International Immunology, Vol. 12, No. 8, 1167-1172,
August 2000
© 2000 Japanese Society for Immunology
NF-
B/p50 and NF-
B/c-Rel differentially regulate the activity of the 3'
E-hsl,2 enhancer in normal murine B cells in an activation-dependent manner
Department of Pathology, Uniformed Services University of the Health Sciences, 4301 Jones Bridge Road, Bethesda, MD 20814, USA
Correspondence to: C. M. Snapper
| Abstract |
|---|
|
|
|---|
The enhancer complex located 3' to the CH
gene in the IgH locus (3
E) may regulate B cell function through its ability to act as a locus control region. Multiple, functionally relevant NF-
B binding sites are located within the 3'
E. NF-
B subunits, especially p50 and c-Rel, have also been shown to play critical and differential roles in regulating B cell proliferation, Ig secretion, germline CH transcription and Ig class switching. Thus, NF-
B could regulate B cell function in part through modulation of 3'
E activity. In this study we determined whether p50 and/or c-Rel regulate 3'
E activity in normal murine B cells and whether this depends on the nature of the B cell activator. For this purpose, we crossed p50- and c-Rel-deficient mice with mice that are transgenic for a 3'
E-hsl,2-human ß-globin reporter gene, and established p50/ or c-Rel/ mice homozygous for the enhancer transgene. We show, using optimal stimulating conditions, that p50 selectively augments 3'
E-hsl,2 activity in lipopolysaccharide-activated B cells, whereas c-Rel is required for optimal 3'
E-hs1,2 induction in B cells activated through CD40.
Keywords: B lymphocytes, cellular activation, rodent, transcription factors, transgenic/knockout
| Introduction |
|---|
|
|
|---|
The mouse Ig heavy chain locus contains a set of four enhancers (hs3a, hsl,2, hs3b and hs4) [3'
E] located 3' to the constant heavy gene for IgA ( reviewed in 1). The ability of a combination of 3'
E-hsl,2, 3'
E-hs3b, and 3'
E-hs4 enhancer elements to regulate the myc promoter in a transfected B cell line in a locus-independent, but copy number-dependent, manner suggested that the 3'
E locus acts as a locus control region (2). Except for 3'
E-hs4, which appears to be active in both pre-B cells and plasma cell lines (3,4), the other elements of 3'
E are most active during later stages of B cell differentiation such as in plasma cell lines and in activated B cells, but not in pre-B cells (410). Indeed, 3'
E is activated in B cells stimulated with lipopolysaccharide (LPS), anti-Ig or CD40 ligand (CD40L), albeit through binding of distinct, though overlapping, sets of transcription factors (10,11). Individual enhancers also show synergistic activity when acting in concert (12). The role of the 3'
E in normal B cell function remains to be clearly defined, although control of events throughout B cell differentiation, including VDJ recombination, Ig class switching, somatic mutation, and Ig heavy chain gene expression in plasma cells have been suggested (1,3,13,14).
The 3'
E contains binding sites for multiple transcription factors, including NF-
B (7,9,15,16). Specifically, both p50 and c-Rel binding sites have been identified in 3'
E-hsl,2 (15). Transfection of a plasmacytoma line with a 3'
E-hs1,2 construct containing a mutated, non-binding,
B site indicated that
B binding proteins contribute to at least 50% of the activity of the 3'
E-hsl,2 (15). We and others have previously demonstrated that NF-
B members play key roles in B cell survival, proliferation, differentiation to Ig secretion, germline CH gene transcription and class switch recombination, depending upon the manner in which the B cell is activated (1723). In particular, RelB, p50 and c-Rel, but not p52 or RelA, alone, regulate B cell proliferation in a positive manner, whereas only p50 and c-Rel individually play a role in induction of Ig secretion, germline CH transcription and recombination (1723). Collectively, these studies, and those cited above, suggest that certain NF-
B members may regulate various B cell functions, at least in part, by modulating the activity of the 3'
E.
In this regard, no studies have yet demonstrated the role of individual NF-
B members in 3'
E regulation, whether NF-
B regulates 3'
E activity in normal B lymphocytes and whether the role of NF-
B in 3'
E regulation is dependent upon the manner in which the B cell is activated. In this study we crossed p50- and c-Rel-deficient mice with mice that are transgenic for a 3'
E-hsl,2-human (h) ß-globin reporter gene (10), and established p50/ or c-Rel/ mice homozygous for the enhancer transgene. Purified resting B cells from such mice were activated in distinct ways and relative enhancer activity was measured by quantitation of steady-state levels of hß-globin mRNA. We show, using optimal stimulating conditions, that both p50 and c-Rel differentially regulate 3'
E-hsl,2 activity in a positive manner and that this action further depends upon the nature of the B cell activator.
| Methods |
|---|
|
|
|---|
Generation of homozygotic crosses of NF-
B/Rel/ mice with 3'
E-hsl,2-hß-globin transgenic mice (3'
E-hsl,2Tg)Homozygous 3'
E-hsl,2Tg mice (kindly provided by Dr Sven Pettersson, Karolinska Institute, Stockholm, Sweden) were produced as previously described (10). Briefly, the transgenic construct consisted of a ~900 bp StuIStuI fragment containing the core 3'
E-hs1,2 enhancer, 128 bp upstream of the hß-globin basal promoter and gene. The transcriptional activity of the ß-globin gene is weak unless coupled to a strong regulatory element. 3'
E-hs1,2Tg mice were crossed with NF-
B/p50/ mice (17) (Jackson Laboratories, Bar Harbor, ME) and NF-
B/c-Rel/ mice (18) (kindly provided by Dr Steve Gerondakis, Walter and Eliza Hall Inst. of Med. Research, Victoria, Australia) followed by crossing of resultant F1 mice. Genotyping was performed to identify mice homozygous for both the 3'
E-hs1,2Tg and either the p50 or c-Rel null mutation as follows. A 0.5 cm piece of tail tissue was taken from ~3-week-old animals. The tissue samples were incubated in 0.5 ml of buffer containing 50 mM KCl, 10 mM TrisHCl, pH 8.3, 2.5 mM MgCl2, 0.l mg/ml gelatin, 0.45% v/v NP-40, 0.45%v/v Tween 20 and 100 mg/ml Proteinase K (Boehringer Mannheim, Indianapolis, IN) overnight at 55°C. Proteinase K was inactivated by heating samples in 95°C for 10 min. The insoluble pellet was separated by centrifugation for 5 min in 4°C. About 2 ml of supernatant was used in a standard 25 ml PCR reaction. The PCR products were separated on a 1% agarose gel and stained with ethidium bromide. The primers used were as follows:
p50/
- (i) wild-type-50 sense primer complementary to sequences upstream of the Neo insertion site (present in both control and p50/):
GCAAACCTGGGAATACTTCATGTGACTAAG.
- (ii) HH-NEO antisense primer complementary to sequences within the Neo insertion (present in p50/ only): AAATGTGTCAGTTTCATAGCCTGAAGAACG.
- (iii) BS-7 antisense primer complementary to sequences otherwise deleted by a Neo insertion (present only in control): ATAGGCAAGGTCAGAATGCACCAGAAGTCC.
- (ii) HH-NEO antisense primer complementary to sequences within the Neo insertion (present in p50/ only): AAATGTGTCAGTTTCATAGCCTGAAGAACG.
PCR conditions were as follows: 30 cycles containing 94°C for 1 min, 63°C for 2 min, no primer extension step, MgCl2 concentration 2.5 mM.
When the three primers are used concomitantly the PCR reaction generated a 300 bp band for p50/ and/or a 200 bp band for control.
c-Rel/
DNA samples, extracted from mouse tail tissue, were subjected to PCR analysis for determination of c-Rel/ homozygosity using the following primers:
- (i) Rel SP-2 sense primer complementary to sequences upstream of the Neo insertion site (present in both control and c-reP'): CACGTGCTTGCTGTGAGTTGTTTTCTG.
- (ii) pgk-2 antisense primer complementary to sequences within the Neo insertion (present in c-Rel/ only): GCCTGCTCTTTACTGAAGGCTCTTTAC.
- (iii) Rel 3P-2 antisense from sequence complementary to sequences otherwise deleted by the Neo insertion (present only in control): TTTAGGAGATCAAACCGAATGAGAACATC.
- (ii) pgk-2 antisense primer complementary to sequences within the Neo insertion (present in c-Rel/ only): GCCTGCTCTTTACTGAAGGCTCTTTAC.
PCR conditions were as follows: 30 cycles containing 94°C for 1 min, 62°C for 1.5 min, 72°C for 1.5 min, MgCl2 concentration 2.0 mM.
When three primers are used concomitantly in the PCR reaction a 440 bp band is generated for c-Rel/ and/or a 387 bp band for control.
3'
ETg
DNA samples, extracted from mouse tail tissue, were subjected to PCR analysis for determination of 3'
ETg homozygosity using the following primers:
- (i) P2 sense primer hybridizing to the sequences near EcoRV site downstream of the StuIStuI 3'
E enhancer fragment: TGGTACTGATATCTGAGCCC.
- (ii) P3 antisense primer hybridizing to the sequences near the beginning of the second exon in the hß-globin gene: CAGGTGCACCATGGTGTC.
- (ii) P3 antisense primer hybridizing to the sequences near the beginning of the second exon in the hß-globin gene: CAGGTGCACCATGGTGTC.
PCR conditions were as follows: 30 cycles containing 94°C for 1 min, 63°C for 2 min, 72°C for 2.5 min, MgCl2 concentration 2.5 mM.
A 560 bp band is generated in DNA samples containing the 3'
ETg. A semiquantitative analysis was performed using GAPDH as a control to detect mice homozygous for the transgene. Homozygosity was confirmed by genotypic analyses of subsequent interbreedings.
Detection of hß-globin gene expression by RT-PCR
PCR primers were constructed based on available hß-globin gene sequence (gene bank access no. V00497).
- Sense primer: ACCCAGAGGTTCTTTGAGTC (165184).
- Anti-sense primer: ATTAGCCACACCAGCCACCA (451470).
- Product size 306 bp.
- Conditions used for RT-PCR have been described elsewhere (21). The relative density of the bands were analyzed using the Molecular Analyst computer software (BioRad, Hercules, CA).
Preparation of B cells, reagents and culture medium
Resting B cells were prepared from mouse splenocytes as previously described (19). Briefly, spleen cells were depleted of T cells by rat anti-mouse Thy-1 mAb (3H11) and complement followed by centrifugation on a discontinuous Percoll gradient. Resulting cells were >90% resting B cells. LPS serotype 0111:B4, phenol-extracted was purchased from Sigma (St Louis, MO). Dextran-conjugated H
a/1 and AF3 antibodies (
-dex) were prepared by conjugation of the respective mAb to high mol. wt dextran (2x106 mol. wt) as previously described (24). A membrane-bound preparation of CD40L (mCD40L) was prepared from Sf9 insect cells infected with a CD40L-containing recombinant baculovirus vector and was a kind gift from Dr Marilyn Kehry (Boehringer Ingelheim, Ridgefield, CT). Recombinant murine IL-4 was a kind gift from Dr Alan Levine (Case Western Reserve University School of Medicine, Cleveland, OH). RPMI 1640 (Biofluids, Rockville, MD) supplemented with 10% FBS (Sigma, St Louis, MO), L-glutamine (2 mM), 2-mercaptoethanol (0.05 mM), penicillin (Gibco, Grand Island, NY) (50 mg/ml) and streptomycin (Gibco) (50 µg/ml) was used for culturing cells.
| Results and discussion |
|---|
|
|
|---|
The 3'
E-hs1,2 contains binding sites for NF-
B/p50 and NF-
B/c-Rel (15). Using a 3'
E-hsl,2 reporter construct transfected into a plasmacytoma line, it was demonstrated that the
B binding site contributes to at least 50% of the activity of this enhancer (15). However, no studies have addressed the role of individual NF-
B members in 3'
E regulation, whether NF-
B regulates 3'
E activity in normal B lymphocytes and whether the role of NF-
B in 3'
E regulation is dependent upon the manner in which the B cell is activated. To address these questions we performed serial crosses between mice homozygous for a transgene containing the core 3'
E-hsl,2 enhancer, which was placed 128 bp upstream of the hß-globin basal promoter and gene (10), and mice made genetically deficient in either p50 (17) or c-Rel (18). The transcriptional activity of the hß-globin gene is weak unless coupled to a strong regulatory element. Through genotyping (see Methods) we identified mice which were both homozygous for the 3'
E-hs1,2Tg and which were either p50/ or c-Rel/ (Fig. 1
|
In initial studies, purified resting B cells from 3'
E-hsl,2Tg mice (wild-type for NF-
B) were stimulated in vitro with LPS or with CD40L + IL-4 and RNA was obtained from such cultures, 04 days after activation, for quantitation of hß-globin mRNA by RT-PCR. RT-PCR analysis of GAPDH mRNA was performed as a control. The relative level of hß-globin mRNA was expressed as the ratio of the relative band density of hß-globin/GAPDH for each sample. PCR analysis of serial 2-fold dilutions of cDNA samples revealed a direct linear relationship between the quantity of cDNA and the density of the signal within the range of cDNA used in these studies, allowing us to accurately detect 2-fold changes. We confirmed results from Arulampalam et al. (10) that the level of hß-globin mRNA in resting B cells is up-regulated after activation (data not shown). Optimal induction was observed 3 days after activation, with similar levels also seen on day 4. Levels of hß-globin mRNA in B cells activated for 3 days with either LPS or CD40L + IL-4 were generally 3- to 4-fold higher than those seen in resting B cells. Thus, day 3 in vitro-activated B cells were used in all subsequent studies.
Resting B cells from p50/ and c-Rel/ mice exhibit both distinct and overlapping functional deficits in proliferation, maturation to Ig secretion, and both germline CH transcription and recombination depending upon the nature of the stimuli used for activation (1723). We therefore wished to determine the level of expression of 3'
E-hsl,2 after optimal activation with LPS, through membrane Ig cross-linking, using dextran-conjugated anti-IgD antibodies (
-dex), and/or through CD40 using membrane CD40L, in the presence or absence of the growth and class switch-promoting cytokine IL-4. B cells activated with LPS, or through CD40, as well as membrane Ig, all have been shown to contain nuclear p50 and c-Rel (2527). In addition, the combination of CD40 and IL-4 activation has been shown to be synergistic for NF-
B induction (28). Purified resting B cells from 3'
E-hsl,2Tg mice expressing wild-type NF-
B were directly compared with transgenic mice lacking either p50 (p50/) or c-Rel (Rel/) for hß-globin mRNA expression as an indicator of 3'
E-hsl,2 activity. Resting p50/ and c-Rel/ B cells expressed similar levels of hß-globin mRNA as wild-type controls (data not shown). Of interest, normal resting B cells have been reported to lack detectable nuclear NF-
B, challenging observations reported by others (29). In three independent experiments, LPS-activated p50/ B cells exhibited >2-fold lower levels of hß-globin mRNA expression relative to LPS-activated wild-type B cells (P < 0.002) (Figs 2 and 3![]()
). By contrast, hß-globin mRNA expression in LPS-activated c-Rel/ cells was identical to wild-type controls. Addition of 
-dex to LPS-activated p50/ B cells caused a further significant reduction in hß-globin mRNA expression in p50/ B cells (P < 0.008), whereas it had no significant effect in LPS-activated c-Rel/ B cells. Of interest, in contrast to a previous report, using 3
E-hsl,2Tg mice, which demonstrated that µg/ml amounts of unconjugated anti-Ig antibodies, an amount that is required for optimal for B cell proliferation, could inhibit hß-globin mRNA expression in LPS-activated normal B cells (10), we observed no significant effect of ng/ml concentrations of 
-dex, also an amount optimal for B cell proliferation, on hß-globin mRNA expression in normal B cells activated with LPS (Figs 2 and 3![]()
). Addition of IL-4 to LPS-activated B cells led to a modest increase in hß-globin mRNA expression in p50/, but not c-Rel/ B cells, although this was not statistically significant.
|
|
Whereas normal B cells activated with CD40L alone proliferate only modestly, further addition of

-dex or IL-4 is synergistic (30). Thus p50/ and c-Rel/ B cells were directly compared with wild-type B cells for hß-globin mRNA expression after activation with CD40L + 
-dex or CD40L + IL-4 (Figs 2 and 3
-dex (P < 0.002) or CD40L + IL-4 (P < 0.02). By contrast p50/ B cells showed only a modest, though significant, reduction in hß-globin mRNA expression after CD40L + 
-dex activation (P < 0.04) and no significant differences in response to CD40L + IL-4. Collectively, the data, using optimal stimulating conditions, strongly suggest that both p50 and c-Rel can regulate 3'
E-hsl,2 activity in normal B cells in a positive manner, but that the relative roles of c-Rel and p50 in this regulation depend upon how the B cell is activated. We cannot rule out the possibility that differences in the relative expression patterns of 3'
E-hs1,2 in p50/ and c-Rel/ B cells might be observed using suboptimal stimulating conditions, but these were not addressed in this study.
These data are consistent with the conclusions of Michaelson et al. showing that the
B site within a 3'
E-hsl,2 enhancer construct accounts for ~50% of enhancer activity when transfected into a myeloma cell line (15). Specifically, since 3'
E-hs1,2Tg activity was up-regulated 3- to 4-fold after activation with either LPS or CD40L, and the absence of p50 or c-Rel resulted in up to 2-fold decreases in 3'
E-hs1,2Tg activity, depending upon the activator, our data also suggests that NF-
B action accounts for ~50% of enhancer activity in normal B cells. Of interest, 3'
E-hsl,2 activity in LPS- or CD40L-activated p50/ and c-Rel/ B cells did not directly correlate with the relative proliferative responses of these cells, since both p50/ and cRel/ B cells showed defective LPS- and CD40L-induced mitogenesis (data not shown, 1719). Both LPS- and CD40L-activated B cells have been shown to express nuclear p50 and c-Rel (2527). Thus, the reason for the differential, activator-dependent regulation of 3'
E-hs1,2 activity by p50 and c-Rel may lie in the differential expression of other NF-
B subunits and/or distinct induction profiles of other transcription factors in response to LPS versus CD40L, which may act in concert with NF-
B to regulate the 3'
E-hs,1,2 locus. Finally, since 3'
E-hs1,2 has been shown to act in concert with other 3'
E elements (12) and these members may also bind NF-
B subunits, the role of NF-
B in the activity of the intact 3'
E remains to be determined.
| Acknowledgments |
|---|
We thank Dr Sven Petterson (Karolinska Institute, Stockholm, Sweden) for 3'
E-hsl,2-hß-globin transgenic mice and Dr Steve Gerondakis (Walter and Eliza Hall Institute of Medical Research, Victoria, Australia) for c-Rel knockout mice. This work was supported by National Institutes of Health grant no. A132560. Opinions and assertions contained herein are the private ones of the authors and are not to be construed as official or reflecting the views of the Department of Defense or the Uniformed Services University of the Health Sciences. | Abbreviations |
|---|
| CD40L CD40 ligand |
| LPS lipopolysaccharide |
| Notes |
|---|
Transmitting editor: K. Takatsu
Received 29 February 2000, accepted 28 April 2000.
| References |
|---|
|
|
|---|
- Birshtein, B. K., Chen, C., Saleque, S., Michaelson, J. S., Singh, M. and Little, R. D. 1997. Murine and human 3' IgH regulatory sequences. Curr. Top. Microbiol. Immunol. 224:73.[ISI][Medline]
- Madisen, L. and Groudine, M. 1994. Identification of a locus control region in the immunoglobulin heavy-chain locus that deregulates c-myc expression in plasmacytoma and Burkitt's lymphoma cells. Genes Dev. 8:22 12.
-
Michaelson, J. S., Giannini, S. L. and Birshtein, B. K. 1995. Identification of 3'
-hs4, a novel Ig heavy chain enhancer element regulated at multiple stages of B cell differentiation. Nucleic Acids Res. 23:975.[Abstract/Free Full Text] -
Giannini, S. L., Singh, M., Calvo, C.-F., Ding, G. and Birshtein, B. K. 1993. DNA regions flanking mouse Ig 3'

0005T
enhancer are differentially methylated and DNAse I hypersensitive during B cell differentiation. J. Immunol. 150:1772.[Abstract]
-
Saleque, S., Singh, M., Little, R. D., Giannini, S. L., Michaelson, J. S. and Birshtein, B. K. 1997. Dyad symmetry within the 3' IgH regulatory region includes two virtually identical enhancers (C
3'E and hs3). J. Immunol. 158:4780.[Abstract]
- Dariavach, P., Williams, G. T., Campbell, K., Pettersson, S. and Neuberger, M. S. 1991. The mouse IgH 3'-enhancer. Eur. J. Immunol. 21:1499.[ISI][Medline]
-
Singh, M. and Birshtein, B. K. 1993. NF-HB (BSAP) is a repressor of the murine immunoglobulin heavy-chain 3'
enhancer at early stages of B-cell differentiation. Mol. Cell. Biol. 13:3611.[Abstract/Free Full Text] -
Grant, P. A., Arulampalam, V., Ahrlund-Richter, L. and Pettersson, S. 1992. Identification of ets-like lymphoid specific elements within the immunoglobulin heavy chain 3' enhancer. Nucleic Acids Res. 20:4401.
[Abstract/Free Full Text] -
Neurath, M. F., Strober, W. and Wakatsuki, Y. 1994. The murine Ig 3'
enhancer is a target site with repressor function for the B cell lineage-specific transcription factor BSAP (NF-HB, Sa-BP). J. Immunol. 153:730.[Abstract]
- Arulampalam, M., Grant, P. A., Samuelsson, A., Lendahl, U. and Pettersson, S. 1994. Lipopolysaccharide-dependent transactivation of the temporally regulated immunoglobulin heavy chain 3' enhancer. Eur. J. Immunol. 24:1671.[ISI][Medline]
- Grant, P. A., Andersson, T., Neurath, M. F., Arulampalam, V., Bauch, A., Muller, R., Reth, M. and Pettersson, S. 1996. A T cell controlled molecular pathway regulating the IgH locus: CD40-mediated activation of the IgH 3' enhancer. EMBO J. 15:6691.[ISI][Medline]
-
Ong, J., Stevens, S., Roeder, R. G. and Eckhardt, L. A. 1998. 3 IgH enhancer elements shift synergistic interactions during B cell development. J. Immunol. 160:4896.
[Abstract/Free Full Text] -
Gregor, P. D. and Morrison, S. L. 1986. Myeloma mutant with a novel 3' flanking region: loss of normal sequence and insertion of repetitive elements leads to decreased transcription but normal processing of the alpha heavy-chain gene products. Mol. Cell. Biol. 6:1903.
[Abstract/Free Full Text] -
Lieberson, R., Ong, J., Shi, X. and Eckhardt, L. A. 1995. Transcription of an immunoglobulin
2a gene ceases upon deletion of an enhancer region over 70 kilobases away. EMBO J. 14:6229.[ISI][Medline]
-
Michaelson, J. S., Singh, M., Snapper, C. M., Sha, W. C., Baltimore, D. and Birshtein, B. K. 1996. Regulation of 3' IgH enhancers by a common set of factors, including
B-binding proteins. J. Immunol. 156:2828.[Abstract]
-
Singh, M. and Birshtein, B. K. 1996. Concerted expression of an immunoglobulin heavy chain 3'
enhancer, 3'
E(hsl,2). Proc. Natl Acad. Sci. USA 93:4392.[Abstract/Free Full Text] -
Sha, W. C., Liou, H.-C., Tuomanen, E. I. and Baltimore, D. 1995. Targeted disruption of the p50 subunit of NF-
B leads to multifocal defects in immune responses. Cell 80:321.[ISI][Medline]
-
Kontgen, F., Grumont, R. J., Strasser, A., Metcalf, D., Ruili, L., Tarlington, D., Gerondakis, S. 1995. Mice lacking the c-rel proto-oncogene exhibit defects in lymphocyte proliferation, humoral immunity, and interleukin-2 expression. Genes Dev. 9:1965.
[Abstract/Free Full Text] -
Snapper, C. M., Zelazowski, P., Rosas, F. R., Kehry, M. R., Ming, T., Baltimore, D. and Sha, W. C. 1996. B cells from p50/NF-
B knockout mice have selective defects in proliferation, differentiation, germ-line CH transcription, and Ig class switching. J. Immunol. 156:183.[Abstract]
-
Snapper, C. M., Rosas, F. R., Zelazowski, P., Moorman, M. A., Kehry, M. R., Bravo, R. and Weih, F. 1996. B cells lacking RelB are defective in proliferative responses but undergo normal B cell maturation to Ig secretion and Ig class switching. J. Exp. Med. 184:1537.
[Abstract/Free Full Text] - Zelazowski, P., Carrasco, D., Rosas, F. R., Moorman, M. A., Bravo, R. and Snapper, C. M. 1997. B cells genetically deficient in the c-Rel transactivation domain have selective defects in germline CH transcription and Ig class switching. J. Immunol. 159:3133.[Abstract]
-
Caamano, J. H., Rizzo, C. A., Durham, S. K., Barton, D. S., Raventos-Squarez, C., Snapper, C. M. and Bravo, R. 1998. Nuclear factor (NF)-
B2 (p100/p52) is required for normal splenic microarchitecture and B cell-mediated immune responses. J. Exp. Med. 187:185.[Abstract/Free Full Text] -
Horwitz, B. H., Zelazowski, P., Shen, Y., Wolcott, K. M., Scott, M. L., Baltimore, D. and Snapper, C. M. 1999. The p65 subunit of NF-
B is redundant with p50 during B cell proliferative responses, and is required for germline CH transcription and class switching to IgG3. J. Immunol. 162:1941.[Abstract/Free Full Text] - Brunswick, M., Finkelman, F. D., Highet, P. F., Inman, J. K., Dintzis, H. M. and Mond, J. J. 1988. Picogram quantities of anti-Ig antibodies coupled to dextran induce B cell proliferation. J. Immunol. 140:3364.[Abstract]
-
Lin, S.-C., Wortis, H. H. and Stavnezer, J. 1998. The ability of CD40L, but not lipopolysaccharide, to initiate immunoglobulin switching to immnoglobulin G1 is explained by differential induction of NF-
B/Rel proteins. Mol. Cell. Biol. 18:5523.[Abstract/Free Full Text] -
Francis, D. A., Sen, F., Rice, N. and Rothstein. T. L. 1998. Receptor-specific induction of NF-
B components in primary B cells. Int. Immunol. 3:285.[Abstract/Free Full Text] - Neumann, M., Wohlleben, G., Chuvpilo, S., Kistler, B., Wirth, T., Serfling, E. and Schimpl, A. 1996. CD40, but not lipopolysaccharide and anti-IgM stimulation of primary B lymphocytes, leads to a persistent nuclear accumulation of relB. J. Immunol. 157:4862.[Abstract]
-
Jeppson, J. D., Patel, H. R., Sakata, N., Domenico, J. Terada, N. and Gelfand, E. W. 1998. Requirement for dual signals by anti-CD40 and IL-4 for the induction of nuclear factor-
B, IL-6, and IgE in human B lymphocytes. J. Immunol. 161:1738.[Abstract/Free Full Text] -
Yedidia, Y., Ben-Neriah, Y. and Jung, S. 1998. Primary B cells essentially lack constitutive NF-
B activity. Eur. J. Immunol. 28:30.[ISI][Medline]
- Snapper, C. M., Kehry, M. R., Castle, B. E. and Mond, J. J. 1995. Multivalent, but not divalent, antigen receptor crosslinkers synergize with CD40 ligand for induction of Ig synthesis and class switching in normal murine B cells. J. Immunol. 154:1177.[Abstract]
This article has been cited by other articles:
![]() |
C. A. Heckman, T. Cao, L. Somsouk, H. Duan, J. W. Mehew, C.-y. Zhang, and L. M. Boxer Critical Elements of the Immunoglobulin Heavy Chain Gene Enhancers for Deregulated Expression of Bcl-2 Cancer Res., October 15, 2003; 63(20): 6666 - 6673. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Zhang Accessibility control and machinery of immunoglobulin class switch recombination J. Leukoc. Biol., March 1, 2003; 73(3): 323 - 332. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Laurencikiene, V. Deveikaite, and E. Severinson HS1,2 Enhancer Regulation of Germline {epsilon} and {gamma}2b Promoters in Murine B Lymphocytes: Evidence for Specific Promoter-Enhancer Interactions J. Immunol., September 15, 2001; 167(6): 3257 - 3265. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Damjanovich, L. Bene, J. Matko, A. Alileche, C. K. Goldman, S. Sharrow, and T. A. Waldmann Preassembly of interleukin 2 (IL-2) receptor subunits on resting Kit 225 K6 T cells and their modulation by IL-2, IL-7, and IL-15: A fluorescence resonance energy transfer study PNAS, November 25, 1997; 94(24): 13134 - 13139. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






