Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (46)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Ban, E.
Right arrow Articles by Riveau, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ban, E.
Right arrow Articles by Riveau, G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 12, No. 6, 737-745, June 2000
© 2000 Japanese Society for Immunology

CpG motifs induce Langerhans cell migration in vivo

Elisabeth Ban, Loïc Dupré, Emmanuel Hermann, Wolfgang Rohn, Catherine Vendeville, Brigitte Quatannens1, Paola Ricciardi-Castagnoli2, André Capron and Gilles Riveau

INSERM U167 and
1 CNRS URA 1160, Institut Pasteur de Lille, 59019 Lille Cedex, France
2 Department of Biotechnology Science, University of Milano Biococca, Milan 20126, Italy

Correspondence to: E. Ban


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Cytosine–guanosine (CpG) oligonucleotide (CpG-oligo) sequences are immunostimulatory motifs that are present in bacterial DNA and their presence in plasmids might contribute to the immune response generated by DNA vaccination. The cell targets of CpG motifs in vivo have not been characterized yet. In this report we assessed the in vivo effects of CpG motifs on Langerhans cells (LC) migration. We showed that intradermal injection of 10 µg of CpG-containing oligonucleotides in mouse ear induced the local depletion of LC within 2 h of exposure as shown by CD11c and Ia immunohistological staining. To demonstrate that LC depletion was due to LC migration, CpG oligonucleotides were injected into the explants ex vivo, and the CD11c+ cells emigrating from the cultured isolated skin within medium were evaluated by immunostaining and FACS analysis. Our findings demonstrate that CpG motifs induce LC/dendritic cell (DC) migration out of the skin. To assess whether CpG motifs may act directly on LC/DC to induce their emigration we next analyzed the effects of CpG motifs in vitro on the expression of adhesion molecules involved in LC/DC migration. The results of these experiments show that {alpha}6 integrins, E-Cadherin, ICAM-1, CD11b and CD11c were differentially regulated upon CpG-oligo treatment of immortalized DC. CpG treatment (10 µg/ml for 8 h) resulted in a 100% increase in ICAM-1 staining intensity, a 50% decrease in E-Cadherin staining and a 25% decrease in {alpha}6 integrins staining, while no changes in the levels of CD11b and CD11c expression were recorded. Changes in adhesion molecule expression were mirrored by concomitant changes in the cell morphology that included cell depolarization, the appearance of filopods and loss of adherence. This study provides the first in vivo evidence that CpG motifs signal the migration of LC from the epidermis.

Keywords: adhesion molecules, CpG motifs, DNA vaccine, Langerhans cell, migration


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Bacterial DNA possesses immunostimulatory properties that are not shared with eukaryotic DNA (1). This was first established by the work of Tokunaga et al. showing that the anti-tumoral properties of mycobacteria extracts were due to nucleic acid compounds (2). The bioactive molecular entities were identified as being palindromic nucleotide sequences containing a cytosine–guanosine (CpG) core (3). These sequences are expressed at a high frequency in non-vertebrate DNA but are rare in vertebrate DNA (46). In addition the CpG sequences are largely methylated in eukaryotes while they are unmethylated in bacteria. These observations led to the hypothesis that immune activation by unmethylated CpG motifs is part of the innate immune defense mechanisms triggered by structural patterns present in microbes (7,8).

Selected synthetic oligonucleotides containing unmethylated CpG motifs (CpG-oligo) possess the same immunoregulatory properties as bacterial DNA. In vitro, CpG-oligo directly activate splenocytes, monocytes, macrophages and dendritic cells to secrete a variety of cytokines, such as IFN-{gamma} (3), IL-1ß (9,10), tumor necrosis factor (TNF)-{alpha} (11), IL-18 (12) and IL-12 (10,13,14), and activate B cells for IL-6 secretion and proliferation (15). In vivo, systemic injection of CpG-oligo was shown to promote NK activity (3), to increase the B cell percentage in the spleen (7), and to increase IFN-{gamma} (1), IL-6 (15), TNF-{alpha} (16) and IL-12 (17) plasma levels or mRNA expression in tissues. In addition to their effect on non-specific immunity, CpG-oligo were shown to potentiate the specific immune responses to co-injected antigens (1821). The presence of CpG motifs in plasmid DNA may contribute significantly to the immune response generated by DNA vaccination, thereby acting as internal adjuvants (22). Overall, CpG motif injection induces Th1 cytokine production (23,24), thereby promoting not only cytotoxic T cell responses (18,25) but also enhancing the production of Ig (17,19).

The immunoregulatory effects of CpG-oligo, or CpG- containing plasmid DNA, described so far in vivo are long-term effects that may result from intricate cascades of events. What steps of the immune response are directly regulated by CpG and which cells are targeted by these motifs in vivo is not known yet. The present study focuses on the immediate effects of CpG motifs in vivo. We studied CpG activity on cells of the dendritic cell (DC) lineage that represent the key cellular component involved in the onset of the primary immune response to antigens. In the skin, immature DC are represented by Langerhans cells that are induced to migrate to lymph nodes upon activation by allergens, lipopolysaccharide or cytokines (26). Since LC migration is known to be a crucial event in the initiation of cutaneous immune responses (27) we evaluated the ability of CpG motifs to trigger the migration of these cells from the skin. We report that intradermal CpG-oligo injection induces the depletion of LC in the epidermis within 2 h. Using skin explant cultures we show that this depletion is due to LC emigration from the epidermis. In addition, results of in vitro experiments show that CpG oligonucleotides act directly on LC to induce the regulation of cell surface adhesion molecules involved in LC mobilization and translocation through the extracellular matrix. These studies demonstrate that CpG motifs trigger one of the earliest events of innate immunity, mobilizing cells which are determinant in responses to the entry of pathogens and antigens. Thereby, our study contributes to the concept that unmethylated CpG motifs may represent a microbial signal to the immune system.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Mice
BALB/c mice, 6–8 weeks old, were purchased from Iffa Credo (L'Arbresle, France) and kept in specific pathogen-free units.

Antibodies and reagents
Biotinylated antibodies used for immunostaining and immunofluorescent stainings were purchased from PharMingen (San Diego, CA) except for the anti-E-Cadherin antibody (Tebu, Le Perray en Yvelines, France) that was detected with an FITC-labeled rabbit anti-goat IgG antibody (Southern Biotech, Birmingham, AL). FITC-labeled phalloidin was purchased from Sigma (St Louis, MO) and FITC–streptavidin was from Zymed (San Francisco, CA). Phosphothioate oligonucleotides (TGCTAGTTCCATAACGTTCCTGATGCTTAC and TGCTAGT- TCCATAAGCTTCCTGATGCTTAC) were from Genset (Paris, France). Detection of endotoxin was achieved using the Limulus amebocyte lysate assay (BioWhittaker, Walkersville, MD). No endotoxin could be detected in the oligonucleotides (<0.05 EU/ml). Recombinant sterile mouse TNF-{alpha} (Boehringer Mannheim, Hamburg, Germany) had a sp. act. of 4x108 U/mg (1 U being equivalent to the amount of TNF-{alpha} that is required to mediate half-maximal cytotoxicity with WEHI 164 cells).

Histochemical staining of LC in epidermal sheets
Mice were anesthetized with pentobarbital and inoculated in the ear with 10 µg of oligonucleotides or with 20ng of rTNF-{alpha} using lancets for the prick test (Bayer, Leverkusen, Germany). After 2 h ears were cut and separated into dorsal and ventral leaflets with a forceps. Dorsal leaflets were fixed to slides with dermatome tape (3M, St Paul, MN) and incubated with 3.8% ammonium thiocyanate for 20 min at 37°C (28). The dermis was removed with a forceps, and the slides were washed with PBS and fixed in ice-cold acetone for 10 min. Staining was performed overnight at 4°C with anti-Iab,d or anti-CD11c (1/50) in PBS/0.5% ovalbumin after saturation with 5% normal goat serum for 30 min. Slides were mounted with Immunofluore mounting medium (ICN, Orsay, France) and examined immediately.

Detection of apoptosis
Apoptosis in vivo was assessed by the DNA terminal transferase nick-end translation method (TUNEL) using the APO-BRDU kit (PharMingen) and adapted for histological preparation. Epidermal sheets were prepared as described previously and slide-mounted tissues were fixed with 1% (w/v) paraformaldehyde in PBS for 15 min. on ice. Tissues were treated with saponin 0.5% in PBS containing 0.2% BSA for 30 min on ice. Slides were washed 2x10 min in ice-cold PBS and fixed in ice-cold 70% ethanol for 30 min. Sections were washed 3x10 min in PBS and treated for 60 min at 37°C with DNA labeling solution containing terminal deoxynucleotidyl transferase and BrdU prepared according to the manufacturer's instructions. Sections were washed 2 times in rinse solution and incubated with FITC-labeled anti-BrdU antibody solution for 30 min at room temperature. Sections were then washed 3x10 min in PBS and mounted with Immunofluore.

Skin explant assay
Epidermal sheets were prepared from naive mice, and dorsal ear halves were put into six-well plates and inoculated with oligonucleotides. After 30 min the culture wells were carefully filled with 2 ml of Iscove's medium containing 10% bovine serum and explants were cultured for 13 h while floating on the medium. Cells migrating into the culture medium were recovered by centrifugation at 800 g for 10 min, counted and analyzed by FACS for CD11c, MAC-1 or Ly-6G expression on the large granular cell gate.

Flow cytometry
Epidermal LC and fetal skin DC cells (29) were analyzed for the expression of various cell surface molecules by dual-color immunofluorescent staining with antibodies for CD11c, ICAM-1, E-Cadherin and {alpha}6 integrin (clone GoH3). Cell viability was assessed using propidium iodide. Adherent cells were detached from the plastic by treatment with 3 mM EDTA (10 min at 20°C). Staining was performed for 30 min on ice with 1 or 2 µg of the various antibodies for 5x106 cells in PBS containing 10% heat-inactivated rat serum. Cells were washed with 3 ml PBS and incubated with streptavidin–FITC (1/1000) for 20 min on ice. When GoH3 was used as the first-step reagent, binding was detected by FITC-labeled rabbit antibody anti-goat Ig (1 mg for 5x106 cells). Cells were washed and resuspended in PBS containing 10% serum and 10 µg/ml propidium iodide. Flow cytometry was performed using a FACSCalibur (Becton Dickinson). Cells were gated for size and scatter to exclude debris, and dead cells were excluded by gating on the propidium-negative cell population.

Phalloidin–FITC staining
Fetal skin DC were seeded on glass coverslips and cultured overnight to 50% confluence. Cells were treated with the oligonucleotides for 2–18 h and fixed for 15 min in 4% paraformaldehyde on ice. Fixed cells were washed 3 times with PBS containing 10mM glycine, 0.1mM MgCl2 and 0.1 mM CaCl2, and permeabilized for 30 min with 0.5% saponin in PBS/0.2% BSA. Cells were stained with FITC-labeled phalloidin (10 µg/ml) in PBS for 30 min, washed 3x10 min with PBS and mounted with Immunofluore mounting medium for observation.

Adhesion assay
Cells were cultured in six-well plates and treated for 48 h with increasing doses of oligonucleotide. After 48 h of incubation the culture medium was removed and cells were further incubated with 2 ml PBS for 10 min at room temperature. Non-adherent cells in the culture medium and cells detaching themselves from the plastic after PBS incubation were pooled and recovered by centrifugation. Cell number and viability was then assessed by Trypan blue exclusion.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
CpG-oligo induce LC depletion from the skin
To study the effect of CpG motifs on the initiation of a cutaneous immune response we analyzed their ability to induce LC activation and the development of migratory DC. The effect of CpG motifs on LC migration was studied in vivo by intradermal inoculation of 10 µg of either a CpG-containing oligo (CpG-oligo) or a control inverted oligo (GpC-oligo) in the mouse ear. Epidermal sheets were then prepared and the number of epidermal LC still present in the area of the injection was determined by immunostaining of the tissues with an anti-Ia (Fig. 1Go) antibody or an anti-CD11c antibody (data not shown). In control tissues Ia+ cells were organized in a regular network of interdigitated cells typical of LC morphology (Fig. 1A and BGo). Two hours after a single injection of CpG-oligo, the number of Ia+ cells in the epidermis was reduced by 57% (Fig. 1CGo) compared to control tissue from the non-injected ear (Fig. 1DGo) and to tissues inoculated with PBS (Fig. 1AGo) or with the inverted oligonucleotide (Fig. 1FGo). Similarly depleted areas were observed in TNF-{alpha}-treated samples used as a positive control (Fig. 1EGo). Quantification of Ia+ cells showed that CpG-oligo treatment was as potent as TNF-{alpha} in inducing Ia+ cell depletion in the epidermis layer (Table 1Go). The depletion of Ia+ cells was not due to cytotoxic effects of CpG on LC because TUNEL staining of epidermal sheets showed that there were essentially no apoptotic cells present in situ 2 h after CpG injection (Fig. 2AGo) except for the hair bundle dermal cells (Fig. 2BGo) that continuously undergo apoptosis (30). The results of these experiments indicate that the CpG-oligo has a profound sequence-specific effect on the density of Ia+ cells in the skin.



View larger version (64K):
[in this window]
[in a new window]
 
Fig. 1. In situ immunostaining of LC after in vivo treatment with CpG-oligo. Mice were inoculated in one ear with saline buffer (A and B), 10 µg of CpG-oligo (C), 20 ng of rTNF-{alpha} (E) or 10 µg of control oligonucleotide (F). For all mice the second ear was not treated and used as an internal control (D shows the control ear of an CpG-injected mouse). Two hours after inoculation epidermal sheets were prepared, mounted on slides and fixed. LC were stained in whole mounted tissues for Ia expression using indirect immunohistofluorescent staining. Original magnifications: x500 (A and C–F) and x1250 (B).

 

View this table:
[in this window]
[in a new window]
 
Table 1. CpG-oligo induce Ia+ cells depletion in the epidermis
 


View larger version (53K):
[in this window]
[in a new window]
 
Fig. 2. Detection of apoptotic cells in CpG-treated skin. Mice ears were inoculated with CpG-oligo (10 µg). After 2 h epidermal sheets were prepared, mounted on slides and double-fixed as described in Methods. LC were stained by TUNEL using BrdU and FITC-labeled anti-BrdU immunohistofluorescent staining. No apoptotic cells were observed in the epidermal sheets (A), except for the hair bundle dermal cells (B). Magnification: x500.

 
CpG-oligo induce LC migration from the epidermis
The rapid depletion of LC induced in the skin by CpG-oligo treatment in vivo suggested that CpG motifs may induce LC migration from the epidermis. To confirm this hypothesis we used whole organ skin explants that were inoculated ex vivo and then cultured in tissue culture medium. Cells migrating out of the epidermis were collected in the medium and DC were identified by CD11c staining and FACS analysis (Fig. 3A and BGo) to distinguish them from cells of the monocytic lineage present in the dermis (31). CD11c was also chosen because its expression is not regulated by CpG-oligo in vitro (see Fig. 6DGo). The results of these ex vivo experiments showed that inoculation of CpG-oligo (10 µg) induced an increase from 5 ± 1.2 to 36 ± 2.4% of CD11c+ cells in the skin explant culture medium (Fig. 3AGo) while the reversed control oligo had no effect (Fig. 3BGo). The amount of CD11c+ cells within the pool of migrating cells was evaluated by using the results from FACS analysis. This analysis showed that CpG-oligo treatment increased by 3.8-fold the amount of CD11c cells migrating from the explants while TNF-{alpha} induced a 9.5-fold increase. In addition, CpG motifs were as effective as TNF-{alpha} in the induction of cell migration from the skin explants since the total number of cells recovered in the culture medium was markedly increased upon CpG treatment and comparable to the amount of cells recovered after TNF-{alpha} treatment (Fig. 3CGo). The pool of non-CD11c cells that was induced to migrate by CpG-oligo treatment comprised MAC-I+ cells of the monocytic lineage and Ly-6G+ of the neutrophilic lineage (Table 2Go) while TNF-{alpha} treatment was ineffective on Ly-6G+ cells.



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 3. Effect of CpG-oligo on the migration of epidermal LC in whole organ cultures. Skin explants were prepared from naive mice and epidermal sheets were inoculated in vitro with CpG- or control-oligo (10 µg) or TNF-{alpha} (20 ng). Migrating cells in the culture medium were recovered by centrifugation after 13 h of incubation and migrating DC were identified by the expression of CD11c. Histograms show the expression of CD11c (solid line) in comparison with isotype-matched control (shaded area) for explants treated with CpG- (A) or control- (B) oligo. Bar diagrams show the effect of CpG versus TNF-{alpha} treatment on the total amount of migrating cells (C) and the percentage of CD11c+ cells (D). *P < 0.001 by Student's t-test (n = 3).

 


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 6. Regulation of adhesion molecules after exposure of fetal skin DC to CpG-oligo. Fetal skin DC were incubated for 18 h with 10 µg/ml of CpG-oligo (solid lines), control GpC-oligo (dotted lines) or without oligonucleotide (gray area). Cells were stained with anti-ICAM-1 antibody (A), anti-{alpha}6 integrins antibody (B), anti-E-Cadherin antibody (C), anti-CD11b (D), anti-CD11c (E) or IgG2a isotype matched controls (F is the control for ICAM-1, {alpha}6 integrins CD11c staining). Theses profiles are representative of six separate experiments.

 

View this table:
[in this window]
[in a new window]
 
Table 2. CpG-oligo induce cell emigration from skin explants
 
Together with the in vivo data showing local depletion of LC upon CpG inoculation, these observations are consistent with the hypothesis that CpG motifs promote the migration of LC from skin epidermis.

CpG oligonucleotides induce a DC migratory phenotype in vitro
LC/DC migration requires the sequential rearrangement of both surface adhesion molecules and the actin-based cytoskeleton. The direct effects of CpG motifs on LC activation in migratory DC was assessed in vitro. Because murine LC spontaneously mature in culture (32,33) these experiments were performed on immortalized immature DC cultures that mature in vitro when stimulated with different inflammatory stimuli and bacteria products such as lipopolysaccharide (29). The effect of CpG on early cytoskeleton rearrangements involved in the acquisition of migratory properties was tested by histofluorescent staining of CpG-treated cells with FITC–phalloidin. While most of the cells in untreated cultures were polarized with one or two pseudopod-like membrane expansions and displayed discrete actin aggregates (Fig. 4AGo), cells treated with 1 µM of CpG for 18 h underwent profound changes in morphology characterized by the loss of polarization, the development of numerous filopod-like dendrites and subcorticol actin aggregates (Fig. 4BGo). Conversely, cells treated with the inverted GpC-oligo did not demonstrate any morphological changes (Fig. 4CGo). Furthermore, the observed cytoskeleton rearrangements correlated with loss of adherence. This was first observed by histology after 48 h of incubation with CpG-oligo. Histological preparations revealed large areas of missing cells with only free filopods stained by the FITC–phalloidin (Fig. 4DGo). Cell disappearance was shown to result from loss of adherence of viable cells and not cell death. To show this cultures were treated for 48 h with CpG-oligo and cells present in the supernatant, or detaching after 10 min of incubation in PBS, were pooled and the number of non-adherent viable cells recovered was assessed under microscopy after Trypan blue exclusion staining. The results of these experiments showed that CpG motifs act on cell adhesion in a dose-dependent manner (Fig. 5Go) inducing a 2.3-fold increase in the number of non-adherent cells, whereas unstimulated cultures required incubation with EDTA to induce their detachment.



View larger version (69K):
[in this window]
[in a new window]
 
Fig. 4. Effect of CpG-oligo treatment on the morphology of DC in vitro. Fetal skin DC were grown onto coverslips (A) and treated for 18 h with 10 µg/ml of CpG-oligo (B) or GpC-oligo (C). Cells were fixed and cytoskeleton modifications were visualized by phalloidin–FITC staining of F-actin. After 48 h of treatment with CpG-oligo the cells lost adherence to the coverslips leaving filopods that were stained with phalloidin–FITC (D). Magnification: x750.

 


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 5. Effects of CpG-oligo on cell adhesion to the culture plate. Fetal skin DC were treated for 48 h with increasing doses of CpG-oligo. Non-adherent cells (closed squares) recovered in the culture medium, and in PBS after 10 min of incubation, were counted and viability determined by Trypan blue exclusion of dead cells (open circles). This graph is representative of three experiments.

 
Altogether these results show that CpG motifs induce the profound phenotypic changes that are associated with DC maturation in migrating cells.

CpG-oligo regulate the expression of adhesion molecules
As LC migrate they dissociate themselves from keratinocytes, cross the underlying basement membrane into the dermis and enter the afferent lymphatics. Each of these steps is regulated by various adhesion molecules that include E-Cadherin (34), {alpha}6 integrin (VLA-6 CD49f) (35) and ICAM-1 (36). Therefore, we next assessed whether CpG-oligo regulated the expression of adhesion molecules involved in DC mobilization. In our experiments, unstimulated cells expressed an intermediate level of {alpha}6 integrin and E-Cadherin, and a high level of ICAM-1 (Fig. 6Go). Stimulation with CpG-oligo for 18 h resulted in a 98% increase in ICAM-1 levels (Fig. 6AGo and Table 2Go), and a decrease of 38 and 23% in E-Cadherin and {alpha}6 integrin levels respectively (Fig. 6B and CGo, and Table 3Go), while the levels of CD11b and CD11c (Fig. 6D and EGo) remained unchanged. Theses results suggest that adhesion molecules that are involved in DC retention in the skin, E-Cadherin and {alpha}6 integrin, are down-regulated by CpG. In contrast, ICAM-1 that is involved in trans-endothelial migration and antigen presentation by mature DC is up-regulated by CpG motifs (36,37). Therefore, CpG motifs induce the coordinated regulation of several adhesion molecules which is part of the acquisition of the mature migratory DC phenotype. Kinetic studies showed that ICAM-1 surface expression was slightly decreased between 30 min and 1h of incubation and increased after 2 h (Fig. 7AGo). Compared to ICAM-1, changes in the surface expression of E-Cadherin and {alpha}6 integrins were delayed, and the decrease was first observed after 4 and 5 h of stimulation respectively (Fig. 7B and CGo). Altogether, these results suggest that one of the earliest events in LC activation by CpG-oligo is the specific regulation of adhesion molecule surface expression.


View this table:
[in this window]
[in a new window]
 
Table 3. CpG-oligo regulate adhesion molecules expression
 


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 7. Kinetic study of adhesion molecule regulation by CpG-oligo. Fetal skin DC were treated with 10 µg/ml of CpG-oligo for increasing lengths of time, and the expression of ICAM-1 (A) E-Cadherin (B) and {alpha}6 integrins (C) was measured by immunostaining and flow cytometry analysis. Each point is the mean ± SD of n = 3 separately treated cultures. An asterisk indicates the first point in the kinetic which was significantly different from the control with P < 0.05 by Student's t-test (n = 3).

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The present study reveals one of the early effect of CpG motifs on the immune system. The results of our experiments on the skin identified an in vivo cellular target for CpG motifs immunostimulatory activity. In addition, this study shows that CpG topical application induces LC migration in the same manner as allergens or bacterial products, e.g. lipopolysaccharide. Therefore, CpG motifs not only act as immunomodulators, but may also initiate a crucial event of the induction of an immune response which is LC mobilization in the skin.

The depletion of LC observed in situ in the skin after CpG-oligo inoculation suggested that LC are induced to migrate out of the epidermis layer. However, the disappearance of Ia staining in the skin after CpG inoculation could be due to cytotoxicity or disappearance of Ia expression. Our combined results show that disappearance of Ia+ cells was not due to a cytotoxic effect or Ia expression regulation. First, the disappearance of Ia+ cells was extremely rapid and no apoptotic cells were detected in situ at the site of injection. Second, the effects observed were not attributable to the trauma resulting from the injection since treatment with PBS or with the inverted control GpC-oligo failed to cause similar changes. Third, MHC class II molecules are not down-regulated but rather up-regulated by CpG-oligo in vitro (our unpublished observation on D1 cells) (14,38). In addition, similar results were observed when tissues were stained with an anti-CD11c antibody and CD11c levels were not regulated by CpG-oligo treatment in vitro. Despite these data, the results of our studies do not directly demonstrate migration of DC. To further test this hypothesis, we showed that CpG-oligo induced a pool of migrating CD11c+ cells from the epidermis in skin organ cultures. Collectively, the results of these two independent experimental approaches show that CpG motifs induce LC migration.

Results of our in vitro study on CpG regulation of several adhesion molecules involved in LC/DC migration showed that stimulation with CpG motifs induced the differential regulation of E-Cadherin, {alpha}6 integrins and ICAM-1. Since adhesion molecule regulation is required for LC migration from the skin (35,39), these results suggest that CpG acts upon LC migration through molecular mechanisms that include regulation of the required adhesion molecules expression. Kinetic studies revealed that CpG motifs induce a transitory decrease in ICAM-1 cell surface levels which is followed by a progressive up-regulation, reaching the maximal surface expression at 12 h of stimulation. This pattern of ICAM-1 expression was recently shown to correlate with the acquisition of the migratory function by DC which shows a transitory decrease after 1 h of stimulation with lipopolysaccharide vitro (Granucci et al., submitted). In addition, in vivo studies showed that ICAM-1 is up-regulated on DC in the lymph nodes when compared to the LC in the skin, suggesting that, during migration from the skin, LC are induced to express increased levels of ICAM-1 (36). Therefore, ICAM-1 that mediates DC attachment to the endothelium (40) is likely to contribute to the migration of DC from non-lymphoid organs to lymphoid organ. Conversely, we showed that CpG-induced ICAM-1 up-regulation was paralleled by the decrease in E-Cadherin and {alpha}6 integrin surface expression. This stage of ICAM-1high, E-Cadherinlow, {alpha}6 integrinslow is observed after treatment for 4–6 h with CpG oligonucleotides and matches the change in migratory behavior of activated DC. Indeed, results of in vitro experiments show that E-Cadherin surface expression is decreased upon LC activation and suggest that LC loosen their E-Cadherin-mediated adhesive contact with surrounding keratinocytes before leaving the epidermis layer (34). Similarly, experiments on skin explant cultures showed that {alpha}6 integrin down-regulation is a crucial step of LC migration from the epidermis across the underlying basement membrane (35). Altogether, the differential regulation of adhesion molecules by CpG is consistent with our results showing that CpG is a strong inducer of LC migration in vivo. LC are believed to acquire their migratory function in non-lymphoid tissues upon stimulation by maturation stimuli. Therefore, our results suggest that CpG represent a maturation stimulus for LC in vivo. This hypothesis is supported by the recent in vitro findings that CpG is a more potent stimulus than GM-CSF for inducing human primary blood DC survival and maturation (41) and induces MHC class-II and co-stimulatory molecules up-regulation on DC (14,38).

Our findings that CpG-oligo are rapidly mobilizing skin LC in vivo provides insights into the early mechanisms of the induction of the immune response during DNA vaccination. Although studies employing bone marrow chimeras suggest that the antigen-presenting cells involved in the induction of immune responses to DNA vaccines are bone marrow derived, a definitive identification of the cell type involved in the onset of the response has not been achieved. Accumulating evidence indicates that DC present in the draining lymph nodes carry the plasmid and express the transfected antigen DNA (our unpublished observation) (42,43). In addition, grafting experiments showed that the immune response generated by DNA immunization is primed by cells that migrate rapidly from the site of plasmid administration (44). Altogether, these data led to the model in which skin DC are transfected by the DNA plasmid and rapidly migrate to the draining lymph node, where they express and present the antigen. In this report, we provide evidence that CpG motifs present in the plasmid backbone may represent the signal that triggers the rapid migration of LC/DC during DNA immunization.

In summary, the data in the present report indicate that exposure to CpG motifs can promote the very rapid migration of LC in vivo either directly or indirectly (e.g. by inducing cytokines). However, given the pleiotropic and apparently degenerate nature of cytokine activity, it may prove difficult to define individual cytokines that mediate LC migration in vivo. However, preliminary in vitro experiments using neutralizing anti-TNF-{alpha} antibodies showed that this cytokine was not involved in adhesion molecule regulation by CpG motifs (data not shown). Even though it is not clear if local exposure of physiologically relevant concentrations of CpG motifs from bacterial DNA during infection would induce LC migration, our results suggest that this event may represent a component of early host response to bacterial invasion.


    Acknowledgments
 
The authors are thankful to Bob LeBoeuf and Raymond Pierce for carefully reading the manuscript. This work received financial support from the European Economic Community contract BIO4CT96-0374. This study was also supported by the Institut National de la Santé et de la Recherche and by l'Institut Pasteur de Lille. E. B. was supported by the Fondation pour la Recherche Médicale.


    Abbreviations
 
CpG cytosine–guanosine
DC dendritic cell
LC Langerhans cell
TNF tumor necrosis factor

    Notes
 
Transmitting editor: S. H. E.Kaufmann

Received 20 August 1999, accepted 3 February 2000.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Yamamoto, S., Yamamoto, T., Kuramoto, E., Yano, O., Kataoka, T. and Tokunaga, T. 1992. DNA from bacteria but not from vertebrates, induces interferons, activates natural killer cells and inhibits tumor growth. Microbiol. Immunol. 36:983.[Web of Science][Medline]
  2. Tokunaga, T., Yamamoto, H., Shimada, S., Abe, H., Fukuda, T., Fujisawa, Y., Furutani, Y., Yano, O., Kataoka, T., Sudo, T., Makiguchi, N. and Suganuma, T. 1984. Antitumor activity of deoxyribonucleic acid fraction from Mycobacterium bovis, BCG. I. Isolation, physicochemical characterization, and antitumor activity. J. Natl Cancer Inst. 72:955.
  3. Yamamoto, S., Yamamoto, T., Kataoka, T., Kuramato, E., Kimura, Y., Yano, O. and Tokunaga, T. 1992. Unique palindromic sequences in synthetic oligonucleotides are required to induce IFN and augment IFN-mediated natural killer activity. J. Immunol. 148:4072.[Abstract]
  4. Bird, A. P. 1987. CpG islands as gene markers in vertebrate nucleus. Trends Genet. 3:342.[Web of Science]
  5. Doerfler, W. 1991. Patterns of de novo DNA methylation—evolutionary vestiges of foreign DNA inactivation as host defense mechanism. Biol. Chem. Hoppe-Seyler 372:557.[Web of Science][Medline]
  6. Burge, C., Campbell, A. M. and Karlin, S. 1992. Over- and under-representation of short oligonucleotides in DNA sequences. Proc. Natl Acad. Sci. USA. 89:1358.[Abstract/Free Full Text]
  7. Krieg, A. M., Yi, A.-K., Matson, S., Waldschmidt, T. J., Bishop, G. A., Teasdale, R., Koretzky, G. A. and Klinman, D. M. 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374:546.[Medline]
  8. Pisetsky, D. S. 1996. Immune activation by bacterial DNA: a new genetic code. Immunity 5:303.[Web of Science][Medline]
  9. Stacey, K. J., Matthew, J. S. and Hume, D. A. 1996. Macrophages ingest and are activated by bacterial DNA. J. Immunol. 157:2116.[Abstract]
  10. Lipford, G. B., Sparwasser, T., Bauer, M., Zimmermann, S., Koch, E.-S., Heeg, K. and Wagner, H. 1997. Immunostimulatory DNA: sequence-dependent production of potentially harmful or useful cytokines. Eur. J. Immunol. 27:3420.[Web of Science][Medline]
  11. Sparwasser, T., Miethke, T., Lipfrod, G., Borschert, K., Häcker, H., Heeg, K. and Wagner, H. 1997. Bacterial DNA causes septic shock. Nature 386:336.[Medline]
  12. Roman, M., Martin-Orozco, E., Goodman, J. S., Nguyen, M. D., Sato, Y., Ronaghy, A., Kornbluth, R. S., Richman, D. D., Carson, D. A. and Raz, E. 1997. Immunostimulatory DNA sequences function as T helper-1-promoting adjuvants. Nat. Med. 3:849.[Web of Science][Medline]
  13. Segal, B. M., Klinman, D. M. and Shevach, E. M. 1997. Microbial products induce autoimmune disease by an IL-12-dependent pathway. J. Immunol. 158:5087.[Abstract]
  14. Jakob, T., Walker, P. S., Krieg, A. M., Udey, M. C. and Vogel, J. C. 1998. Activation of cutaneous dendritic cells by CpG-containing oligodeoxynucleotides: a role for dendritic cells in the augmentation of Th1 responses by immunostimulatory DNA. J. Immunol. 161:3042.[Abstract/Free Full Text]
  15. Yi, A.-K., Klinman, D. M., Martin, T. L., Matson, S. and Krieg, A. M. 1996. Rapid immune activation by CpG motifs in bacterial DNA. J. Immunol. 157:5394.[Abstract]
  16. Sparwasser, T., Miethke, T., Lipford, G., Erdmann, A., Häcker, H., Heeg, K. and Wagner, H. 1997. Macrophages sense pathogens via DNA motifs: induction of tumor necrosis factor-{alpha} mediated shock. Eur. J. Immunol. 27:1671.[Web of Science][Medline]
  17. Zimmermann, S., Egeter, O., Hausmann, S., Lipford, G., Röcken, M., Wagner, H. and Heeg, C. 1998. CpG oligonucleotides trigger protective and curative Th1 responses in lethal murine leishmaniasis. J. Immunol. 160:3627.[Abstract/Free Full Text]
  18. Lipford, G. B., Bauer, M., Blank, C., Reiter, R., Wagner, H. and Heeg, K. 1997. CpG-containing synthetic oligonucleotides promote B and cytotoxic cell responses to protein antigen: a new class of vaccine adjuvant. Eur. J. Immunol. 27:2340.[Web of Science][Medline]
  19. Weiner, G. J., Liu, H.-M., Wooldridge, J. E., Dahle, C. E. and Krieg, A. M. 1997. Immunostimulatory oligonucleotides containing CpG motif are effective as immune adjuvant in tumor antigen immunization. Proc. Natl Acad. Sci. USA 94:10833.[Abstract/Free Full Text]
  20. Klinman, D. M., Yamshchikov, G. and Ishigatsubo, Y. 1997. Contribution of CpG motifs to the immunogenicity of DNA vaccines. J. Immunol. 158:3635.[Abstract]
  21. Leclerc, C., Dériaud, E., Rojas, M. and Whalen, R. G. 1997. The preferential induction of a Th1 immune response by DNA-based immunization is mediated by the immunostimulatory effect of the plasmid DNA. Cell. Immunol. 179:97.[Web of Science][Medline]
  22. Sato, Y., Roman, M., Tighe, H., Lee, D., Corr, M., Nguyen, M.-D., Silvermann, G. J., Lotz, M., Carson, D. A. and Raz, E. 1996. Immunostimulatory DNA sequences necessary for effective intradermal gene immunization. Science 273:352.[Abstract]
  23. Klinman, D., A-K., Y., Beaucage, S. L., Conover, J. and Krieg, A. M. 1996. CpG motifs expressed by bacterial DNA rapidly induce lymphocytes to secrete IL-6, IL-12, and INF-gamma. Proc. Natl Acad. Sci. USA 93:2879.[Abstract/Free Full Text]
  24. Chu, R. S., Targoni, O. S., Krieg, A. M., Lehmann, P. V. and Harding, C. V. 1997. CpG oligonucleotides act as adjuvants that switch on T helper 1 (Th1) immunity. J. Exp. Med. 186:1623.[Abstract/Free Full Text]
  25. Davis, H. L., Weeranta, R., Waldschmidt, T. J., Tygrett, L., Schorr, J. and Krieg, A. M. 1998. CpG DNA is a potent enhancer of specific immunity in mice immunized with recombinant Hepatitis B surface antigen. J. Immunol. 160:870.[Abstract/Free Full Text]
  26. Kimber, I., Dearman, R., Cumberbatch, M. and Huby, R. 1998. Langerhans cells and chemical allergy. Curr. Opin. Immunol. 10:614.[Web of Science][Medline]
  27. Wang, B., Fujisawa, H., Zhuang, L., Kondo, S., Shivji, G. M., Kim, C. S., Mak, T. W. and Saunder, D. N. 1997. Depressed Langerhans cells migration and reduced contact hypersensitivity response in mice lacking TNF receptor p75. J. Immunol. 159:6148.[Abstract]
  28. Juhlin, L. and Shelley, W. B. 1977. New staining techniques for Langerhans cell. Acta Dermatol. Venereol. 57:289[Web of Science][Medline]
  29. Girolomi, G., Lutz, M. B., Pastore, S., Abmann, C. U., Cavani, A. and Ricciardi-Castognoli, P. 1995. Establishment of a cell line with features of early dendritic cell precursors from fetal mouse skin. Eur. J. Immunol. 25:2163.[Web of Science][Medline]
  30. Paus, R. 1998. Principles of hair cycle control. J. Dermatol. 25:793.[Medline]
  31. Sato, K., Imai, Y. and Irimura, T. 1998. Contribution of dermal macrophage trafficking in the sensitization phase of contact hypersensitivity. J. Immunol. 161:6835.[Abstract/Free Full Text]
  32. Schuler, G. and Steinman, R. M. 1985. Murine epidermal Langerhans cells mature into potent immunostimulatory dendritic cells in vitro. J. Exp. Med. 161:526.[Abstract/Free Full Text]
  33. Shimada, S., Caughman, S. W., Sharrow, S. O., Stephany, D. and Katz, S. I. 1987. Enhanced antigen-presenting capacity of cultured Langerhans' cells is associated with markedly increased expression of Ia antigen. J. Immunol. 139:2551.[Abstract]
  34. Tang, A., Amagai, M., Granger, L. G., Stanley, J. R. and Udey, M. C. 1993. Adhesion of epidermal Langerhans cells to keratinocytes is mediated by E-cadherin. Nature 361:82.[Medline]
  35. Price, A. A., Cumberbatch, M. and Kimber, I. 1997. Alpha-6 Integrins are required for Langerhans cell migration from the epidermis. J. Exp. Med. 186:1725.[Abstract/Free Full Text]
  36. Cumberbatch, M., Peters, S. W., Gould, S. J. and Kimber, I. 1992. Intercellular adhesion molecule-1 (ICAM-1) expression by lymph node dendritic cells: comparison with epidermal Langerhans cells. Immunol. Lett. 32:105.[Web of Science][Medline]
  37. Oppenheim-Mark, N., Davis, L. S., Bogue, D. T., Ramberg, J. and Lipsky, P. E. 1991. Differential utilization of ICAM-1 and VCAM-1 during the adhesion and transendothelial migration of human T lymphocytes. J. Immunol. 147:2913.[Abstract]
  38. Sparwasser, T., Koch, E. S., Valulas, R. M., Heeg, K., Lipford, G. B., Ellwart, J. W. and Wagner, H. 1998. Bacterial DNA and immunostimulatory CpG oligonucleotides trigger maturation and activation of murine dendritic cells. Eur. J. Immunol. 28:2045.[Web of Science][Medline]
  39. Staquet, M. J., Kobayashi, Y., Dezutter-Dambuyant, C. and Schimtt, D. 1995. Role of specific successive contacts between extracellular matrix proteins and epidermal Langerhans cells in the control of their directed migration. Eur. J. Cell. Biol. 66:342.[Web of Science][Medline]
  40. Brown, K. A., Bedford, M., Macey, D. A., McCarthy, A., Leroy, F., Vora, A. J., Stagg, A. J., Dumonde, D. C. and Knight, S. C. 1997. Human blood dendritic cells: binding to vascular endothelium and expression of adhesion molecules. Clin. Exp. Immunol. 107:601.[Web of Science][Medline]
  41. Hartmann, G., Weiner, G. J. and Krieg, A. M. 1999. CpG DNA: a potent signal for growth, activation, and maturation of human dendritic cells. Proc. Natl Acad. Sci. USA 96:9305.[Abstract/Free Full Text]
  42. Porgador, A., Irvine, K. R., Iwasaki, A., Barder, B. H., Restifo, N. P. and Germain, R. N. 1998. Predominant role for directly transfected dendritic cells in antigen presentation to CD8+ T cells after gene gun immunization. J. Exp. Med. 188:1075.[Abstract/Free Full Text]
  43. Casares, S., Inaba, K., Brumeanu, T. D., Steinmann, R. M. and Bona, C. A. 1997. Antigen presentation by dendritic cells after immunization with DNA encoding a major histocompatibility complex class II-restricted viral epitope. J. Exp. Med. 186:1481.[Abstract/Free Full Text]
  44. Klinman, D. M., Sechler, J. M., Conover, J., Gu, M. and Rosenberg, A. S. 1998. Contribution of cells at the site of DNA vaccination to the generation of antigen-specific immunity and memory. J. Immunol. 160:2388.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
A.-H. Hovav, M. W. Panas, S. Rahman, P. Sircar, G. Gillard, M. J. Cayabyab, and N. L. Letvin
Duration of Antigen Expression In Vivo following DNA Immunization Modifies the Magnitude, Contraction, and Secondary Responses of CD8+ T Lymphocytes
J. Immunol., November 15, 2007; 179(10): 6725 - 6733.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. Flacher, M. Bouschbacher, E. Verronese, C. Massacrier, V. Sisirak, O. Berthier-Vergnes, B. de Saint-Vis, C. Caux, C. Dezutter-Dambuyant, S. Lebecque, et al.
Human Langerhans Cells Express a Specific TLR Profile and Differentially Respond to Viruses and Gram-Positive Bacteria
J. Immunol., December 1, 2006; 177(11): 7959 - 7967.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G.-X. Yang, Z.-X. Lian, K. Kikuchi, Y.-J. Liu, A. A. Ansari, S. Ikehara, and M. E. Gershwin
CD4- Plasmacytoid Dendritic Cells (pDCs) Migrate in Lymph Nodes by CpG Inoculation and Represent a Potent Functional Subset of pDCs
J. Immunol., March 15, 2005; 174(6): 3197 - 3203.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. M. Harandi, K. Eriksson, and J. Holmgren
A Protective Role of Locally Administered Immunostimulatory CpG Oligodeoxynucleotide in a Mouse Model of Genital Herpes Infection
J. Virol., December 20, 2002; 77(2): 953 - 962.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. C. Fausch, D. M. Da Silva, M. P. Rudolf, and W. M. Kast
Human Papillomavirus Virus-Like Particles Do Not Activate Langerhans Cells: A Possible Immune Escape Mechanism Used by Human Papillomaviruses
J. Immunol., September 15, 2002; 169(6): 3242 - 3249.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Merad, T. Sugie, E. G. Engleman, and L. Fong
In vivo manipulation of dendritic cells to induce therapeutic immunity
Blood, March 1, 2002; 99(5): 1676 - 1682.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Kawarada, R. Ganss, N. Garbi, T. Sacher, B. Arnold, and G. J. Hammerling
NK- and CD8+ T Cell-Mediated Eradication of Established Tumors by Peritumoral Injection of CpG-Containing Oligodeoxynucleotides
J. Immunol., November 1, 2001; 167(9): 5247 - 5253.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
T. De Smedt, E. Butz, J. Smith, R. Maldonado-Lopez, B. Pajak, M. Moser, and C. Maliszewski
CD8{alpha}- and CD8{alpha}+ subclasses of dendritic cells undergo phenotypic and functional maturation in vitro and in vivo
J. Leukoc. Biol., June 1, 2001; 69(6): 951 - 958.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
V. Angeli, C. Faveeuw, O. Roye, J. Fontaine, E. Teissier, A. Capron, I. Wolowczuk, M. Capron, and F. Trottein
Role of the Parasite-Derived Prostaglandin D2 in the Inhibition of Epidermal Langerhans Cell Migration during Schistosomiasis Infection
J. Exp. Med., May 21, 2001; 193(10): 1135 - 1148.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (46)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Ban, E.
Right arrow Articles by Riveau, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ban, E.
Right arrow Articles by Riveau, G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?