Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (9)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Tsujimura, K.
Right arrow Articles by Takahashi, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tsujimura, K.
Right arrow Articles by Takahashi, T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 12, No. 9, 1217-1225, September 2000
© 2000 Japanese Society for Immunology

The epitope detected by cytotoxic T lymphocytes against thymus leukemia (TL) antigen is TAP independent

Kunio Tsujimura1, Yuichi Obata1, Shigeru Iwase1,2, Yasue Matsudaira1, Satoshi Ozeki1 and Toshitada Takahashi1

1 Laboratory of Immunology, Aichi Cancer Center Research Institute, 1-1 Kanokoden, Chikusa-ku, Nagoya 464-8681, Japan
2 Department of Hygienic Chemistry, Faculty of Pharmaceutical Sciences, Nagoya City University, 3-1 Tanabe-dori, Mizuho-ku, Nagoya 467-8603, Japan.

Correspondence to: K. Tsujimura


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Thymus leukemia (TL) antigens belong to the family of MHC class Ib antigens. We have shown in our previous studies that they serve as transplantation antigens, and can be recognized by both TCR {alpha}ß and TCR {gamma}{delta} cytotoxic T lymphocytes (CTL) with TL but not H-2 restriction. Although TL are known to be expressed TAP independently, it is unclear whether peptide loading on TL molecules is necessary for the formation of CTL epitopes. In the present study, we first showed that TL expression is ß2-microglobulin (ß2m)-dependent but TAP1 independent by flow cytometric analysis of thymocytes from ß2m- or TAP1-deficient mice crossed with TL transgenic mice expressing Tlaa-3-TL on their thymocytes. Subsequently, we investigated the epitope recognized by CTL derived from C3H mice immunized with skin from a transgenic mouse expressing T3b-TL ubiquitously. Bulk CTL lines against TL from primary mixed lymphocyte cultures showed comparable cytotoxicity against T3b-TL transfectants of TAP2-deficient murine RMA-S grown at 37°C to that against those grown at 25°C. Furthermore, TCR {alpha}ß and TCR {gamma}{delta} CTL clones against TL recognized TL expressed on T3b-TL transfectants of RMA-S and Drosophila melanogaster cells having broad defects in peptide loading of MHC, and lysed these target cells. These results together indicate that TL-specific CTL populations primarily recognize epitopes expressed TAP independently.

Keywords: MHC class Ib, thymus leukemia (TL) antigen


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Mice and human have several MHC class Ib (or non-classical MHC class I) molecules that are distinguished from MHC class Ia (or classical MHC class I) by their limited polymorphism and unique expression patterns (1,2). Mouse thymus leukemia (TL) antigens belong to the family of MHC class Ib and have a unique manner of expression, i.e. they are restricted to the intestines in all mouse strains and the thymus of TL+ strains (e.g. A-strain and BALB/c mice) (36). Although TL strains like C57BL/6 (B6) and C3H/He (C3H) do not express TL in their thymuses, a proportion of T lymphomas originating in these mice express TL as a tumor antigen.

In previous studies, we showed that TL can be recognized by both TCR {alpha}ß and TCR {gamma}{delta} cytotoxic T lymphocytes (CTL) (79). Since the cytotoxic activity of these CTL is inhibited by anti-TL antibodies, but not by anti-H-2 antibodies, it was concluded that recognition of TL is direct without any requirement for antigen presentation by H-2 molecules. Recent studies have demonstrated that TL molecules are transported to and stably expressed on the surface of murine RMA-S cells lacking TAP2 at 37°C (10,11). They are also expressed on thymocytes of TAP1-deficient mice (12). However, it has not been determined whether TL-specific CTL recognize the TL molecule expressed in a TAP-independent manner. In order to answer this interesting question, an attempt was made in this study to ascertain whether TL-specific CTL recognize TL expressed on cells lacking the peptide-loading machinery for MHC class Ia molecules. Thus, for the CTL target cells, we prepared T3b-TL transfectants of Drosophila melanogaster cells that have proved to have much broader defects in peptide loading in MHC molecules than RMA-S (13), together with T3b-TL transfectants of RMA-S. Both transfectant cells were found to be sensitive to TL-specific CTL, demonstrating that the CTL epitope is TAP independent.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Mice
The derivation of the transgenic mouse strains used here has been described previously (14,15). Tg.Con.3-1, having a chimeric gene in which the T3b gene (from B6) is driven by the H-2Kb promoter, expresses T3b-TL ubiquitously. Another strain, Tg.Tlaa-3-1, having a Tlaa-3 transgene (from A-strain) with its own promoter, expresses Tlaa-3-TL predominantly on thymocytes and intestinal epithelial cells. These transgenic mice were generated on a C3H background, without TL in the thymus, but with expression of T3k-TL in the intestine.

To test ß2-microglobulin (ß2m) or TAP dependency of TL expression, Tg.Tlaa-3-1 mice were crossed to mice with disrupted ß2m [ß2m–/– (16)] or TAP1 [TAP1–/– (17)] respectively. ß2m–/– and TAP1–/– mice were kindly provided by Dr M. Zijlstra (Massachusetts Institute of Technology, Cambridge, MA) and Dr S. Tonegawa (Massachusetts Institute of Technology) respectively. C3H and B6 mice were purchased from Japan SLC (Hamamatsu, Japan).

Cells
Bulk CTL lines and CTL clones against TL were established as previously described (79). CTL clone (2-8-2) against H-2Kb was established as previously described (79) using spleen cells from Tg.H-2Kb-1 (14) as stimulator cells. Bulk CTL lines with H-2b allospecificity were prepared by culturing C3H spleen cells with 20 Gy irradiated B6 spleen cells. RMA and RMA-S (18) were kindly provided by Dr K. Kärre (Karolinska Institute, Stockholm, Sweden), Sf9 cells (19) by Dr N. Yokoyama (Aichi Cancer Center Research Institute) and Schneider cells [S2 (20)] by Dr M. Yamaguchi (Aichi Cancer Center Research Institute).

Antibodies
Rat mAb against TL [HD168 (21)] and mouse mAb to TL.2 [TT213 (7)] were described previously. Rat mAb to H-2 [M1/42 (22)], mouse mAb to H-2KbDb [20-8-4S (23)] and ß2m [S19.8 (24)] were kindly provided by Dr M. Inaba (Kansai Medical University, Moriguchi, Japan), Dr E. Nakayama (Okayama University, Okayama, Japan) and Dr N. Tada (Tokai University, Isehara, Japan) respectively. Mouse mAb to H-2Kb [Y-3 (25)] was purchased from ATCC (Manassas, VA). Biotinylated rat mAb to Thy-1.2 (30-H12) was purchased (Becton Dickinson, Mountain View, CA).

Flow cytometric analysis
Flow cytometric analysis was performed on a FACScan (Becton Dickinson) using Lysys II software. FITC-labeled goat anti-rat IgG (Chemicon International, Temecula, CA) or rabbit anti-mouse Ig (Dako-Patts, Glostrup, Denmark) or phycoerythrin (PE)-labeled streptavidin (PharMingen, San Diego, CA) were used as second reagents.

Isolation of cDNA clones encoding T3b and ß2m
cDNA encoding T3b was prepared by RT-PCR from total RNA of small intestine of B6 with the 5' primer GGAATTCCAACTTCAGATTTCCCTAACATGAGGATGGG and the 3' primer GGAATTCCATTGTCAGGAGACCAATGGTGGGGCAGAAG. These primers were tagged with EcoRI sites (underlined), and the PCR product was cut with EcoRI and ligated into pUC19 cut with the same enzyme to construct the plasmid T3b-pUC19. cDNA encoding ß2m was prepared by RT-PCR from total RNA of small intestine of B6 with the 5' primer CGGGATCCCGATTTCAGTGGCTGCTACTCGGCGCTTCAGT and the 3' primer GCTCTAGAGCTCAGCTATCTAGGATATTTCCAATT according to the method described by Ribaudo and Margulies (26). The primers were tagged with BamHI and XbaI sites respectively as indicated with underlines. After BamHI and XbaI digestion, the PCR product was ligated into pUC19 cut with the same enzymes to construct the plasmid ß2m-pUC19. cDNA inserts used for other plasmid constructs were prepared from these constructs.

Production of T3b transfectants of RMA and RMA-S cells
T3b cDNA was transferred into the EcoRI site of the pCXN expression vector (kindly provided by Dr J.-i Miyazaki (Osaka University, Osaka, Japan) (27) and the expression vector containing T3b cDNA (T3b-pCXN) was digested with HindIII to be linearized. RMA and RMA-S cells were transfected with T3b-pCXN by electroporation with a Gene Transfector 300 (BTX, San Diego, CA). Stable transfectants were obtained by selection in 0.6 mg/ml (RMA) and 0.8 mg/ml (RMA-S) of G418 (Gibco/BRL, Gaithersburg, MD).

Production of transfectants of Schneider cells (S2) transiently expressing T3b–ß2m complex
Baculoviruses containing T3b or ß2m cDNA were prepared using Bac-TO-Bac baculovirus expression systems (Gibco/BRL) according to the manufacturer's instructions. Briefly, T3b and ß2m cDNA were inserted into EcoRI and BamHI–XbaI sites of plasmid pFASTBAC respectively, and transferred into bacmid in DH10BAC competent cells. Sf9 cells were transfected with recombinant bacmid using CELLFECTIN (Gibco/BRL) to prepare virus solution, and S2 cells were simultaneously infected with the viruses encoding T3b and ß2m. Two days after infection, infected cells transiently expressing T3b–ß2m complex were used as target cells.

Production of T3b–ß2m transfectants of Schneider cells (S2)
T3b or ß2m cDNA was transferred into the pGEM3-Actex3 expression vector (kindly provided by Dr M. Yamaguchi), constructed by inserting a NotI linker into the KpnI site of pGEM3-Actex1 (28). For blunt end ligation, termini of EcoRI-digested T3b, BamHI–XbaI-digested ß2m and NotI-digested pGEM3-Actex3 were modified to blunt ends by filling in with T4 DNA polymerase. The cDNAs were then ligated into pGEM3-Actex3, and termed T3b-pGEM3-Actex3 and ß2m-pGEM3-Actex3. A neor cassette was cut from pMC1neo PolyA (Stratagene, La Jolla, CA) with XhoI and BamHI, transferred into SalI and BamHI sites of T3b-pGEM3-Actex3, and termed T3b-neor-pGEM3-Actex3. Co-transfection of T3b-neor-pGEM3-Actex3 and ß2m-pGEM3-Actex3 into S2 cells was performed using CellFectin according to the manufacturer's instructions. Stable transfectants were obtained by positive selection with a mouse mAb against TL (TT213) and a CELLection pan mouse IgG kit (Dynal, Oslo, Norway) after growth in 1.0 mg/ml of G418.

CTL and IFN-{gamma} production assays
The CTL assay was performed as previously described (79). For assessment of IFN-{gamma} production, CTL clones (1x105) were incubated with various target cells (1x105) for 18 h in 96-well round-bottom tissue culture plates and the culture supernatants were collected. The amounts of IFN-{gamma} were measured by ELISA (Quantikine M; R & D systems, Minneapolis, MN).


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
TL expression on thymocytes is ß2m dependent but TAP1 independent
We first tested TAP1 or ß2m dependency of TL expression on thymocytes by crossing Tg.Tlaa-3-1 mice to TAP1–/– or ß2m–/– respectively. As shown in Fig. 1AGo, Tlaa-3-TL was expressed on thymocytes of Tg.Tlaa-3-1/TAP1–/– mice similarly to those from Tg.Tlaa-3-1 mice, whereas H-2 expression on thymocytes was significantly down-regulated. On the other hand, expression of both Tlaa-3 and H-2 on thymocytes of Tg.Tlaa-3-1/ß2m–/– mice was completely inhibited. These results are consistent with the previous report that TL expression on thymocytes is ß2m dependent but TAP1 independent (12).



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 1. (A) Flow cytometric analysis of TL expression on thymocytes from TAP1-deficient and ß2m-deficient mice. Thymocytes from Tg.Tlaa-3-1, Tg.Tlaa-3-1/TAP1–/– and Tg.Tlaa-3-1/ß2m–/– mice were stained with rat mAb to TL (HD168) or H-2 (M1/42) plus FITC-labeled goat anti-rat IgG and biotinylated rat mAb to Thy-1.2 plus PE–streptavidin, and the Thy-1.2+ population was gated and analyzed. Flow cytometric analysis was performed using a FACScan. (B) T3b-TL expression on mouse RMA-S and RMA transfectants used in CTL assay. Cells were incubated for 18 h either at 37 or 25°C and then stained with mAb. Anti-TL mAb (HD168) plus FITC-labeled anti-rat IgG were used for cell staining. Relative amounts of TL antigen on the transfectants are summarized in Table 1Go, together with those of H-2KbDb (20-8-4S).

 
TL-specific CTL recognize the epitope(s) expressed TAP2 independently
To investigate the epitope recognized by TL-specific CTL, we first prepared T3b-TL transfectants of TAP2-deficient RMA-S cells as well as parental RMA cells. T3b-TL and H-2KbDb expression of these transfectants cultured either at 37 or 25°C was analyzed by flow cytometry. The relative amounts of these surface antigens are summarized in Table 1Go, while the profile of representative clones is shown in Fig. 1BGo. High levels of TL expression were equally detected on all the RMA-S transfectants cultured at 37 or 25°C, whereas high levels of H-2KbDb expression were only observed on cells cultured at 25°C. These results are consistent with the previous report that expression of the TL antigen is TAP2 independent (10,11).


View this table:
[in this window]
[in a new window]
 
Table 1. Effects of reduced temperature on TL expression of transfectants
 
Next, we tested whether TL-specific CTL recognize and lyse transfectant cells. Bulk CTL lines against TL from primary mixed lymphocyte cultures were used as effector cells. As shown in Fig. 2AGo, these CTL lines showed comparable cytotoxicity against T3b transfectants of RMA-S (1F1) grown at 37 or 25°C. The activity of these CTL lines against 1F1 target cells was as strong as that against the T3b transfectant of RMA (1G10), although the latter expresses TL to a greater extent. In contrast, bulk CTL lines with H-2b allospecificity showed weaker cytotoxicity against 1F1 transfectants and RMA-S grown at 37°C than against those grown at 25°C. Similar results were obtained when other transfectants were used as target cells (data not shown). Furthermore, bulk TL-specific CTL lines derived from four different mice exhibited similar cytotoxic activity (data not shown), suggesting that most TL-specific CTL recognize the epitope(s) expressed on TL molecules TAP2 independently.



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 2. (A) Cytotoxic activity of bulk CTL lines against T3b-TL transfectants of RMA and RMA-S cells. Target cells were incubated for 18 h either at 37 or 25°C and used for CTL assays. Bulk CTL lines were generated as described previously (7,8) and incubated with 51Cr-labeled target cells (2x104) at 37°C for 3 h. Target cells were T3b transfectants of RMA (1G10, •), RMA ({circ}), T3b transfectants of RMA-S (1F1, {blacksquare}) and RMA-S ({square}). (T3b-TL expression, see Table 1Go and Fig. 1BGo). (B) Cytotoxic activity of CTL clones against T3b transfectants of RMA and RMA-S cells. CTL clone expressing TCR {alpha}ß (TC9-1) or TCR {gamma}{delta} (KC5-1) was incubated with 51Cr-labeled target cells (2x104) for 3 h. Target cells were Con A blast cells of Tg.Con.3-1 ({blacktriangleup}) and C3H ({triangleup}), T3b transfectants of RMA (1G10, •), RMA ({circ}), T3b transfectants of RMA-S (1F1, {blacksquare}) and RMA-S ({square}). These target cells were grown at 37°C. Similar results were also obtained with those pre-incubated at 25°C for 18 h (data not shown). (C) Cytotoxic activity of CTL clones against T3b transfectants of RMA and RMA-S cells after acid treatment. T3b transfectants of RMA (1G10) and RMA-S (1F1) were grown at 37°C, 51Cr labeled and treated at 4°C for 2 min with citric acid buffer at pH 3.0 (34). CTL clones against TL were incubated with these target cells (2x104) for 3 h. Target cells were untreated 1G10 (•) and acid-treated 1G10 ({circ}), untreated 1F1 ({blacksquare}), and acid-treated 1F1 ({square}) (TL and H-2Kb expression, see Table 2Go).

 
Since most TL-specific CTL derived from C3H express TCR {alpha}ß, we tested whether TL-specific CTL with a TCR {gamma}{delta} phenotype also showed cytotoxicity against RMA-S transfectants. As shown in Fig. 2BGo, not only TCR {alpha}ß but also the TCR {gamma}{delta} CTL clone lysed 1F1 and 1G10 transfectants grown at 37°C significantly, suggesting that TCR {gamma}{delta} CTL also recognize the epitope expressed TAP2 independently. Similar results were also obtained when other transfectants were used as target cells (data not shown).

TL is expressed on Drosophila cells with broad defects in peptide loading on MHC molecules
RMA-S lacks TAP2 molecules, but TAP-independent pathways for peptide loading have been reported (2933). Therefore, we next attempted to generate T3b-TL transfectants of D. melanogaster cells (Schneider cells) that are known to have much broader defects in peptide loading on MHC molecules than RMA-S (13), to address whether peptide loading on the TL molecule is necessary for the formation of the epitope(s) recognized by TL-specific CTL. First, we constructed baculoviruses containing cDNA for T3b or ß2m, and both were simultaneously infected into Schneider cells (S2) to express TL transiently. As shown in Fig. 3AGo, TL was expressed only when both viruses were co-infected, confirming ß2m dependence. These results also suggested that TL might be expressed on the cell surface without peptide loading.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 3 (A) T3b-TL expression on Schneider cell transfectants of D. melanogaster. (1) Transient T3b-TL expression by the baculovirus expression system. Schneider cells (S2) were infected with baculovirus containing T3b (T3b-BV) and/or ß2m2m-BV) genes, incubated at 25°C for 48 h, stained with HD168 plus FITC-labeled anti-rat IgG, and analyzed for TL expression by flow cytometry. (2) Stable T3b-TL expression by a plasmids containing the actin 5C promoter. Schneider cells (S2) were transfected with T3b-neor-pGEM3-Actex3 and ß2m-pGEM3-Actex3 using CellFectin reagent. For detecting TL and ß2m, anti-TL mAb HD168 plus FITC-labeled anti-rat IgG and anti-ß2m mAb S19.8 plus FITC-labeled anti-mouse Ig were used respectively. (B) IFN-{gamma} production by CTL clones stimulated with Schneider cell transfectants expressing T3b–ß2m transiently. CTL clones (1x105) were incubated with various target cells (1x105) for 18 h in 96-well round-bottom tissue culture plates and then the IFN-{gamma} concentration of the culture supernatants was measured by ELISA (TL expression, see Fig. 3AGo). (C) Cytotoxic activity of CTL clones against stable T3bß2m transfectants of Schneider cells. CTL clones were incubated with 51Cr-labeled target cells (2x104) for 3 h. Target cells were Con A blast cells of Tg.Con.3-1 (•) and C3H ({circ}), stable T3bß2m transfectants of Schneider cells (S2) ({blacktriangleup}), and S2 cells ({triangleup}) (TL expression, see Fig. 3AGo).

 
Both TCR {alpha}ß and TCR {gamma}{delta} CTL recognize TL expressed on Schneider cells
We tested the reactivity of TL-specific CTL against TL transiently expressed on Schneider cells by IFN-{gamma} production assay. As shown in Fig. 3BGo, higher amounts of IFN-{gamma} were produced by both TCR {alpha}ß and TCR {gamma}{delta} CTL clones co-cultured with TL transtectants of Schneider cells, suggesting that these CTL clones recognize TL expressed on the cell surface probably without peptide loading.

Next, we prepared stable transfectants of Schneider cells. As shown in Fig. 3BGo, the T3b–ß2m complex was expressed on Schneider cells, although the expression level was slightly lower than that in transient transfectants. Both TCR {alpha}ß and TCR {gamma}{delta} CTL clones showed significant cytotoxicity against these stable transfectants (Fig. 3CGo). Bulk CTL lines against TL also showed significant cytotoxicity (data not shown).

TL-specific CTL clones recognize TL after acid treatment
Finally, we tested whether TL-specific CTL clones recognize TL after acid treatment. T3b transfectants of RMA and RMA-S were treated with citric acid buffer (pH 3.0) under the condition that antigenic peptides in the antigen binding cleft of H-2 molecules are known to be released (34), and the expression of T3b-TL and H-2Kb was analyzed by flow cytometry. As shown in Table 2Go, expression of T3b as well as of H-2Kb was significantly decreased. Nevertheless, both TCR {alpha}ß and TCR {gamma}{delta} TL-specific CTL clones showed a comparable cytotoxicity against acid-treated T3b transfectants to that against untreated cells (Fig. 2CGo), showing that a relatively small amount of the remaining T3b molecule probably without peptides was recognized by these CTL clones. In the case of H-2Kb-specific CTL clone 2-8-2, it did not lyze T3b-RMA after acid treatment nor T3b-RMA-S (data not shown). These data together suggest that both TL-specific CTL clones against TL can recognize TL without antigenic peptides.


View this table:
[in this window]
[in a new window]
 
Table 2. Effects of acid treatment on TL expression of transfectants
 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The present study showed that TL expression on thymocytes is ß2m dependent, but TAP1independent, using ß2m-deficient and TAP1-deficient mice respectively, confirming the results by other investigators (1012). We also showed here that most TL-specific CTL expressing either TCR {alpha}ß or TCR {gamma}{delta} recognize the epitope(s) expressed TAP independently.

Recent studies revealed that some MHC class Ib molecules have specialized functions (reviewed in 35). In mice, Qa-1 (36), Qa-2 (37) and M3 (38) are known to be capable of binding antigenic peptides; however, it is still controversial whether TL binds peptides (10,39). Our previous structural comparison of TL and MHC class Ia molecules suggested that TL molecules can form peptide binding clefts (40). Since only a single amino acid non-synonymous substitution at position 169 is recognized in the peptide binding region of seven known TL genes, a relatively restricted repertoire of antigens of protein or other chemical nature appears to be presented by TL molecules. Analysis of TCR of TL-specific CTL clones showed a relatively limited Vß usage (Vß8.3 and 14) and V{gamma} usage (V{gamma}4) in TCR {alpha}ß and TCR {gamma}{delta} CTL respectively, but nucleotide sequencing showed heterogeneity in the CDR3 region of the TCR V gene (8,9), suggesting that the repertoire of antigens recognized is not necessarily limited, although a CTL epitope consisting of a single peptide presented by a single MHC molecule is sometimes recognized by a variety of TCR (41).

In the case of Qa-1, CTL clones recognizing not only TAP-dependent epitopes but also TAP-independent epitopes were reported (33,36,42), but our present study showed that most TL-specific CTL recognize epitopes expressed TAP independently, suggesting that the CTL epitope may be present on (i) non-peptide antigen such as lipid or carbohydrate, (ii) endogenous peptides processed by TAP-independent or unknown pathways, or (iii) the framework of the TL molecule. Mouse and human CD1 molecules are encoded by genes located outside of the MHC region, but are regarded as MHC class Ib molecules and characterized by a unique ability to present non-protein antigens (4347). Mycolic acids and phosphoglycolipids of the bacterial wall were first identified as antigens recognized by human CD1b- and CD1c-restricted T cells (45,46). Recently, mycolyl glycolipids have been shown to bind to human CD1b (47). Cellular glycophosphatidylinositol has been identified as the major ligand for mouse CD1d molecules and could constitute the natural ligand of T cells directly reactive to CD1d (48). It is possible that such lipid antigens may be presented by TL molecules expressed on Drosophila cells or mouse RMA-S cells and be recognized by TL-restricted CTL.

TCR {gamma}{delta} cells are known to have a recognition mode similar to antibodies (49), apparently recognizing the framework of MHC class Ia and II molecules (50) and also certain antigens that are not presented on MHC molecules (reviewed in 51). Therefore, it is probable that TL-specific TCR {gamma}{delta} CTL may recognize the framework of TL. A major population of TCR {alpha}ß CTL are known to recognize peptide antigens in the context of MHC class Ia molecules (52), although a minor population recognizes TAP-independent epitopes as demonstrated by studies of allorecognition of MHC class Ia with mouse RMA-S and human T2 cells (5358). Portions of these TAP-independent epitopes may be present on the framework of MHC class Ia molecule, while the reminder could be formed with MHC class Ia plus TAP-independent endogenous peptides (2933). Accordingly, there is a possibility that even TCR {alpha}ß CTL may directly recognize the TL molecule framework. This possibility may be supported by the present results that, in contrast to TAP-dependent H-2Kb specific CTL clones, TL-specific CTL clones showed a comparable cytotoxicity against acid-treated T3b-RMA cells to that against non-treated cells, implying the recognition of TL molecule without antigenic peptides. In the case of allorecognition, the definitive evidence for peptide-independent TCR recognition was provided by the proliferative reactivity of an H-2Kb-allospecific hybridoma upon incubation with immobilized H-2Kb even after acid treatment (58). Thus, we are now preparing soluble T3b-TL molecules to test whether TL-specific CTL can recognize immobilized TL after acid treatment. Furthermore, it may also be possible to determine whether the CTL epitope(s) is present on the framework or not by producing transfectants expressing a variety of chimeric molecules between TL and H-2 as targets.

The present study suggests that the recognition mode is quite different between TL-specific CTL and MHC class Ia-restricted conventional CTL, and also that TL may have a specialized function. Most of the studies on TL by our group and others have been conducted with thymocytes and leukemia cells, but some mouse strains lack TL expression in the thymus. In contrast, the intestine of all mouse strains is positive (5,6), suggesting that TL may be involved in host defense in the intestinal tract. Further studies of TL expressed on intestinal cells appear warranted to help elucidate the physiological function of the TL molecule.


    Acknowledgments
 
This work was supported in part by a grant-in-aid for Scientific Research on Priority Areas from the Ministry of Education, Science, Sports and Culture, Japan, a special project grant from Aichi Cancer Center, an Imanaga Medical Research Grant, and a Bristol-Myers Squibb Biomedical Research Grant. We are grateful to Drs M. Inaba, K. Kärre, J. Miyazaki, E. Nakayama, N. Tada, S. Tonegawa, M. Yamaguchi, N. Yokoyama and M. Zijlstra for their kind gifts of various materials used in this study. We thank Dr M. A. Moore for his editorial assistance.


    Abbreviations
 
ß2m ß2-microglobulin
CTL cytotoxic T lymphocyte
B6 C57BL/6
C3H C3H/He
PE phycoerythrin
TL thymus leukemia

    Notes
 
Transmitting editor: K. Okumura

Received 28 February 2000, accepted 2 May 2000.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Klein, J. 1986. Natural History of the Major Histocompatibility Complex. Wiley, New York.
  2. Shawar, S. M., Vyas, J. M., Rodgers, J. R. and Rich, R. R. 1994. Antigen presentation by major histocompatibility complex class I-B molecules. Annu. Rev. Immunol. 12:839.[ISI][Medline]
  3. Old, L. J. and Stockert, E. 1977. Immunogenetics of cell surface antigens of mouse leukemia. Annu. Rev. Genet. 11:127.[ISI][Medline]
  4. Chen, Y.-T., Obata, Y., Stockert, E., Takahashi, T. and Old, L. J. 1987. Tla-region genes and their products. Immunol. Res. 6:30.[ISI][Medline]
  5. Hershberg, R., Eghtesady,P., Sydora, B., Brorson, K., Cheroutre,H., Modlin, R. and Kronenberg, M. 1990. Expression of the thymus leukemia antigen in mouse intestinal epithelium. Proc. Natl Acad. Sci. USA 87:9727.[Abstract/Free Full Text]
  6. Wu, M., Van Kaer, L., Itohara, S. and Tonegawa, S. 1991. Highly restricted expression of the thymus leukemia antigens on intestinal epithelial cells. J. Exp. Med. 174:213.[Abstract/Free Full Text]
  7. Morita, A., Takahashi, T., Stockert, E., Nakayama, E., Tsuji, T., Matsudaira, Y., Old, L. J. and Obata, Y. 1994. TL antigen as a transplantation antigen recognized by TL-restricted cytotoxic T cells. J. Exp. Med. 179:777.[Abstract/Free Full Text]
  8. Tsujimura, K., Takahashi, T., Morita, A., Hasegawa-Nishiwaki, H., Iwase, S. and Obata, Y. 1996. Positive selection of {gamma}{delta} CTL by TL antigen expressed in the thymus. J. Exp. Med. 184:2175.[Abstract/Free Full Text]
  9. Tsujimura, K., Takahashi, T., Iwase, S., Matsudaira, Y., Kaneko, Y., Yagita, H. and Obata, Y. 1998. Two types of anti-TL (thymus leukemia) CTL clones with distinct target specificities: differences in cytotoxic mechanisms and accessory molecule requirements. J. Immunol. 160:5253.[Abstract/Free Full Text]
  10. Holcombe, H. R., Castaño, A. R., Cheroutre, H., Teitell, M., Maher, J. K. Peterson, P. A. and Kronenberg, M. 1995. Nonclassical behavior of the thymus leukemia antigen: peptide transporter-independent expression of a nonclassical class I molecule. J. Exp. Med. 181:1433.[Abstract/Free Full Text]
  11. Rodgers, J. R., Mehta, V. and Cook, R. G. 1995. Surface expression of ß2-microglobulin-associated thymus-leukemia antigen is independent of TAP2. Eur. J. Immunol. 25:1001.[ISI][Medline]
  12. Joyce, S., Negishi, I., Boesteanu, A., DeSilva, A. D., Sharma, P., Chorney, M. J., Loh, D. Y. and Van Kaer, L. 1996. Expansion of natural (NK1+) T cells that express {alpha}ß T cell receptors in transporters associated with antigen presentation-1 null and thymus leukemia antigen positive mice. J. Exp. Med. 184:1579.[Abstract/Free Full Text]
  13. Jackson, M. R., Song, E. S., Yang, Y. and Peterson, P. A. 1992. Empty and peptide-containing conformers of class I major histocompatibility complex molecules expressed in Drosophila melanogaster cells. Proc. Natl Acad. Sci. USA 89:12117.[Abstract/Free Full Text]
  14. Hamasima, N., Takahashi, T., Taguchi, O., Nishizuka, Y., Stockert, E., Old, L. J. and Obata, Y. 1989. Expression of TL, H-2, and chimeric H-2/TL genes in transgenic mice: abnormal thymic differentiation and T-cell lymphomas in a TL transgenic strain. Proc. Natl Acad. Sci. USA 86:7995.[Abstract/Free Full Text]
  15. Obata, Y., Taguchi, O., Matsudaira, Y., Hasegawa, H., Hamasima, N. and Takahashi, T. 1991. Abnormal thymic development, impaired immune function and {gamma}{delta} T cell lymphomas in a TL transgenic mouse strain. J. Exp. Med. 174:351.[Abstract/Free Full Text]
  16. Zijlstra, M., Bix, M., Simister, N. E., Loring, J. M., Raulet, D. H. and Jaenisch, R. 1990. ß2-microglobulin deficient mice lack CD48+ cytolytic T cells. Nature 344:742.[Medline]
  17. Van Kaer, L., Ashton-Rickardt, P. G., Ploegh, H. L. and Tonegawa, S. 1992. TAP1 mutant mice are deficient in antigen presentation, surface class I molecules, and CD48+ T cells. Cell 71:1205.[ISI][Medline]
  18. Kärre, K., H. G. Ljunggren, H. G., Piontek, G. and Kiessling, R. 1986. Selective rejection of H-2-deficient lymphoma variants suggests alternative immune defence strategy. Nature 319:675.[Medline]
  19. Summers, M. D. and Smith, G. E. 1987. A manual of methods for baculovirus vectors and insect cell culture procedures. Texas Agric. Exp. Station Bull. 1555:1.
  20. Schneider, I. 1972. Cell lines derived from late embryonic stages of Drosophila melanogaster. J. Embryol. Exp. Morphol. 27:353.[ISI][Medline]
  21. Obata, Y., Chen, Y.-T., Stockert, E. and Old, L. J. 1985. Structural analysis of TL genes of the mouse. Proc. Natl Acad. Sci. USA 82:5475.[Abstract/Free Full Text]
  22. Springer, T. A. 1980. Cell-surface differentiation in the mouse. Characterization of `jumping' and `lineage' antigens using xenogeneic rat monoclonal antibodies. In Kennett, R. H., McKearn, T. J. and Bechtol, K. B., eds, Monoclonal Antibodies, p. 185. Plenum Press, New York.
  23. Ozato, K. and Sachs, D. H. 1981. Monoclonal antibodies to mouse MHC antigens. III. Hybridoma antibodies reacting to antigens of the H-2b haplotype reveal genetic control of isotype expression. J. Immunol. 126:317.[Abstract]
  24. Tada, N., Kimura, S., Hatzfeld, A. and Hämmerling, U. 1980. Ly-m11: the H-3 region of mouse chromosome 2 controls a new surface alloantigen. Immunogenetics 11:441.[ISI][Medline]
  25. Hämmerling, G. J., Rüsch, E., Tada, N., Kimura, S. and Hämmerling, U. 1982. Localization of allodeterminants on H-2Kb antigens determined with monoclonal antibodies and H-2 mutant mice. Proc. Natl Acad. Sci. USA 79:4737.[Abstract/Free Full Text]
  26. Ribaudo, R. K. and Margulies, D. H. 1992. Independent and synergistic effects of disulfide bond formation, ß2-microglobulin, and peptides on class I MHC folding and assembly in an in vitro translation system. J. Immunol. 149:2935.[Abstract]
  27. Niwa, H., Yamamura, K. and Miyazaki, J. 1991. Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108:193.[ISI][Medline]
  28. Yoo, M.-A., Lee, W.-H., Ha, H.-Y., Ryu, J.-R., Yamaguchi, M., Fujikawa, K., Matsukage, A., Kondo, S. and Nishida, Y. 1994. Effects of DNA polymerase ß gene over-expressed in transgenic Drosophila on DNA repair and recombination. Jpn. J. Genet. 69:21.[Medline]
  29. Sijts, A. J. M., De Bruijn, M. L. H., Nieland, J. D., Kast, W. M. and Melief, C. J. M. 1992. Cytotoxic T lymphocytes against the antigen-processing-defective RMA-S tumor cell line. Eur. J. Immunol. 22:1639.[ISI][Medline]
  30. Esquivel, F., Yewdell, J. and Bennink, J. 1992. RMA/S cells present endogenously synthesized cytosolic proteins to class I-restricted cytotoxic T lymphocytes. J. Exp. Med. 175:163.[Abstract/Free Full Text]
  31. Hosken, N. A. and Bevan, M. J. 1992. An endogenous antigenic peptide bypasses the class I antigen presentation defect in RMA-S. J. Exp. Med. 175:719.[Abstract/Free Full Text]
  32. Zhou, X., Glas, Momburg, R. F., Hämmerling, G. J., Jondal, M. and Ljunggren, H.-G. 1993. TAP2-defective RMA-S cells present Sendai virus antigen to cytotoxic T lymphocytes. Eur. J. Immunol. 23:1796.[ISI][Medline]
  33. Tompkins, S. M., Kraft, J. R., Dao, C. T., Soloski, M. J. and Jensen, P. E. 1998. Transporters associated with antigen processing (TAP)-independent presentation of soluble insulin to {alpha}/ß T cells by the class Ib gene product, Qa-1b. J. Exp. Med. 188:961.[Abstract/Free Full Text]
  34. Sugawara, S., Abo, T. and Kumagai, K. 1987. A simple method to eliminate the antigenicity of surface class I MHC molecules from the membrane of viable cells by acid treatment at pH 3. J. Immunol. Methods 100:83.[ISI][Medline]
  35. Kronenberg, M., Brossay, L., Kurepa, Z. and Forman, J. 1999. Conserved lipid and peptide presentation functions of nonclassical class I molecules. Immunol. Today 20:515.[ISI][Medline]
  36. Aldrich, C. J., DeCloux, A., Woods, A. S., Cotter, R. J., Soloski, M. J. and Forman, J. 1994. Identification of a Tap-dependent leader peptide recognized by alloreactive T cells specific for a class Ib antigen. Cell 79:649.[ISI][Medline]
  37. Joyce, S., Tabaczewski,P., Angeletti, R. H., Nathenson, S. G. and Stroynowski, I. 1994. A nonpolymorphic major histocompatibility complex class Ib molecule binds a large array of diverse self-peptides. J. Exp. Med. 179:579.[Abstract/Free Full Text]
  38. Fischer Lindahl, K., Byers, D. E., Dabhi, V. M., Hovik, R., Jones, E. P., Smith, G. P., Wang, C.-R., Xiao, H. and Yoshino, M. 1997. H2-M3, a full-service class IB histocompatibility antigen. Annu. Rev. Immunol. 15:851.[ISI][Medline]
  39. Sharma, P., Joyce, S., Chorney, K. A., Griffith, J. W., Bonneau, R. H., Wilson, F. D., Johnson, C. A., Flavell, R. A. and Chorney, M. J. 1996. Thymus-leukemia antigen interacts with T cells and self-peptides. J. Immunol. 156:987.[Abstract]
  40. Obata, Y., Satta, Y., Moriwaki, K., Shiroishi, T., Hasegawa, H., Takahashi, T. and Takahata, N. 1994. Structure, function, and evolution of mouse TL genes, nonclassical class I genes of the major histocompatibility complex. Proc. Natl Acad. Sci. USA 91:6589.[Abstract/Free Full Text]
  41. Casanova, J.-L. and Maryanski, J. L. 1993. Antigen-selected T-cell receptor diversity and self-nonself homology. Immunol. Today 14:391.[ISI][Medline]
  42. Aldrich, C. J., Waltrip, R., Hermel, E., Attaya, M., Fischer Lindahl, K., Monaco, J.J, and Forman, J. 1992. T cell recognition of Qa-1b antigens on cells lacking a functional Tap-2 transporter. J. Immunol. 149:3773.[Abstract]
  43. Porcelli, S. A. 1995. The CD1 family: a third lineage of antigen-presenting molecules. Adv. Immunol. 59:1.[ISI][Medline]
  44. Burdin, N. and Kronenberg, M. 1999. CD1-mediated immune responses to glycolipids. Curr. Opin. Immunol. 11:326.[ISI][Medline]
  45. Beckman, E. M., S. A. Porcelli, S. A., Morita, C. T., Behar, S. M., Furlong, S. T. and Brenner, M. B. 1994. Recognition of a lipid antigen by CD1-restricted {alpha}ß+ T cells. Nature 372:691.[Medline]
  46. Sieling, P. A., Chatterjee, D., Porcelli, S. A., Prigozy, T. I., Mazzaccaro, R. J., Soriano, T., Bloom, B. R., Brenner, M. B., Kronenberg, M., Brennan, P. J. and Modlin, R. L. 1995. CD1-restricted T cell recognition of microbial lipoglycan antigens. Science 269:227.[Abstract/Free Full Text]
  47. Moody, D. B., Reinhold, B. B., Guy, M. R., Beckman, E. M., Frederique, D. E., Furlong, S. T., Ye, S., Reinhold, V. N., Sieling, P. A., Modlin,R. L., Besra, G. S. and Porcelli, S. A.. 1997. Structural requirements for glycolipid antigen recognition by CD1b-restricted T cells. Science 278:283.[Abstract/Free Full Text]
  48. Joyce, S., Woods, A. S., Yewdell, J. W., Bennink, J. R., De Silva, A. D., Boesteanu, A., Balk, S. P., Cotter, R. J. and Brutkiewicz, R. R. 1998. Natural ligand of mouse CD1d1: cellular glycosylphosphatidylinositol. Science 279:1541.[Abstract/Free Full Text]
  49. Rock, E. P., Sibbald, P. R., Davis, M. M. and Chien, Y.-H. 1994. CDR3 length in antigen-specific immune receptors. J. Exp. Med. 179:323.[Abstract/Free Full Text]
  50. Schild, H., Mavaddat, N., Litzenberger, C., Ehrich, E. W., Davis, M. M., Bluestone, J. A., Matis, L., Draper, R. K. and Chien, Y.-H. 1994. The nature of major histocompatibility complex recognition by {gamma}{delta} T cells. Cell 76:29.[ISI][Medline]
  51. Chien, Y.-H., Jores, R. and Crowley, M. P. 1996. Recognition by {gamma}/{delta} T cells. Annu. Rev. Immunol. 14:511.[ISI][Medline]
  52. Townsend, A. and Bodmer, H. 1989. Antigen recognition by class I-restricted T lymphocytes. Annu. Rev. Immunol. 7:601.[ISI][Medline]
  53. Elliott, T. J. and Eisen, H. N. 1990. Cytotoxic T lymphocytes recognize a reconstituted class I histocompatibility antigen (HLA-A2) as an allogeneic target molecule. Proc. Natl Acad. Sci. USA 87:5213.[Abstract/Free Full Text]
  54. Aosai, F., Öhlen, C., Ljunggren, H.-G., Höglund, P., Franksson, L., Ploegh, H., Townsend, A., Kärre, K. and Stauss, H. J. 1991. Different types of allospecific CTL clones identified by their ability to recognize peptide loading-defective target cells. Eur. J. Immunol. 21:2767.[ISI][Medline]
  55. Crumpacker, D. B., Alexander, J., Cresswell, P. and Engelhard, V. H. 1992. Role of endogenous peptides in murine allogenic cytotoxic T cell responses assessed using transfectants of the antigen-processing mutant 174xCEM.T2. J. Immunol. 148:3004.[Abstract]
  56. Man, S., Salter, R. D. and Engelhard, V. H. 1992. Role of endogenous peptide in human alloreactive cytotoxic T cell responses. Int. Immunol. 4:367.[Abstract/Free Full Text]
  57. Rötzschke, O., Falk, K., Faath, S. and Rammensee, H.-G. 1991. On the nature of peptides involved in T cell alloreactivity. J. Exp. Med. 174:1059.[Abstract/Free Full Text]
  58. Smith, P. A., Brunmark, A., Jackson, M. R. and Potter, T. A. 1997. Peptide-independent recognition by alloreactive cytotoxic T lymphocytes (CTL). J. Exp. Med. 185:1023.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
P. S. Rohrlich, N. Fazilleau, F. Ginhoux, H. Firat, F. Michel, M. Cochet, N. Laham, M. P. Roth, S. Pascolo, F. Nato, et al.
From The Cover: Direct recognition by {alpha}{beta} cytolytic T cells of Hfe, a MHC class Ib molecule without antigen-presenting function
PNAS, September 6, 2005; 102(36): 12855 - 12860.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
K. Tsujimura, Y. Obata, E. Kondo, K. Nishida, Y. Matsudaira, Y. Akatsuka, K. Kuzushima, and T. Takahashi
Thymus leukemia antigen (TL)-specific cytotoxic T lymphocytes recognize the {alpha}1/{alpha}2 domain of TL free from antigenic peptides
Int. Immunol., November 1, 2003; 15(11): 1319 - 1326.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. K. Davis, R. G. Cook, R. R. Rich, and J. R. Rodgers
Hyperconservation of the Putative Antigen Recognition Site of the MHC Class I-b Molecule TL in the Subfamily Murinae: Evidence That Thymus Leukemia Antigen Is an Ancient Mammalian Gene
J. Immunol., December 15, 2002; 169(12): 6890 - 6899.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. A. Weber, A. Attinger, C. C. Kemball, J. L. Wigal, J. Pohl, Y. Xiong, E. L. Reinherz, H. Cheroutre, M. Kronenberg, and P. E. Jensen
Peptide-Independent Folding and CD8{alpha}{alpha} Binding by the Nonclassical Class I Molecule, Thymic Leukemia Antigen
J. Immunol., November 15, 2002; 169(10): 5708 - 5714.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Tsujimura, Y. Obata, Y. Matsudaira, S. Ozeki, K. Yoshikawa, S. Saga, and T. Takahashi
The Binding of Thymus Leukemia (TL) Antigen Tetramers to Normal Intestinal Intraepithelial Lymphocytes and Thymocytes
J. Immunol., July 15, 2001; 167(2): 759 - 764.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (9)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Tsujimura, K.
Right arrow Articles by Takahashi, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tsujimura, K.
Right arrow Articles by Takahashi, T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?