C in 1 l of M9ZB medium containing 100 µg/ml of ampicillin and 50 µg/ml of chloramphenicol until the cells reached an optical density of 0.4 at 600 nm. The culture was then induced with 1 mM isopropylthio-ß-D-galactoside for 3 h and centrifuged at 4000 g for 20 min, then the bacterial pellet was resuspended in 100 ml of 6 M guanidine hydrochloride (GuHCl), 50 mM NaH2PO4, pH 8.0 and incubated with agitation overnight at room temperature, after which the cell lysate was sonicated for three 30 s periods and centrifuged at 4°C for 15 min at 10,000 g. The supernatant, containing total cell denatured proteins, was collected and stored at room temperature until required for the purification process.
Denaturing purification of the recombinant protein
The expressed protein, corresponding to residues 1207 of the human AChR
subunit (H
1207), was purified by metal chelate affinity chromatography as follows: 3 ml of Ni2+-NTA-agarose (Qiagen), previously equilibrated in 6 M GuHCl, 50 mM NaH2PO4, pH 8.0, was added to 100 ml of the cell lysate supernatant and stirred at room temperature for 1 h. The resin was then loaded into a glass column and washed with 5 column volumes of 6 M GuHCl, 50 mM NaH2PO4, pH 8.0 and ~20 column volumes of 6 M GuHCl, 50 mM NaH2PO4, pH 6.3. The recombinant protein was then eluted in 3 ml of 6 M GuHCl, 50 mM NaH2PO4, pH 4.5. The protein concentration was calculated using the BioRad protein assay (BioRad, Hercules, CA) and further confirmed by SDSPAGE.
Renaturation experiments on the denatured-reduced recombinant protein
Before renaturation, the denatured H
1207 at a concentration of 10 mg/ml was first reduced by the addition of 3 µl of 1 M DTT to 97 µl of protein (final DTT concentration 30 mM), then the solution was left at room temperature for 24 h. The renaturation procedure was carried out according to the `artificial chaperone' method (34) with slight modifications as follows: 5 µl (or as indicated) of 10 mg/ml denatured-reduced H
1207 in 6 M GuHCl, 30 mM DTT, 50 mM NaH2PO4, pH 8.5, was added by rapid vortexing to 0.87 ml of 143 mM Trissulfate, pH 8.5, 1.43 mM EDTA, containing various amounts and ratios of reduced glutathione (GSH) and oxidized glutathione (GSSG), with or without 5.7 mM detergent; in some experiments, 0.25 ml of 100% glycerol replaced an equivalent volume of water to give a 20% glycerol concentration in the final mixture volume (1.25 ml). After 10 min at room temperature, 0.375 ml of water or an aqueous solution of 55 mM (or as indicated) CD was added, then the solutions were left at various temperatures for various lengths of time before assay.
The final renaturation conditions chosen were a final protein concentration of 0.04 mg/ml in 24 mM GuHCl, 0.12 mM DTT, 0.2 mM NaH2PO4, 100 mM Trissulfate, pH 8.5, 1.0 mM EDTA, 4.0 mM GSH, 4.0 mM GSSG, 4.0 mM tetradecyltrimethyl- ammonium bromide (TTAB) detergent and 16.5 mM
-CD, with renaturation proceeding at 28°C overnight.
Measurement of turbidity
After overnight incubation at 28°C (renaturation procedure), the samples were tested for turbidity. Turbidity was measured as the absorbance at 450 nm, using a Perkin-Elmer (Norwalk, CT) Lambda Bio 10 spectrometer.
High-speed centrifugation experiments
After overnight incubation at 28°C (renaturation procedure), 1 ml of refolded and unfolded H
1207 (0.04 mg/ml) was centrifuged at the same temperature at 100,000 g for 90 min in a Sorvall RC 28S centrifuge (F-28/50 rotor). Starting from the top of the samples, 0.25 ml fractions were collected and their OD280 measured before they were subjected to SDSPAGE analysis.
mAb
The mAb used in this study (nos 35, 190, 192, 195, 198 and 202) are directed against the MIR in the extracellular region of the AChR
subunit and were derived from rats immunized with intact AChR from either human muscle (mAb 190, 192, 195, 198 and 202) (25) or Electrophorus electricus electric organ (mAb 35) (24). mAb 35 exhibits very good cross-reactivity with human AChR (11,35), whereas the similarly derived mAb 25 does not bind to mammalian AChR (24) and was used as a negative control. mAb 124, a rat mAb directed against the cytoplasmic region of the Torpedo and human AChR ß subunit (35), was also used as a control in competition experiments. mAb preparations were derived from hybridoma culture supernatants concentrated 20 times by ammonium sulfate precipitation and dialysed against PBS plus 0.05% NaN3. The mAb concentrations were calculated from their apparent titer against the intact human AChR. Apparent titers, expressed as moles of precipitated human AChR [125I]
-Bgt-binding sites per liter of mAb preparation, were determined by radioimmunoassay as previously described (36).
ELISA assessment of H
1207 refolding
The refolding of the H
1207 recombinant protein was assessed mainly by an ELISA system. Wells of microtiter plates (MaxiSorp F96; Nunc, Roskilde, Denmark) were coated by overnight incubation at room temperature with either the refolded or the unfolded recombinant protein (unless indicated otherwise, 37.5 µl of sample containing 1.5 µg protein in refolding or control buffer plus 112.5 µl of 50 mM carbonate buffer, pH 9.6, were added to each well). The coated plates were washed 3 times with PBS, then the wells were saturated with 200 µl of 2.5% BSA in PBS for 1 h at room temperature. After three PBS washes, different mAb dilutions in 100 µl of PBS/0.2% BSA were added to the wells and incubation performed for 3 h at room temperature, then the wells were washed 3 times with PBS/0.05% Tween and 3 times with PBS before addition of 100 µl of peroxidase-conjugated rabbit anti-rat Ig (Dako, Glostrup, Denmark) (dilution 1:500) in PBS/0.2% BSA for 1.5 h at room temperature. The wells were again washed 3 times with PBS/0.05% Tween and 3 times with PBS, then the bound mAb were measured using peroxidase, with 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) as substrate. The color developed after ~45 min was measured at 405 nm using a microtiter plate reader.
To measure the refolding time, after the specified time in refolding buffer, the samples were diluted as above and coated onto the ELISA plates for 2 h at room temperature (instead of overnight incubation), then the ELISA assay was performed as described before, except that the mAb incubation step was overnight, rather than for 3 h.
Competition assays between refolded H
1207 and native AChR
The ability of the refolded H
1207 recombinant protein to inhibit the binding of the mAb to human AChR was tested in competition radioimmunoassay experiments in solution. First, 25 µl of mAb dilution in PBS/0.2% BSA was preincubated overnight at 28°C with 50 µl of refolded or control buffer containing various amounts of either refolded or unfolded H
1207. Then, 14 fmol of human AChR [TE671 cell extract (37,38)], labeled by preincubation with 200 fmol of [125I]
-Bgt (35) diluted in 25 µl of PBS/0.5% Triton X-100 (PBS/Triton), was then added. After 3 h at room temperature, 10 µl of rabbit anti-rat Ig serum was added and incubation continued for a further 1.5 h. The samples were then diluted with 1 ml of PBS/Triton, centrifuged, the pellets washed and the radioactivity in the pellets measured using a
-counter. Inhibition of mAb binding to human AChR was expressed as the percent decrease in the precipitated [125I]
-Bgt-labeled AChR compared with the precipitation in the absence of H
1207 polypeptide but in the presence of the corresponding buffers (refolding or control buffer). The following concentrations of the mAb were used: 0.29 nM mAb 195, 0.68 nM mAb 198, 0.36 nM mAb 202 and 0.206 nM mAb 124. The mAb concentrations were chosen from preliminary experiments so as to precipitate 6080% of the radiolabeled AChR. The negative control mAb 25 was used at a dilution of 1/500.
Filter assay for 125I-labeled Fab 198 binding to refolded H
1207 polypeptide
The fraction of H
1207 polypeptide that was refolded was estimated by Scatchard analysis using the 125I-labeled Fab of mAb 198 [Fab 198 was labeled by the chloramine-T method (36)]. A H
1207 polypeptide concentration of 0.75 µM (untreated or treaded for refolding) was incubated at room temperature for 3 h with various concentrations of 125I-labeled Fab 198 in a final volume of 50 µl of 0.05% Triton X-100 in 20 mM Tris buffer, pH 7.5. Samples were then diluted with 1 ml of 0.5% Triton X-100 in 20 mM Tris buffer, pH 7.5 (Triton buffer) and immediately filtered through a triplet of Whatman DE 81 filters prewashed with the same buffer. The filters were washed 2 times with 1 ml of Triton buffer and the bound radioactivity (125I-labeled Fab 198 bound to H
1207 polypeptide) was measured on a
-counter. Non-specific (background) binding was considered to be the c.p.m. bound to filters from samples without H
1207 polypeptide but otherwise identical to the experimental samples. Because the epitope of mAb 198 only partially depends on the native conformation, for the estimation of the net percentage of renaturation the c.p.m. bound to the control unfolded polypeptide were subtracted from those bound to the treated for refolding polypeptide.
| Results |
|---|
|
|
|---|
Expression, purification and refolding of recombinant H
1207Induction by isopropylthio-ß-D-galactoside of E. coli transformed with the pET-15b construct resulted in overexpression of the recombinant H
1207 fragment (Mr 26,540) in an insoluble aggregated form as inclusion bodies. After solubilization of the bacterial pellet in 6 M GuHCl, 50 mM NaH2PO4, pH 8.0, the H
1207 fragment was purified by affinity chromatography on a Ni2+-NTA column as described in Methods. The protein concentration was 1017 mg/ml, with a total yield of 3050 mg/l of bacterial suspension. The refolding of denatured-reduced H
1207 was based on the `artificial chaperone' method of Rozema and Gellman (31), and was assessed by ELISA measurement of the binding of several anti-MIR mAb, partially or completely dependent on the native conformation of the human AChR. Table 1
-CD and methyl-ß-CD) on the refolding of H
1207 as assessed by the binding of four anti-MIR mAb (nos 198, 35, 192 and 190). When the `artificial chaperone' procedure was not used (Table 1
subunit (25) and to the MIR decapeptide
6776 (20).
|
The use of CD without detergent (Table 1
-CD always produced a better result than methyl-ß-CD (this is most apparent with mAb 35 and 190) and was therefore used in all subsequent experiments. The three ionic detergents behaved rather similarly, but, since TTAB gave a marginally better effect, it was chosen for use in all subsequent experiments.
Another strategy tested for H
1207 refolding was to immobilize the unfolded protein on a solid support before denaturant removal, since, in many cases, immobilization prevents the protein molecules from aggregating during the folding process (39). The results (Table 1
, row 13) were similar to those in the absence of both detergent and CD (Table 1
, row 1), suggesting that the conformation of the H
1207 fragment was not improved by this method.
In all the refolding conditions shown in Table 1
(except those in row 13), GSH and GSSG were both used at final concentrations of 4 mM. Other 1:1 GSH:GSSG ratios (e.g. 1 mM:1 mM and 10 mM:10 mM) or a 10:1 ratio (10 mM:1 mM) were also tested. The binding of anti-MIR mAb under these refolding conditions showed that the use of 4 mM:4 mM GSH:GSSG was marginally preferable (data not shown) and these conditions were therefore used in subsequent experiments.
We then tested the effect of the CD concentration on the refolding process. When
-CD was used at a concentration 3- or 2-fold lower (5.5 or 8.25 mM respectively) than that used in Table 1
, mAb binding was reduced, whereas a 3-fold higher
-CD concentration (49.5 mM) did not improve mAb binding.
We also tested the binding of [125I]
-Bgt to the H
1207 polypeptide subjected to all the above-described refolding conditions. Both solid-phase experiments, in which the polypeptides were immobilized on plastic plates, then incubated with [125I]
-Bgt, and experiments in solution, using a DEAEcellulose filter assay as previously described (40), were performed. Specific
-Bgt binding was low in all preparations, and no difference was seen between the refolded and unfolded preparations (data not shown).
Effects of temperature, protein concentration and reaction time on the refolding of the H
1207 polypeptide
We next investigated the role of temperature on the refolding process. Refolding experiments were performed on H
1207 at a concentration of 0.04 mg/ml by overnight incubation at 16, 28 and 37°C. Refolding could not be performed at low temperatures (e.g. 4°C), since the mixture of TTAB and
-CD formed a thick white precipitate. The data shown in Fig. 1
demonstrate that the artificial chaperone-assisted refolding of H
1207 was considerably influenced by the reaction temperature. Specific binding of the three anti-MIR mAb tested (nos 198, 195 and 35) increased 2- to 3-fold on increasing the temperature from 16 to 28°C. At 37°C, binding showed a non-significant decrease compared to at 28°C. A temperature of 28°C was therefore used in subsequent experiments.
|
The optimum concentration of H
1207 to use in the refolding procedure was then tested. Figure 2
1207 at 0.04 mg/ml resulted in no turbidity, higher concentrations (
0.07 mg/ml) produced insoluble material. Although the presence of glycerol did not improve the binding of the mAb to polypeptide refolded at 0.04 mg/ml (data not shown), it had a clearly beneficial effect on solubility at higher polypeptide concentrations. At 0.2 mg/ml of H
1207, refolding was apparently totally inefficient, either in the presence or absence of glycerol, since the turbidity of the `refolded' sample was similar to that of the unfolded polypeptide in the absence of detergent, suggesting that almost all the polypeptide was in the form of aggregates. In contrast, in the absence of CD, the unfolded detergent-complexed state of the polypeptide (`TTAB only') was completely soluble at all tested concentrations. Refolding from this state requires the addition of CD in order to remove the detergent from the protein (see Table 1
-CD were up to 6-fold higher than those used in the experiments shown in Fig. 2
1207 >0.04 mg/ml continued to produce insoluble material, suggesting that the optimum concentration for refolding of H
1207 was 0.04 mg/ml, irrespective of the concentrations of the `artificial chaperones'.
|
The solubility of the refolded H
1207 polypeptide was further confirmed by high-speed centrifugation experiments. H
1207 fragment, refolded at a concentration of 0.04 mg/ml at 28°C in the presence of glycerol, was centrifuged at the same temperature at 100,000 g for 90 min and fractions were collected as described in the Methods. Measurement of the OD280 of the samples and analysis by SDSPAGE showed that the protein concentration in all fractions was identical to that of the non-centrifuged control. In contrast, centrifugation completely precipitated the unfolded polypeptide in the absence of detergent and CD, while no precipitation was seen using the unfolded polypeptide in TTAB in the absence of CD.
The effect of reaction time on the refolding process was then investigated. H
1207 samples at 0.04 mg/ml were refolded at 28°C for various times and the binding of two conformation-dependent mAb (nos 35 and 192) was tested by ELISA. Figure 3
shows that the refolding of H
1207 polypeptide significantly depends on the duration of the refolding reaction. Refolding, as shown by the binding of the two anti-MIR mAb, dramatically increased during the first 30 min, then continued to increase, although at a much slower rate, for several hours. Therefore, overnight (1618 h) refolding of the H
1207 polypeptide was chosen for all subsequent experiments.
|
mAb binding to H
1207 polypeptide refolded under optimal conditionsBased on the above results, the following refolding conditions were used in all subsequent experiments: H
1207 at a concentration of 0.04 mg/ml was refolded by overnight incubation at 28°C using a two-step procedure which resulted in final concentrations of 100 mM Trissulfate, pH 8.5, 1.0 mM EDTA, 4.0 mM GSH, 4.0 mM GSSG, 4.0 mM TTAB detergent and 16.5 mM
-CD. The control non-refolded H
1207 was obtained by parallel treatment, except that the TTAB and
-CD were replaced by equal volumes of water.
Figure 4
shows ELISA experiments in which refolded and unfolded H
1207 were immobilized on plastic plates and tested for their ability to bind conformationally dependent mAb. The three mAb 195, 198 and 202, shown in Fig. 4
(A), are known to bind well to the intact human AChR and weakly to denatured
subunit (20,25). As expected, these mAb bound significantly to the unfolded polypeptide, but bound ~30100 times better to the refolded molecule. We also tested three other anti-MIR mAb (nos 28, 37 and 42) (20,24) that also bind well to the intact human AChR and weakly to the denatured
subunit, and found that they behaved similarly (data not shown). In contrast, three anti-AChR mAb known to bind to sites other than the extracellular side of the
subunit, mAb 73 (anti-ß subunit), mAb 67 (anti-
subunit) and 155 (binding to the cytoplasmic side of the
subunit) (20,41), did not bind to either the refolded or unfolded H
1207 polypeptide (data not shown).
|
The epitopes of the mAb used in the experiment shown in Fig. 4
subunit of some species, but not that of the human AChR (22,24). As expected, very little binding of these mAb to the unfolded polypeptide was seen. In contrast, they bound quite well to the refolded H
1207, although higher mAb concentrations were needed to detect binding of this group of mAb than for the less conformationally dependent mAb shown in Fig. 4
Competition assays between refolded H
1207 polypeptide and native AChR for binding to the mAb
In order to simultaneously test the mAb binding efficiency of the refolded and unfolded polypeptides in solution, and their ability to interfere with mAb binding to the intact AChR, mAb-binding competition experiments were performed between soluble H
1207 and [125I]
-Bgt-labeled intact human AChR. Figure 5
shows that the refolded polypeptide was several times more efficient (~510 times) than the unfolded polypeptide in inhibiting the binding of the three anti-MIR mAb tested to the AChR. As expected, neither polypeptide was able to inhibit the binding of mAb 124 which is directed against the cytoplasmic part of the AChR ß subunit.
|
Quantitative assessment of H
1207 refoldingELISA is not appropriate for determination of the refolded fraction of the H
1207 molecules because of the uncertainty in the amount of the polypeptide that is attached to the plate with the correct orientation, also the difficulty to reliably correlate developed color with amount of antibody bound. We therefore labeled the Fab of mAb 198 with 125I (125I-labeled Fab 198), allowed it to bind to the H
1207 polypeptide in solution and performed a filter assay (see Methods). This method was based on our previous observation that 125I-labeled Fab 198 does not bind to DEAEcellulose filters whereas as a complex with H
1207 polypeptide it binds to the filters. We labeled the monovalent Fab instead of the bivalent antibody in order to have a 1:1 molar ratio of polypeptide to ligand (Fab). Scatchard analysis showed that 22.5 ± 3.5% H
1207 had been refolded. | Discussion |
|---|
|
|
|---|
The
subunit of skeletal muscle AChR plays the most critical immunogenic role in the autoimmune response in MG. In this study we present the reconstitution of conformationally dependent epitopes in a bacterially expressed recombinant fragment of the human AChR
subunit.
In an attempt to produce the recombinant polypeptide containing the first 207 N-terminal amino acid residues of the human AChR
subunit (H
1207) in a renatured form, we have used different expression vectors and several renaturation methods, and tested the solubility of the polypeptide produced and its ability to bind
-Bgt and mAb directed against conformationally dependent epitopes. One way to achieve correct folding in E. coli is to use vectors that code for signal sequences of proteins that cause the target protein to be secreted into the periplasm. In our initial studies, we used the pHEN1 vector (42), but we did not manage to obtain soluble H
1207 polypeptide in the periplasmic space. We also tried to produce the H
1207 fragment as a fusion protein using the pTrxFus vector (Invitrogen, NV Leek, The Netherlands) which allows foreign genes to be expressed as fusion proteins with the E. coli protein, thioredoxin (43,44). Thioredoxin fusion proteins are expressed at high levels, while the thioredoxin moiety appears to confer solubility to otherwise insoluble proteins (44,45). However, in our case, after induction of the transformed cells and cell lysis by repeated freezethawsonication cycles, no soluble thioredoxinH
1207 fusion protein was found in the supernatant of the cell lysate, whereas a large amount of the fusion protein was found in insoluble form. The insoluble fusion protein was tested, with or without solubilization in a GuHCl-containing buffer, for [125I]
-Bgt and mAb binding in solid-phase binding experiments. Both [125I]
-Bgt and a few mAb to partially conformationally dependent MIR epitopes (mAb 198 and 195) bound weakly, but detectably, whereas no binding of the completely conformationally dependent mAb was seen (data not shown). Finally, we used the pET-15b vector, which produces large amounts of recombinant protein in the aggregated form as inclusion bodies. After solubilization of the inclusion bodies in a strongly denaturing buffer (GuHCl or urea), several renaturation methods were applied to try to restore the functional native conformation of the H
1207 fragment; however, most of these attempts were unsuccessful. Thus, both slow gradual removal of the denaturant by dialysis and rapid dilution of denatured-reduced H
1207 to a non-denaturing concentration in the presence of reduced and oxidized thiol reagents (GSH/GSSG, DTT/oxidized DTT or cysteine/cystine) and mild non-ionic detergents [octyl-glucoside (46) and Tween-80 (47)] resulted in completely aggregated inactive protein. Unsuccessful results were also obtained using another strategy in which the denatured H
1207 fragment was immobilized on a Ni2+-NTA column to remove the denaturant (Table 1
, row 13).
The method we finally used to obtain the H
1207 polypeptide in a native-like conformation was the `artificial chaperone' method (3134) which mimics the two-step mechanism of the natural GroEL/GroES chaperone system. In the first step, a detergent captures the protein as the denaturant is diluted to a non-denaturing concentration, and formation of the proteindetergent complex prevents both protein aggregation and proper refolding. In the second step, addition of a CD (stripping agent) to the proteindetergent complex promotes renaturation because the CD selectively binds the detergent, thereby stripping it from the protein, which is then able to fold. Rozema and Gellman (34) showed that lysozyme could be efficiently folded from the denatured-reduced state if cationic, but not anionic, detergents were used in the capture step. In the present study, we tested three different cationic detergents and two different CD for optimal renaturation of the H
1207 fragment. Binding of mAb to conformationally dependent epitopes (Table 1
) showed that the best combination of `artificial chaperones' for H
1207 refolding was TTAB and
-CD, and this combination was therefore used in all subsequent experiments. We also identified the optimal temperature (Fig. 1
), polypeptide concentration (Fig. 2
), reaction time (Fig. 3
) and the concentration of thiol reagents for the refolding process.
The best indication of the correct folding of at least certain regions of the H
1207 polypeptide was the dramatic ability of the refolded protein to bind mAb directed against conformationally dependent epitopes of the human AChR. Two groups of mAb were used. The binding of the first group (mAb 195, 198 and 202) is only partially dependent on the native conformation of the AChR; these mAb are known to bind well to the intact human AChR, but also bind weakly to the denatured
subunit (25). Figure 4
(A) shows the dramatically improved binding of this group of mAb to the refolded molecule. The epitopes for the second group of mAb (nos 35, 190 and 192) are almost completely dependent on the native human AChR conformation (22,25) [mAb 35 binds marginally to
subunit fragments from non-human AChR (24,26)]. As expected, these mAb showed practically background levels of binding to the unfolded polypeptide, but, interestingly, they showed quite good binding to the refolded H
1207 fragment (Fig. 4B
).
In competition experiments, although the refolded polypeptide was unable to inhibit binding of the completely conformationally dependent mAb to the intact AChR, it inhibited the binding of the partially conformationally dependent mAb to the AChR (Fig. 5
). However, the amounts of the polypeptide used to inhibit mAb binding to the native AChR suggest that either a small proportion of it had been correctly refolded or a large fraction of the H
1207 molecules was only partially refolded. Experiments, in which we tried to quantify the extent of renaturation using the 125I-labeled Fab 198, showed that a conformationally dependent epitope had been reconstituted in the 22.5 ± 3.5% of the H
1207 molecules following refolding. These results indicate that a relatively large proportion of the bacterially expressed H
1207 polypeptide had been only partially refolded.
The refolded H
1207 polypeptide did not meet our expectations in terms of
-Bgt binding. Specific
-Bgt binding was very low and almost no difference was seen between the refolded and unfolded polypeptide. Interestingly, when our thioredoxinH
1207 fusion protein was tested under non-refolding conditions, it bound [125I]
-Bgt 7 times better than the corresponding unfolded H
1207 polypeptide in a solid-phase assay (1085
c.p.m. versus 160
c.p.m. bound [125I]
-Bgt respectively, with a background of 110 c.p.m., when 100,000 c.p.m. of [125I]
-Bgt was incubated with the plated polypeptide, results not shown). Although application of the `artificial chaperone' refolding approach to the thioredoxinH
1207 polypeptide resulted in a moderate improvement of anti-MIR mAb binding, no effect on
-Bgt binding was observed. In contrast to the very weak
-Bgt binding of the recombinant human
subunit fragments, the corresponding refolded polypeptide from the Torpedo
1209 binds
-Bgt with a high affinity (KD = 0.5x109 M) (29), although much lower than that of the intact AChR; we therefore applied the same renaturation protocol to our H
1207 polypeptide, but saw no improvement in the binding of either
-Bgt or anti-MIR mAb (data not shown). Human AChR binds
-Bgt with approximately an order of magnitude lower affinity than that of Torpedo AChR for the same toxin (48). Furthermore, Torpedo AChR fragments or synthetic peptides containing the segment
185196 bind
-Bgt, whereas the corresponding human peptides do not bind
-Bgt or only bind it very weakly (48,49). Thus, it is likely that Torpedo and human (or mammalian) AChR
-Bgt binding sites have different requirements for
-Bgt binding. A critical difference could be the contribution of N-glycosylation to the
-Bgt binding site. The monomeric N-glycosylated human AChR
subunit in TE671 cells (50), as well as the glycosylated extracellular fragment of the mouse muscle
subunit (27) and chicken
7 subunit (28), bind
-Bgt with high affinity, which suggests that glycosylation may play an important role in this binding. In fact, N-glycosylation has been shown to ensure the correct folding of the
-Bgt binding site of the AChR (51) and therefore may be required for high-affinity toxin binding to the human
subunit.
Contrary to the possible contribution of N-glycosylation to the
-Bgt binding, our results suggest that the formation of the MIR epitopes, including those which are completely conformation dependent, do not require the glycosylation of the
subunit. In addition, none of the tested anti-MIR mAb seems to require the direct contribution of residues from other subunits for its binding nor the influence of neighboring subunits to the conformation of the MIR, thus suggesting that the MIR is located exclusively on the
subunit of the AChR.
Recombinant AChR fragments produced in sufficient amounts and acquiring the native conformation open new opportunities in therapeutic approaches of MG. These molecules which share specificities and properties with the native antigen could be potentially used for treatment of the disease. Thus, when immobilized on a solid support they may be suitable for the extracorporeal removal of the anti-AChR antibodies from the circulation by specific immunoabsorption. Alternatively, when administered through non-immunogenic routes they might block in vivo the pathogenic anti-AChR antibodies. A similar approach was used successfully recently with large amounts of a non-refolded bacterially expressed human
1210 polypeptide which blocked mAb 198, a weakly conformationally dependent antibody (52). Furthermore, such human AChR fragments could be potentially used for the development of better experimental MG models using human rather than Torpedo antigen and for the investigation of the immunogenic role of each AChR subunit. Finally, refolded AChR fragments may serve as suitable material for structural studies to obtain high-resolution information on the AChR structure and on its complexes with specific antibody fragments. In this study we have obtained the H
1207 polypeptide in a partially renatured form as it exhibited reconstitution of conformationally dependent epitopes of pathogenic anti-MIR mAb. Further improvement of this approach should lead to a candidate molecule for the above suggested applications.
| Acknowledgments |
|---|
We thank Dr J. Lindstrom for kindly providing us the human muscle
subunit cDNA, A. Kokla for excellent technical assistance, and Dr T. Barkas and Dr L. Jacobson for valuable suggestions. This work was supported by grants from the Greek General Secretariat of Research and Technology (EKBAN 104), the Association Francaise contre les Myopathies , and the contracts ERBFMRXCT970138 of the TMR programme and BIO4-CT98-0110 of the Biotechnology Programme of the European Commission. | Abbreviations |
|---|
-Bgt -bungarotoxin |
-CD -cyclodextrin |
| AChR acetylcholine receptor |
| CTAB cetyltrimethyl-ammonium bromide |
| GSH reduced glutathione |
| GSSG oxidized glutathione |
| GuHCl guanidine hydrochloride |
H 1207 human AChR subunit amino acid residues 1207 |
| methyl-ß-CD methyl-ß-cyclodextrin |
| MG myasthenia gravis |
| MIR main immunogenic region |
| NTA nitrilo-tri-acetic acid |
| TTAB tetradecyltrimethylammonium bromide |
| Z 314 N-tetradecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate |
| Notes |
|---|
Transmitting editor: J.-F. Bach
Received 27 December 1999, accepted 17 May 2000.
| References |
|---|
|
|
|---|
- Lindstrom, J., Shelton, D. and Fugii, Y. 1988. Myasthenia gravis. Adv. Immunol. 42:233.[Web of Science][Medline]
- Protti, M. P., Manfredi, A. A., Horton, R. M., Bellone, M. and Conti-Tronconi, B. M. 1993. Myasthenia gravis: recognition of a human autoantigen at the molecular level. Immunol. Today 14:363.[Web of Science][Medline]
- Drachman, D. B. 1998. Myasthenia Gravis. In Rose, N. R. and Mackay, I. R., ed., The Autoimmune Diseases, Third Edition, p. 637. Academic Press, San Diego, CA.
- Galzi, J.-L. and Changeux, J.-P. 1994. Neurotransmitter-gated ion channels as unconventional allosteric proteins. Curr. Opin. Struct. Biol. 4:554.[Web of Science]
- Karlin, A. and Akabas, M. H. 1995. Toward a structural basis for the function of nicotinic acetylcholine receptors and their cousins. Neuron 15:1231.[Web of Science][Medline]
- Unwin, N. 1995. Acetylcholine receptor channel imaged in the open state. Nature 373:37.[Medline]
- Devillers-Thiery, A., Galzi, J.-L., Eisele, J. L., Bertrand, S., Bertrand, D. and Changeux, J.-P. 1993. Functional architecture of the nicotinic acetylcholine receptor: a prototype of ligand-gated ion channels. J. Membr. Biol. 136:97.[Web of Science][Medline]
- Karlin, A. 1993. Structure of nicotinic acetylcholine receptors. Curr. Opin. Neurobiol. 3:299.[Medline]
- Arias, H. R. 1997. Topology of ligand binding sites on the nicotinic acetylcholine receptor. Brain Res. Rev. 25:133.[Medline]
-
Tzartos, S. J. and Lindstrom, J. L. 1980. Monoclonal antibodies used to probe acetylcholine receptor structure: localization of the main immunogenic region and detection of similarities between subunits. Proc. Natl Acad. Sci. USA 77:755.
[Abstract/Free Full Text] -
Tzartos, S. J., Seybold, M. and Lindstrom, J. L. 1982. Specificities of antibodies to acetylcholine receptors in sera from myasthenia gravis patients measured by monoclonal antibodies. Proc. Natl Acad. Sci. USA 79:188.
[Abstract/Free Full Text] - Vincent, A. 1994. Experimental autoimmune myasthenia gravis. In Cohen, I. and Miller, A., eds, Autoimmune Disease Models: A Guidebook, p. 83. Academic Press, Orlando, FL.
- Conti-Tronconi, B. M., Tzartos, S. J. and Lindstrom, J. 1981. Monoclonal antibodies as a probe of acetylcholine receptor structure. II. Binding to native receptor. Biochemistry 20:2181.[Medline]
- Tzartos, S. J., Sophianos, D. and Efthimiadis, A. 1985. Role of the main immunogenic region of acetylcholine receptor in myasthenia gravis. An Fab monoclonal antibody protects against antigenic modulation by human sera. J. Immunol. 134:2343.[Abstract]
- Guyon, T., Wakkach, A., Poea, S., Mouly, V., Klingel-Schmitt, I., Levasseur, P., Beeson, D., Asher, O., Tzartos, S. and Berrih-Aknin, S. 1998. Regulation of acetylcholine receptor gene expression in human myasthenia gravis muscles. J. Clin. Invest. 102:249.[Web of Science][Medline]
- Tzartos, S. J., Hochschwender. S., Vasquez, P. and Lindstrom, J. 1987. Passive transfer of experimental autoimmune myasthenia gravis by monoclonal antibodies to the main immunogenic region of the acetylcholine receptor. J. Neuroimmunol. 15:185.[Web of Science][Medline]
- Asher, O., Kues, W. A., Witzemann, V., Tzartos, S. J., Fuchs, S. and Souroujon, M. C. 1993. Increased gene expression of acetylcholine receptor and myogenic factors in passively transferred experimental autoimmune myasthenia gravis. J. Immunol. 151:6442.[Abstract]
- Graus, Y., Meng, F., Vincent, A., Van Breda Vriesman, P. and De Baets, M. 1995. Sequence analysis of anti-AChR antibodies in experimental autoimmune myasthenia gravis. J. Immunol. 154:6382.[Abstract]
-
Barkas, T., Gabriel, J.-M., Mauron, A., Hughes, G. J., Roth, B., Alliod, C., Tzartos, S. J. and Ballivet, M. 1988. Monoclonal antibodies to the main immunogenic region of the nicotinic acetylcholine receptor bind to residues 6176 of the alpha subunit. J. Biol. Chem. 263:5916.
[Abstract/Free Full Text] -
Tzartos, S. J., Kokla, A., Walgrave, S. and Conti-Tronconi, B. 1988. Localization of the main immunogenic region of human muscle acetylcholine receptor to residues 6776 of the alpha subunit. Proc. Natl Acad. Sci. USA 85:2899.
[Abstract/Free Full Text] - Saedi, M. S., Anand, R., Conroy, W. G. and Lindstrom, J. 1990. Determination of amino acids critical to the main immunogenic region of intact acetylcholine receptors by in vitro mutagenesis. FEBS Lett. 267:55.[Web of Science][Medline]
- Tzartos, S. J., Barkas, T., Cung, M. T., Mamalaki, A., Marraud, M., Orlewski, P., Papanastasiou, D., Sakarellos, C., Sakarellos-Daitsiotis, M., Tsantili, P. and Tsikaris, V. 1998. Anatomy of the antigenic structure of a large membrane autoantigen, the muscle-type nicotinic acetylcholine receptor. Immunol. Rev. 163:89.[Web of Science][Medline]
- Kontou, M., Vatzaki, E. H., Kokla, A., Acharya, K. R., Oikonomakos, N. G. and Tzartos, S. J. 1996. Characterization, crystallisation and preliminary X-ray diffraction analysis of a Fab fragment of a rat monoclonal antibody with very high affinity for the human muscle acetylcholine receptor. FEBS Lett. 389:195.[Web of Science][Medline]
-
Tzartos, S. J., Rand, D. E., Einarson, B. E. and Lindstrom, J. L. 1981. Mapping of surface structures of electrophorus acetylcholine receptor using monoclonal antibodies. J. Biol. Chem. 256:8635.
[Abstract/Free Full Text] - Tzartos, S. J., Langeberg, L., Hochschwender, S. and Lindstrom, J. L. 1983. Demonstration of a main immunogenic region on acetylcholine receptors from human muscle using monoclonal antibodies to human receptor. FEBS Lett. 158:116.[Web of Science][Medline]
-
Barkas, T., Mauron, A., Roth, B., Alliod, C., Tzartos, S. J. and Ballivet, M. 1987. Mapping the main immunogenic region and toxin-binding site of the nicotinic acetylcholine receptor. Science 235:77.
[Abstract/Free Full Text] -
West, A. P., Bjorkman, P. J., Dougherty, D. A. and Lester, H. A. 1997. Expression and circular dichroism studies of the extracellular domain of the alpha subunit of the nicotinic acetylcholine receptor. J. Biol. Chem. 272:25468.
[Abstract/Free Full Text] -
Wells, G. B., Anand, R., Wang, F. and Lindstrom, J. L. 1998. Water-soluble nicotinic acetylcholine receptor formed by alpha7 subunit extracellular domains. J. Biol. Chem. 273:964.
[Abstract/Free Full Text] -
Schrattenholz, A., Pfeiffer, S., Pejovic, V., Rudolph, R., Godovac-Zimmermann, J. and Maelicke, A. 1998. Expression and renaturation of the N-terminal extracellular domain of torpedo nicotinic acetylcholine receptor alpha subunit. J. Biol. Chem. 273:32393.
[Abstract/Free Full Text] - Alexeev, T., Krivoshein, A., Shevalier, A., Kudelina, I., Telyakova, O., Vincent, A., Utkin, Y., Hucho, F. and Tsetlin, V. 1999. Physicochemical and immunological studies of the N-terminal domain of the Torpedo acetylcholine receptor alpha subunit expressed in Escherichia coli. Eur. J. Biochem. 259:310.[Web of Science][Medline]
- Rozema, D. and Gellman, S. H. 1995. Artificial chaperonesprotein refolding via sequential use of detergent and cyclodextrin. J. Am. Chem. Soc. 117:2373.
-
Rozema, D. and Gellman, S. H. 1996. Artificial chaperone-assisted refolding of carbonic anhydrase B. J. Biol. Chem. 271:3478.
[Abstract/Free Full Text] -
Daugherty, D. L., Rozema, D., Hanson, P. E. and Gellman, S. H. 1998. Artificial chaperone-assisted refolding of citrate synthase. J. Biol. Chem. 273:33961.
[Abstract/Free Full Text] - Rozema, D. and Gellman, S. H. 1996. Artificial chaperone-assisted refolding of denatured-reduced lysozyme: modulation of the competition between renaturation and aggregation. Biochemistry 35:15760.[Medline]
- Tzartos, S. J. and Starzinski-Powitz, A. 1986. Decrease in acetylcholine-receptor content of human myotube cultures mediated by monoclonal antibodies to alpha, beta and gamma subunits. FEBS Lett. 196:91.[Web of Science][Medline]
- Lindstrom, J. L., Einarson, B. and Tzartos, S. J. 1981. Production and assay of antibodies to acetylcholine receptors. Methods Enzymol. 74:432.
- Luther, M. A., Schoepfer, R., Whiting, P., Casey, B., Blatt, Y., Montal, M. S., Montal, M. and Lindstrom, J. L. 1989. A muscle acetylcholine receptor is expressed in the human cerebellar medulloblastoma cell line TE671. J. Neurosci. 9:1082.[Abstract]
- Stratton, M. R., Darling, J., Pilkington, G. J., Lantos, P. L., Reeves, B. R. and Cooper, C. S. 1989. Characterization of the human cell line TE671. Carcinogenesis 10:899.
-
Epstein, C. J. and Anfinsen, C. B. 1962. The reversible reduction of disulfide bonds in trypsin and ribonuclease coupled to carboxymethyl cellulose. J. Biol. Chem. 237:2175.
[Free Full Text] -
Tzartos, S. J. and Changeux, J.-P. 1984. Lipid-dependent recovery of alpha-bungarotoxin and monoclonal antibody binding to the purified alpha subunit from Torpedo marmorata acetylcholine receptor. Enhancement by noncompetitive channel blockers. J. Biol. Chem. 259:11512.
[Abstract/Free Full Text] - Tzartos, S. J., Langeberg, L., Hochschwender, S., Swanson, L. and Lindstrom, J. L. 1986. Characteristics of monoclonal antibodies to denatured Torpedo and to native calf acetylcholine receptors: species, subunit and region specificity. J. Neuroimmunol. 10:235.[Web of Science][Medline]
-
Hoogenboom, H. R., Griffiths, A. D., Johnson, K. S., Chiswell, D. J., Hudson, P. and Winter, G. 1991. Multi subunit proteins on the surface of filamentous phage: methodologies for displaying antibody (Fab) heavy and light chains. Nucleic Acids Res. 19:4133.
[Abstract/Free Full Text] -
Bayer, M. E. 1968. Areas of adhesion between wall and membrane of Escherichia coli. J. Gen. Microbiol. 53:395.
[Abstract/Free Full Text] - Holmgren, A. 1985. Thioredoxin. Annu. Rev. Biochem. 54:237.[Web of Science][Medline]
- LaVallie, E. R., DiBlasio, E. A., Kovacic, S., Grant, K. L., Schendel, P. F. and McCoy, J. M. 1992. A thioredoxin gene fusion expression system that circumvents inclusion body formation in the E. coli cytoplasm. Bio/technology 11:187.
- Mathieu, M. E., Grigera, P. R., Helenius, A. and Wagner, R. R. 1996. Folding, unfolding, and refolding of the vesicular stomatitis virus glycoprotein. Biochemistry 35:4084.[Medline]
- Jaenicke, R. and Rudolph, R. 1990. Folding Proteins. In T. E. Creighton, ed., Protein Structure: A Practical Approach, p. 191. IRL Press, New York.
- Vincent, A., Jacobson, L. and Curran, L. 1998. Alpha-Bungarotoxin binding to human muscle acetylcholine receptor: measurement of affinity, delineation of AChR subunit residues crucial to binding, and protection of AChR function by synthetic peptides. Neurochem. Int. 32:427.[Web of Science][Medline]
-
Neumann, D., Barchan, D., Fridkin, M. and Fuchs, S. 1986. Analysis of ligand binding to the synthetic dodecapeptide 185196 of the acetylcholine receptor alpha subunit. Proc. Natl Acad. Sci. USA 83:9250.
[Abstract/Free Full Text] -
Conroy, W. G., Saedi, M. S. and Lindstrom, J. L. 1990. TE671 cells express an abundance of a partially mature acetylcholine receptor alpha subunit which has characteristics of an assembly intermediate. J. Biol. Chem. 265:21642.
[Abstract/Free Full Text] - Gehle, V. M., Walcott, E. C., Nishizaki, T. and Sumikawa, K. 1997. N-glycosylation at the conserved sites ensures the expression of properly folded functional ACh receptors. Mol. Brain Res. 45:219.[Medline]
- Barchan, D., Asher, O., Tzartos, S. J., Fuchs, S. and Souroujon, M. C. 1998. Modulation of the anti-acetylcholine receptor response and experimental autoimmune myasthenia gravis by recombinant fragments of the acetylcholine receptor. Eur. J. Immunol. 28:616.[Web of Science][Medline]
This article has been cited by other articles:
![]() |
V. Avramopoulou, A. Mamalaki, and S. J. Tzartos Soluble, Oligomeric, and Ligand-binding Extracellular Domain of the Human {alpha}7 Acetylcholine Receptor Expressed in Yeast: REPLACEMENT OF THE HYDROPHOBIC CYSTEINE LOOP BY THE HYDROPHILIC LOOP OF THE ACh-BINDING PROTEIN ENHANCES PROTEIN SOLUBILITY J. Biol. Chem., September 10, 2004; 279(37): 38287 - 38293. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Psaridi-Linardaki, A. Mamalaki, M. Remoundos, and S. J. Tzartos Expression of Soluble Ligand- and Antibody-binding Extracellular Domain of Human Muscle Acetylcholine Receptor alpha Subunit in Yeast Pichia pastoris. ROLE OF GLYCOSYLATION IN alpha -BUNGAROTOXIN BINDING J. Biol. Chem., July 19, 2002; 277(30): 26980 - 26986. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



) and 192 (
) to the molecule after refolding for different times is presented. Unfolded control samples (incubated in the absence of TTAB and
). The binding of control mAb 25 to the refolded and the unfolded polypeptides was also tested and gave OD405 values of 0.10 ± 0.01 at all the tested times (not shown). mAb 35 and 192 were used at concentrations of 1 and 50 nM respectively.

) and unfolded (
) H
