Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow An erratum has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (8)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Yoshida, T.
Right arrow Articles by Sakano, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yoshida, T.
Right arrow Articles by Sakano, H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 12, No. 5, 721-729, May 2000
© 2000 Japanese Society for Immunology

The DNA-bending protein, HMG1, is required for correct cleavage of 23 bp recombination signal sequences by recombination activating gene proteins in vitro

Tomoyuki Yoshida, Akio Tsuboi, Kei-ichiro Ishiguro, Fumikiyo Nagawa and Hitoshi Sakano

Department of Biophysics and Biochemistry, Graduate School of Science, University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032, Japan

Correspondence to: H. Sakano


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
DNA-bending proteins are known to facilitate the in vitro V(D)J joining of antigen receptor genes. Here we report that the high-mobility group protein, HMG1, is necessary for the correct nicking of the 23 bp recombination signal sequence (23-RSS) by the products of the recombination activating gene (RAG) proteins, RAG1 and RAG2. Without HMG1, the mouse J{kappa}1 23-RSS was recognized as if it were the 12-RSS and nicked at a site 12 + 7 nucleotides away from the 9mer signal, even though no 7mer-like sequence was evident at the cryptic nicking site. When increased amounts of HMG1 were added, the 23-RSS substrate was nicked correctly at a site 23 + 7 nucleotides from the 9mer, and nicking at the cryptic site disappeared. Unlike the 23-RSS, the 12-RSS did not require HMG1 for correct nicking, although HMG1 was found to increase the interaction between RSS and RAG proteins. Modification-interference assays demonstrated that HMG1 caused changes in the interaction between the 23-RSS and RAG proteins specifically at the 7mer and the cryptic nicking site.

Keywords: 12/23 rule, HMG1, recombination activating gene, recombination signal sequence, V(D)J recombination


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
V(D)J recombination plays crucial roles in the activation and diversification of both Ig and TCR genes (1). Joining occurs between two sets of recombination signals, heptamer (CACAGTG) and nonamer (ACAAAAACC) (2,3): one set is separated by a 12 bp spacer and the other by a 23 bp spacer (46). This is the so-called 12/23 bp spacer rule for V(D)J recombination (7). V(D)J recombination consists of two processes: recombination signal sequences (RSS)-dependent cleavage mediated by recombination activating gene (RAG) proteins, and ligation of two cleaved ends by the DNA repair mechanism. The former process includes specific recognition of the two RSS by RAG proteins, synaptic complex formation obeying the 12/23 rule and site-specific double-strand breakage of RSS DNA (8,9). The latter process is known to be mediated by the DNA repair mechanism involving DNA-dependent protein kinase (DNA-PK) (1012), Ku70 (13,14), Ku80 (15,16), XRCC4 (17,18) and DNA ligase IV (19,20).

Protein products of two recombination activating genes, RAG1 and RAG2 (21,22), were found to cleave RSS DNA in vitro at the coding border with the heptamer (23). The RAG-mediated RSS cleavage contains two successive steps: (i) nicking at the 5'-end of the heptamer sequence, and (ii) attacking the phosphodiester bond in the other strand, resulting in a hairpin structure at the coding end and a blunt cut on the 7mer end (24). It has been assumed that the heptamer sequence plays a crucial role in the cleavage reaction, while the nonamer sequence is important for the binding with RAG proteins (25). A Hin homeodomain of RAG1 has been reported to be essential in the nonamer binding (26,27), and its mode of interaction is quite similar to that of the Hin–hix interaction in the Salmonella phase variation (28,29).

The RAG-mediated cleavage of two RSS obeying the 12/23 rule was seen with crude cell lysate of B cell lines (30); however, the 12/23 rule was not followed strictly in the reaction with RAG1 and RAG2 proteins alone (31). DNA-bending proteins such as HMG1 have been reported to enhance the in vitro reactions of transposons (32,33) and the coordinated V(D)J joining (34,35). HMG1 has been shown to be important for binding of the 23-RSS (34). HMG1 is a member of the high-mobility group proteins which are non-histone chromosomal components (36). This protein was first identified as a cruciform-DNA binding protein (37) and is also known as a DNA-bending protein (38). RAG1, RAG2 and HMG1 together are thought to be sufficient for the coordinated cleavage of two RSS satisfying the 12/23 rule (39,40,41), at least in the in vitro reaction.

In the present study, we report that when the HMG1 protein is not present, the 23-RSS is nicked by RAG proteins at a cryptic site within the spacer, 12 + 7 nucleotides away from the 9mer. No nick is found at the border of the 7mer in the absence of HMG1. Addition of HMG1 to the 23-RSS–RAG complex caused the shift of the nicking site from the cryptic site to the 7mer coding border, indicating a structural alteration of the 23-RSS–RAG complex. Methylation- and uracilinterference assays further support the shift of interaction from the cryptic 7mer to the correct 7mer region.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Proteins
Truncated versions of RAG1 and RAG2 fused with the maltose-binding protein were prepared as described previously (23). Recombinant murine rag genes were expressed in the Spodoptera frugiperda cell line Sf.9 using baculovirus vectors (42). RAG proteins were purified with Ni-nitrilotriacetic acid (Qiagen, Hilden, Germany) and amylose resin columns (New England Biolabs, Beverly, MA).

HMG1 protein was purified from porcine thymi as described (43). Nuclear extracts were prepared from 200 g of the tissue. Non-histone nuclear proteins were isolated with 0.35 M NaCl, dialyzed against 10 mM Tris–HCl (pH 7.8) and passed through a chromatofocusing column. HMG1 was eluted with a linear gradient of 0–1.2 M NaCl in 10 mM Tris–HCl (pH 7.8). HMG1 fractions >90% purity were pooled and dialyzed against 10 mM Tris–HCl (pH 7.6).

Substrates
Wild-type 12- and 23-RSS sequences were CACAGTG-CTCCAGGGCTGAACAAAAACC (V{kappa}21c) and CACAGTG-GTAGTACTCCACTGTCTGGGTGTACAAAAACC (J{kappa}1) for the top strand respectively. As described previously (29), chemically synthesized RSS were subcloned into plasmid vectors, pKI13 (29) and pBluescript, which were used for nicking and modification-interference assays, respectively. For the nicking assay, EcoO109I–SfaNI cleaved fragment was recovered and labeled with DNA polymerase I Klenow fragment (New England BioLabs) at the EcoO109I site. For the electrophoretic mobility shift assay (EMSA) and modification-interference assay, KpnI–NotI fragment or EcoO109I–SacII fragment was recovered and labeled with Klenow fragment at the NotI or EcoO109I site for the bottom and top strand respectively.

For a double-strand break assay with a pre-nicked 23-RSS substrate, three oligonucleotides (CACAGTGGTAGTACTCCACTGTCTGGGTGTACAAAAACCGTCGACCTCGAGGGGGGGCC, CTCCTGAGCGGCCGCAAGCTT and GGCCCCCCC-TCGAGGTCGACGGTTTTTGTCACCCAGACAGTGGAGTAC-TACCACTGTGAAGCTTGCGGCCGCTCAGGA) were 5'-phosphorylated and annealed. Labeled 12-RSS was the same as the substrate used in the modification-interference assay.

EMSA
[32P]DNA (0.02 pmol; 1x105 c.p.m.) was incubated with 100 ng of RAG1 and RAG2 proteins at 37°C for 10 min in 10 µl of binding buffer containing 0–80 ng of HMG1, 25 mM MOPS–KOH (pH 7.0), 5 mM HEPES–KOH (pH 8.0), 2 mM Tris–HCl (pH 7.6), 90 mM potassium acetate (pH 7.0), 30 mM KCl, 10 mM MgCl2, 10% DMSO, 2.4 mM DTT, 4% glycerol, 1 mM carrier oligonucleotide (25mer; ACTGGAGTTAGTTGAAGCATTAGGT) and 100 µg/ml BSA. The sample in 5 µl of the dye mix (10% glycerol, 0.6 mM EDTA, 0.006% xylene cyanol and 0.006% bromophenol blue) was loaded on a 3.5% polyacrylamide gel (acrylamide:bisacrylamide 19:1) containing 89 mM Tris–borate (pH 8.3).

Nicking assay
The 3'-end-labeled DNA (0.02 pmol, 1x105 c.p.m.) was incubated with 100 ng of RAG1 and RAG2 proteins at 37°C for 90 min in 10 µl of reaction buffer containing 0–80 ng of HMG1, 25 mM HEPES–KOH (pH 7.0), 30 mM potassium glutamate (pH 7.0), 30 mM KCl, 1 mM MgCl2, 2.2 mM DTT, 2 mM Tris–HCl (pH 7.6) and 100 µg/ml BSA. In some experiments 1 mM MnCl2 was used instead of MgCl2. The sample was precipitated and rinsed with ethanol, added with dye mix (90% formamide, 1 mM EDTA, 0.01% xylene cyanol and 0.01% bromophenol blue), heated at 95°C for 5 min, and loaded on an 8% polyacrylamide gel containing 89 mM Tris–borate (pH 8.3), 2 mM EDTA and 7 M urea.

Modification-interference assay
The methylation-interference assay was performed as described (29), except that preparative EMSA was scaled up to 3- to 5-fold and DNA was purified by reversed-phase column chromatography (Elutip-d; Schleicher & Schuell, Dassel, Germany). Uracil-interference assay was carried out as described (44). Substrates were prepared by PCR, substituting thymine residues with dUTP. Amplified fragments were purified with the QIAEX II gel extraction kit (Qiagen), cleaved with restriction enzymes and filled-in with Klenow fragment. The rest of the procedure was the same as in the methylation-interference assay, except that deuracilation with uracil-N-glycosylase (Perkin Elmer, Branchburg, NJ) was carried out after purification with reversed-phase column chromatography.

Double-strand break assay
The 3' end-labeled DNA (0.02 pmol, 1x105 c.p.m.) was mixed with 100 ng of RAG1 and RAG2 at 37°C for 90 min in the presence of cold partner RSS (0.05 pmol) in 10 µl of buffer containing 0 or 40 ng of HMG1, 25 mM MOPS–KOH (pH 7.0), 30 mM potassium acetate (pH 7.0), 30 mM KCl, 10 mM MgCl2, 2.4 mM DTT and 100 µg/ml BSA. The sample was precipitated and rinsed with ethanol, added with dye mix, and loaded on an 8% polyacrylamide gel containing 89 mM Tris–borate (pH 8.3) and 2 mM EDTA.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
HMG1 is required for correct nicking of 23-RSS
In order to study a possible role of HMG1 in the in vitro V(D)J joining, we have analyzed the reaction products of 12- and 23-RSS with the RAG1–RAG2 complex and increasing amounts of the HMG1 protein. RSS DNA was labeled at the 3'-end of the top strand. The V{kappa}21c 12-RSS substrate was nicked correctly 12 + 7 nucleotides from the 9mer, regardless of HMG1 (Fig. 1AGo). In contrast, the J{kappa}1 23-RSS substrate was not nicked at the expected site, 23 + 7 nucleotides from the 9mer, in the absence of HMG1. It was instead nicked at a cryptic site, 12 + 7 nucleotides from the 9mer (Fig. 1BGo). Under the Mg2+ condition, ~1% of the input DNA was nicked at the cryptic site without HMG1. In order to know how far the reaction can proceed, the 23-RSS was then labeled at the 5'-end of the top strand for the detection of the hairpin structure. Double-strand cleavage was hardly seen at the cryptic heptamer, although both hairpin and nicked structures were observed under the Mn2+ condition (data not shown). When HMG1 was added to the reaction mixture, nicking at the cryptic site decreased and a band representing DNA nicked at the distal end of 7mer began to appear.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 1. In vitro nicking of RSS by RAG1 and RAG2 proteins with increasing amounts of HMG1. The V{kappa}21C 12-RSS (a) and the J{kappa}1 23-RSS (B) were labeled with 32P at the 3'-end of the top strand. Samples were incubated with 10 µg/ml of RAG proteins and 0–8 µg/ml of HMG1 in the Mg2+-containing buffer, unless otherwise noted. Reaction products were electrophoresed in 8% denaturing polyacrylamide gels. G-reacted RSS DNA (G) was electrophoresed alongside as a positional marker. Open and closed arrows indicate nicking at the coding border of 7mer () and at a cryptic nicking site () respectively. RSS substrates and nicking sites are schematically shown below the autoradiographs. Asterisks indicate 32P-labeled 3'-ends.

 
In the experiments previously reported by others (34), 23-RSS DNA was nicked correctly by RAG1–RAG2 even in the absence of HMG1. To examine the discrepancy with the present result, we prepared various 23-RSS substrates with different lengths of flanking sequences (Fig. 2Go). When we shortened the 5' sequence from 96 to 60 bp and the 3' sequence from 19 to 12 bp, the amount of nicking at the correct site appeared almost equal to that for the cryptic site, in the absence of HMG1 (Fig. 2A and BGo). When we further trimmed the 5' side to 19 bp, almost all the 23-RSS substrate was nicked correctly in the absence of HMG1 and nicking at a cryptic site disappeared completely (Fig. 2cGo). These results indicate that HMG1 is not required for in vitro nicking of shorter 23-RSS substrates.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2. Nicking of 23-RSS' with different lengths of flanking sequences. The J{kappa}1 23-RSS substrates with three different lengths were incubated with the RAG1 and RAG2 proteins in the absence of HMG1. Open triangles, closed triangles and open squares in the diagrams represent the 7mer, cryptic 7mer and 9mer sequences, respectively. Lengths of flanking sequences at the 7mer-side and the 9mer-side are shown in base pairs (bp). Lengths of nicking products are in nucleotides (nt). Open and closed arrowheads beside the autoradiographs indicate DNA fragments nicked at the correct and cryptic sites, respectively. Asterisks indicate the position of 32P.

 
HMG1 supershifts the 23-RSS–RAG complex in the mobility shift assay
Figure 3Go shows the gel mobility shift assay to study the RAG–RSS interaction with or without the HMG1 protein. The RAG proteins were mixed with RSS DNA with increasing amounts of HMG1 in the presence of Mg2+. When HMG1 was absent, a faint band representing the RSS–RAG complex was detected (Fig. 3BGo). When HMG1 was added at higher concentrations, a band representing the RAG–RSS complex not only became darker, but also migrated slower in the gel, suggesting that the HMG1 protein formed a higher-order complex with RAG-bound RSS or caused a conformational change of the complex. This supershift induced by the HMG1 protein was also detected for the 12-RSS substrate (Fig. 3AGo).



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 3. Formation of the RSS–RAG complex with increasing amounts of HMG1. The V{kappa}21C 12-RSS (a) and the J{kappa}1 23-RSS (b) fragments illustrated in Fig. 1Go were incubated with 0–4 µg/ml of HMG1 and 10 µg/ml of RAG proteins. The complexes were separated in 3.5% polyacrylamide gels. Two types of RSS–RAG complexes were detected (indicated by arrows). DNA was eluted separately from the faster and the slower migrating 23-RSS–RAG complexes (in the lane of 1 µg/ml HMG1), and electrophoresed in an 8% denaturing polyacrylamide gel (C). Open and closed arrows indicate DNA fragments nicked at the 7mer coding border () and the cryptic site () in the J{kappa}1 23-RSS, respectively.

 
In order to compare the structures of 23-RSS in two shifted bands (indicated by arrows in Fig. 3BGo), DNA was eluted separately from the lane for 1 µg/ml of HMG1. The samples were electrophoresed in a denaturing polyacrylamide gel to examine the nicked products (Fig. 3CGo). In the faster migrating band, 23-RSS DNA was nicked more frequently at the cryptic site than at the correct 7mer, while in the slower migrating band, DNA was nicked mostly at the correct site, i.e. the coding border of the 7mer. Detection of both types of nicking products in the faster migrating bands is probably due to the dissociation of HMG1 from the supershifted complex after nicking. Although a correlation between the supershift and correct nicking is not evident, binding of HMG1 to the RSS–RAG complex appears to be necessary for nicking at the correct site in the 23-RSS substrate.

HMG1 induces the change of interaction between 23-RSS and RAG proteins
The nicking experiment described above indicated that HMG1 induces an alteration in the structure of the 23-RSS–RAG complex so that the 23-RSS substrate is nicked correctly at the 7mer rather than at a cryptic site within the spacer. In order to study whether HMG1 indeed changes specific interaction between 23-RSS and RAG proteins, we have analyzed the RAG–RSS complex by the methylation- and the uracil-interference assays. For the methylation-interference assay (45), RSS DNA was partially methylated with dimethylsulfate, and complexed with the RAG proteins in the presence or absence of HMG1. DNA was eluted from the gel, treated with piperidine and electrophoresed in a DNA sequencing gel. RAG-bound DNA samples with or without HMG1 are compared for both the bottom (Fig. 4AGo) and the top (Fig. 4BGo) strands. G-reacted markers and unbound DNA samples were also separated in the same gel.



View larger version (55K):
[in this window]
[in a new window]
 
Fig. 4. Methylation- and uracil-interference analyses of the RSS–RAG interaction. Structural changes of the RSS–RAG complex were studied before and after the addition of HMG1. Both strands of the J{kappa}1 23-RSS (A) and the V{kappa}21C 12-RSS (B), illustrated in Fig. 1Go, were analyzed by the methylation-interference assay. Uracil-interference assay was performed with the bottom strands of 23- and 12-RSS (C). Partially G-methylated or T-uracylated DNA samples were complexed with the RAG1 and RAG2 proteins in the presence or absence of HMG1. Complexes were electrophoresed in 3.5% polyacrylamide gels, and DNA was eluted separately from the gel slices containing the bands of unbound and shifted RSS DNA. Samples were chemically cleaved and applied on 8% denaturing polyacrylamide gels along with G-reacted marker DNA. Asterisks indicate interfered residues in the RSS–RAG complex regardless of HMG1. Residues are indicated by crosses (+), when the levels of interference differ before and after the addition of HMG1. Open and filled triangles for the top strand indicate RAG-mediated nicking at the correct and cryptic sites respectively. Heptamer (`7') and nonamer (`9') signals are indicated. Broken lines are cryptic heptamer regions in the spacer of 23-RSS.

 
In the bottom strand of 23-RSS (Fig. 4AGo), strong interference was detected at the second position G (indicated by asterisk) in the 9mer signal, regardless of HMG1. In the 7mer region, the third position G (indicated by +) was weakly interfered when HMG1 was added to the complex, suggesting that HMG1 created a new interaction at the residue. It is interesting that the same interference is seen in the 7mer of the 12-RSS, regardless of HMG1 (Fig. 4BGo). In the top strand of the 23-RSS (Fig. 4AGo), strong signals were detected for nicking by the RAG proteins at a cryptic site ({blacktriangleright}) and at the coding border of 7mer ({triangleright}). At a G residue in the spacer region proximal to the 9mer, the band became fainter when the HMG1 protein was added. This interference indicates a conformational alteration at this position induced by HMG1, which may be responsible for enhancing the interaction between 23-RSS and RAG proteins. In the 12-RSS (Fig. 4BGo), five G residues indicated by asterisks were interfered in the RSS–RAG complex. However, these interferences were detected regardless of HMG1, indicating that no structural changes were induced by HMG1 in the case of 12-RSS.

In the uracil-interference experiment (Fig. 4CGo), T residues were partially substituted with dUTP and examined for the interference in binding of RSS and RAG proteins. In this assay, T residues, if involved in the protein–DNA interaction, are detected as fainter bands, when they are compared with the unbound sample (44). In the 23-RSS substrate (Fig. 4cGo), interference was evident in the 9mer region, at the first, third and fourth positions (indicated by asterisks) regardless of HMG1. Interference at the fifth position (indicated by +) was seen only when HMG1 was absent. A similar observation was made for the seventh position T in the cryptic 7mer. In contrast, the band of the second position T in the cryptic 7mer became darker in the bound sample when HMG1 was absent. These results reveal that HMG1 causes the changes of interactions with RAG proteins at specific residues of 23-RSS both in the 7mer and in the cryptic nicking regions.

Effects of base substitutions at a cryptic nicking site
In order to examine whether the nicking at a cryptic site occurs independent of the sequence, we introduced base substitutions in the cryptic 7mer, TACTCCA, which is remotely related to the consensus sequence, CACAGTG (Fig. 5Go). Since the cryptic 7mer does not apparently resemble the signal sequence, it was first thought that the secondary nicking would take place at a site 12 + 7 nucleotides from the 9mer, regardless of the surrounding sequence. When we tested a sequence, ATGAGGT (Mut 1), for the cryptic site, the secondary nicking was not seen in the absence of HMG1. In contrast, when we changed the cryptic site sequence to more similar to the consensus 7mer, CACTCCA (Mut 2) or ACGCGTG (Mut 3), secondary nicking occurred even in the presence of HMG1. With these substrates, Mut 1, Mut 2 and Mut 3, nicking at the correct site was seen only when HMG1 was present. Interestingly, when the cryptic site sequence was changed to the signal sequence itself, CACAGTG (Mut 4), nicking occurred at the cryptic site, but not at a correct site at all. Although this substrate can be recognized as either 12-RSS or 23-RSS, it was recognized only as the 12-RSS substrate in the nicking reaction. It appears that the nicking at a cryptic site is not totally independent of the cryptic 7mer sequence. It should be noted that the supershift of the RAG–RSS complex was equally seen, regardless of base substitutions in the cryptic heptamer (data not shown). Since the supershift was detected even with the Mut 4 substrate, these observations indicate that the shift of the gel mobility does not necessarily correlate with the shift of the nicking site.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 5. Effects of base substitutions in the cryptic 7mer on the nicking of 23-RSS. Five 23-RSS substrates with different cryptic 7mer sequences were incubated with the RAG1 and RAG2 proteins in the presence of 0–8 µg/ml of HMG1. Reaction products were separated on 8% denaturing polyacrylamide gels. Open and closed arrowheads indicate DNA fragments nicked at the correct and cryptic sites respectively. Sequences of the cryptic 7mer region are shown beside the closed arrowheads. Lower case letters are residues different from the consensus 7mer sequence (CACAGTG). The structure of 23-RSS used in the study is schematically shown. An asterisk indicates 32P label.

 
HMG1 is still necessary for coordinated double-strand cleavage even after nicking of 23-RSS
Our data described above demonstrated that HMG1 is required for correct nicking of 23-RSS, while 12-RSS is nicked correctly with the RAG proteins even without HMG1. It has been reported that HMG1 is necessary for the coordinated double-strand cleavage reaction satisfying the 12/23 rule (34,35). In order to test whether pre-nicking of 23-RSS can remove the requirement of HMG1 from the coordinated cleavage reaction, we examined coordinated double-strand cleavage using a pre-nicked substrate. The pre-nicked 23-RSS at the 7mer was paired with labeled 12-RSS with and without HMG1, and then cleaved with the RAG1–RAG2 complex. As shown in Fig. 6Go, HMG1 is still necessary for the double-strand cleavage in the coordinated reaction satisfying the 12/23 rule.



View larger version (76K):
[in this window]
[in a new window]
 
Fig. 6. Effects of HMG1 on the RAG-mediated coordinated double-strand breakage reaction. The end-labeled 12-RSS and unlabeled partner 23-RSS were incubated with the RAG1 and RAG2 proteins in the presence or absence of HMG1. Two types of partner DNA were examined, with (right panel) and without (left panel) a nick at the coding border of the 7mer signal. Substrate RSS and a hairpin structure of the double-strand cleavage product are schematically shown.

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
In the present study we have analyzed the effect of the DNA-bending protein, HMG1, on the interaction between RSS and RAG proteins. It was shown that the mouse J{kappa}1 23-RSS was nicked at a cryptic site 12 + 7 nucleotides from the 9mer in the absence of HMG1. No nicking was seen at the coding border of the 7mer signal. When HMG1 was added, nicking was shifted from the cryptic site to the correct site, i.e. the coding border (Fig. 1Go). These observations indicate that in the absence of HMG1 the 23-RSS is recognized by RAG proteins as if it were the 12-RSS. In contrast to our observation, van Gent et al. (34) reported that the RAG proteins alone introduced a nick correctly at the 7mer in the same J{kappa}1 RSS in the absence of HMG1. We noticed that the substrate used in their study (34) contained relatively shorter flanking regions on both sides of the RSS, while our substrate contained longer flanking sequences. By analyzing J{kappa}1 substrates with different lengths (Fig. 2Go), it was confirmed that 23-RSS with shorter flanking regions (<20 bp) were indeed nicked at the coding border of the 7mer even without HMG1. It appears that the conformation of 23-RSS, when flanked by relatively longer sequences may need to be changed, so that it can be nicked correctly. Although the exact nature of this conformational change induced by HMG1 is yet to be clarified, DNA unwinding may be one possibility: shorter DNA may unwind by itself without the aid of HMG1.

In our gel shift assay, a band of the RSS–RAG complex further shifted when the HMG1 protein was added (Fig. 3Go). This supershift indicates direct association of HMG1 to the RSS–RAG complex, which may cause the alteration in the RSS–RAG interaction. Recently, two groups demonstrated that the RAG1 protein interacts with the HMG box of the HMG1 protein (46,47). In our uracil-interference assay of the bottom strand of 23-RSS, RSS–RAG interactions in the cryptic 7mer region disappeared when HMG1 was added (Fig. 4CGo). In the methylation-interference assay of the bottom strand of 23-RSS, interference at the third position G in the 7mer signal newly appeared when HMG1 was added (Fig. 4AGo). This interference was constantly observed in the 7mer of 12-RSS regardless of HMG1 (Fig. 4BGo). These results may indicate that HMG1 causes conformational changes of the 23-RSS so that RAG proteins can access to the correct nicking site of the 7mer. It should be noted that no alteration was found with the interference pattern of the 12-RSS–RAG complex after the addition of HMG1. In our experiment, the 23-RSS appeared to be recognized as if it were a 12-RSS by the RAG proteins when HMG1 was not present: nicking took place at a cryptic site 12 + 7 nucleotides from the 9mer. Although the cryptic heptamer (TACTCCA) is only remotely related to the consensus 7mer (CACAGTG), the sequence at the cryptic site appears to be still important (Fig. 5Go). It is yet to be clarified why this sequence was recognized as a nicking site by the RAG1–RAG2 complex in the absence of HMG1.

HMG1 was shown to be necessary not only for the nicking of the 23-RSS at the correct site, but also for the coordinated double-strand breakage satisfying the 12/23 rule (Fig. 6Go). With regard to the stage of establishment of the 12/23 rule, two possibilities have been considered: (i) at the step of the synaptic complex formation (39) and (ii) at the hairpin formation on both RSS substrates (41). Since excess amounts of either type of RSS did not lower the cleavage reaction, a synaptic complex satisfying the 12/23 rule may be formed prior to the coupled cleavage. In order to study the roles of HMG1, pre-nicked 23-RSS was paired with 12-RSS and tested for the coordinated cleavage by the RAG proteins with and without HMG1 (Fig. 6Go). It was found that HMG1 was still needed for the coordinated reaction even when the pre-nicked 23-RSS was used. HMG1 is probably needed for the synaptic complex formation, since the conformation of 23-RSS is expected to be similar to that of 12-RSS in the absence of HMG1. The synaptic complex following the 12/23 rule may be formed only when the conformation of the 23-RSS–RAG complex has been changed from the 12-RSS type to the 23-RSS type with the aid of HMG1. In the present study, we analyzed the RSS–RAG complex by the methylation- and uracil-interference assays. We have detected the shift of interference from the cryptic 7mer to the natural 7mer region. This is the first demonstration of the HMG1-induced interaction change between the 23-RSS and RAG proteins at the level of nucleotides. More precise structural analysis of the RSS–RAG complex will shed light on the molecular bases of the 12/23 joining rule and on the possible roles of HMG1 in V(D)J recombination.


    Acknowledgments
 
This work was supported by the Special Promotion Research Grant from the Ministry of Education and Culture of Japan, and by grants from Toray Science Foundation, Nissan Science Foundation and Mitsubishi Foundation. We thank Akiko Ishikawa and Hirotomo Fujihashi for technical assistance, Hirofumi Nishizumi and Toshitada Takemori for helpful discussion, and Hitomi Sakano for critical reading of the manuscript.


    Abbreviations
 
EMSA electrophoretic mobility shift assay
HMG high mobility group protein
RAG recombination activating gene
RSS recombination signal sequence

    Notes
 
Transmitting editor: T. Saito

Received 2 December 1999, accepted 3 February 2000.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Tonegawa, S. 1983. Somatic generation of antibody diversity. Nature 302:575.[Medline]
  2. Max, E., Seidman, J. G. and Leder, P. 1979. Sequences of five potential recombination sites encoded close to an immunoglobulin kappa constant region gene. Proc. Natl Acad. Sci. USA 76:3450.[Abstract/Free Full Text]
  3. Sakano, H., Huppi, K., Heinrich, G. and Tonegawa, S. 1979. Sequences at the somatic recombination sites of immunoglobulin light-chain genes. Nature 280:288.[Medline]
  4. Early, P., Huang, H., Davis, M., Calame, K. and Hood, L. 1980. An immunoglobulin heavy chain variable region gene is generated from three segments of DNA: VH, D and JH. Cell 19:981.[Web of Science][Medline]
  5. Sakano, H., Maki, R., Kurosawa, Y., Roeder, W. and Tonegawa, S. 1980. Two types of somatic recombination are necessary for the generation of complete immunoglobulin heavy-chain genes. Nature 286:676.[Medline]
  6. Sakano, H., Kurosawa, Y., Weigert, M. and Tonegawa, S. 1981. Identification and nucleotide sequence of a diversity DNA segment (D) of immunoglobulin heavy-chain genes. Nature 290:562.[Medline]
  7. Akira, S., Okazaki, K. and Sakano, H. 1987. Two pairs of recombination signals are sufficient to cause immunoglobulin V–(D)–J joining. Science 238:1134.[Abstract/Free Full Text]
  8. Roth, D. B., Menetski, J. P., Nakajima, P. B., Bosma, M. J. and Gellert, M. 1992. V(D)J recombination: covalently sealed (hairpin) coding ends in scid mouse thymocytes. Cell 70:983.[Web of Science][Medline]
  9. Schlissel, M., Constantinescu, A., Morrow, T., Baxter, M. and Peng, A. 1993. Double-strand signal sequence breaks in V(D)J recombination are blunt, 5'-phosphorylated, RAG-dependent and cell cycle regulated. Genes Dev. 7:2520.[Abstract/Free Full Text]
  10. Blunt, T., Finnie, N. J., Taccioli, G. E., Smith, G. C. M., Demengeot, J., Gottlieb, T. M., Mizuta, R., Varghese, A. J., Alt, F. W., Jeggo, P. A. and Jackson, S. P. 1995. Defective DNA-dependent protein kinase activity is linked to V(D)J recombination and DNA repair defects associated with the murine scid mutation. Cell 80:813.[Web of Science][Medline]
  11. Kirchgessner, C. U., Patil, C. K., Evans, J. W., Cuomo, C. A., Fried, L. M., Carter, T., Oettinger, M. A. and Brown, J. M. 1995. DNA-dependent kinase (p350) as a candidate gene for the murine SCID defect. Science 267:1178.[Abstract/Free Full Text]
  12. Lees-Miller, S. P., Godbout, R., Chan, D. W., Weinfeld, M., Day, R. S., III, Barron, G. M. and Allalunis-Turner, J. 1995. Absence of p350 subunit of DNA-activated protein kinase from a radiosensitive human cell line. Science 267:1183.[Abstract/Free Full Text]
  13. Taccioli, G. E., Rathbun, G., Oltz, E., Stamato, T., Jeggo, P. A. and Alt, F. W. 1993. Impairment of V(D)J recombination in double strand break repair mutants. Science 260:207.[Abstract/Free Full Text]
  14. Gu, Y., Seidl, K. J., Rathbun, G. A., Zhu, C., Manis, J. P., van der Stoep, N., Davidson, L., Cheng, H. L., Sekiguchi, J. M., Frank, K., Stanhope-Baker, P., Schlissel, M. S., Roth, D. B. and Alt, F. W. 1997. Growth retardation and leaky SCID phenotype of Ku70-deficient mice. Immunity 7:653.[Web of Science][Medline]
  15. Zhu, C., Bogue, M. A., Lim, D.-S., Hasty, P. and Roth., D. B. 1996. Ku 86-deficient mice exhibit severe combined immunodeficiency and defective processing of V(D)J recombination intermediates. Cell 86:379.[Web of Science][Medline]
  16. Nussenzweig, A., Chen, C., da Costa Soares, V., Sanchez, M., Sokol, K., Nussenzweig, M. C. and Li, G. C. 1996. Requirement for Ku80 in growth and immunoglobulin V(D)J recombination. Nature 382:551.[Medline]
  17. Li, Z., Otevrel, T., Gao, Y., Cheng, H.-L., Seed, B., Stamato, T. D., Taccioli, G. E. and Alt, F. W. 1995. The XRCC4 gene encodes a novel protein involved in DNA double-strand break repair and V(D)J recombination. Cell 83:1079.[Web of Science][Medline]
  18. Gao, Y., Sun, Y., Frank, K. M., Dikkes, P., Fujiwara, Y., Seidl, K. J., Sekiguchi, J. M., Rathbun, G. A., Swat, W., Wang, J., Bronson, R. T., Malynn, B. A., Bryans, M., Zhu, C., Chaudhuri, J., Davidson, L., Ferrini, R., Stamato, T., Orkin, S. H., Greenberg, M. E. and Alt, F. W. 1998. A critical role for DNA end-joining proteins in both lymphogenesis and neurogenesis. Cell 95:891.[Web of Science][Medline]
  19. Grawunder, U., Wilm, M., Wu, X., Kulesza, P., Wilson, T. E., Mann, M. and Lieber, M. R. 1997. Activity of DNA ligase IV stimulated by complex formation with XRCC4 protein in mammalian cells. Nature 388:492.[Medline]
  20. Frank, K. M., Sekiguchi, J. M., Seidl, K. J., Swat, W., Rathbun, G. A., Cheng, H. L., Davidson, L., Kangaloo, L. and Alt, F. W. 1998. Late embryonic lethality and impaired V(D)J recombination in mice lacking DNA ligase IV. Nature 396:173.[Medline]
  21. Schatz, D. G., Oettinger, M. A. and Baltimore, D. 1989. The V(D)J recombination-activating gene, RAG-1. Cell 59:1035.[Web of Science][Medline]
  22. Oettinger, M. A., Schatz, D. G., Gerka, C. and Baltimore, D. 1990. RAG-1 and RAG-2, adjacent genes that synergistically activate V(D)J recombination. Science 248:1517.[Abstract/Free Full Text]
  23. van Gent, D. C., McBlane, J. F., Ramsden, D. A., Sadofsky, M. J., Hesse, J. E. and Gellert, M. 1995. Initiation of V(D)J recombination in a cell-free system. Cell 81:925.[Web of Science][Medline]
  24. McBlane, J. F., van Gent, D. C., Ramsden, D. A., Romeo, C., Cuomo, C. A., Gellert, M. and Oettinger, M. A. 1995. Cleavage at a V(D)J recombination signal requires only RAG1 and RAG2 proteins and occurs in two steps. Cell 83:387.[Web of Science][Medline]
  25. Ramsden, D. A., McBlane, J. F., van Gent, D. C. and Gellert, M. 1996. Distinct DNA sequence and structure requirements for the two steps of V(D)J recombination signal cleavage. EMBO J. 15:3197.[Web of Science][Medline]
  26. Difilippantonio, M. J., McMahan, C. J., Eastman, Q. M., Spanopoulou, E. and Schatz, D. G. 1996. Rag-1 mediates signal sequence recognition and recruitment of Rag-2 in V(D)J recombination. Cell 87:253.[Web of Science][Medline]
  27. Spanopoulou, E., Zaitseva, F., Wang, F.-H., Santagata, S., Baltimore, D. and Panayotou, G. 1996. The homeodomain region of Rag-1 reveals the parallel mechanisms of bacterial and V(D)J recombination. Cell 87:263.[Web of Science][Medline]
  28. Feng, J.-A., Johnson, R. C. and Dickerson, R. E. 1994. Hin recombinase bound to DNA: the origin of specificity in major and minor groove interactions. Science 263:348.[Abstract/Free Full Text]
  29. Nagawa, F., Ishiguro, K.-I., Tsuboi, A., Yoshida, T., Ishikawa, A., Takemori, T., Otsuka, A. J. and Sakano, H. 1998. Footprint analysis of the RAG protein recombination signal sequence complex for V(D)J recombination. Mol. Cell. Biol. 18:655.[Abstract/Free Full Text]
  30. Eastman, Q. M., Leu, T. M. J. and Schatz, D. G. 1996. Initiation of V(D)J type recombination in vitro obeying the 12/23 rule. Nature 380:85.[Medline]
  31. van Gent, D. C., Ramsden, D. A. and Gellert, M. 1996. The RAG1 and RAG2 proteins establish the 12/23 rule in V(D)J recombination. Cell 85:107.[Web of Science][Medline]
  32. Paull, T. T., Haykinson, M. J. and Johnson, R. C. 1993. The nonspecific DNA-binding and -bending proteins HMG1 and HMG2 promote the assembly of complex nucleoprotein structures. Genes Dev. 7:1521.[Abstract/Free Full Text]
  33. Segall, A. M., Goodman, S. D. and Nash, H. A. 1994. Architectural elements in nucleoprotein complexes: interchangeability of specific and non-specific DNA binding proteins. EMBO J. 13:4536.[Web of Science][Medline]
  34. van Gent, D. C., Hiom, K., Paull, T. T. and Gellert, M. 1997. Stimulation of V(D)J cleavage by high mobility group proteins. EMBO J. 16:2665.[Web of Science][Medline]
  35. Sawchuk, D., Weis-Garcia, F., Malik, S., Besmer, E., Bustin, M., Nussenzweig, M. and Cortes, P. 1997. V(D)J recombination: modulation of RAG1 and RAG2 cleavage activity on 12/23 substrates by whole cell extract and DNA-bending proteins. J. Exp. Med. 185:2025.[Abstract/Free Full Text]
  36. Bustin, M. and Reeves, R. 1996. High-mobility-group chromosomal proteins: architectural components that facilitate chromatin function. Prog. Nucleic Acid Res. Mol. Biol. 54:35.[Web of Science][Medline]
  37. Bianchi, M. E., Beltrame, M. and Paonessa, G. 1989. Specific recognition of cruciform DNA by nuclear protein HMG1. Science 243:1056.[Abstract/Free Full Text]
  38. Pil, P. M., Chow, C. S. and Lippard, S. J. 1993. High-mobility-group 1 protein mediates DNA bending as determined by ring closures. Proc. Natl Acad. Sci. USA 90:9465.[Abstract/Free Full Text]
  39. Hiom, K. and Gellert, M. 1998. Assembly of a 12/23 paired signal complex: a critical control point in V(D)J recombination. Mol. Cell 1:1011.[Web of Science][Medline]
  40. Kim, D. R. and Oettinger, M. A. 1998. Functional analysis of coordinated cleavage in V(D)J recombination. Mol. Cell. Biol. 18:4679.[Abstract/Free Full Text]
  41. West, R. B. and Lieber, M. R. 1998. The RAG–HMG1 complex enforces the 12/23 rule of V(D)J recombination specifically at the double-hairpin formation step. Mol. Cell. Biol. 18:6408.[Abstract/Free Full Text]
  42. Smith, G. E., Ju, G., Ericson, B. L., Moschera, J., Lahm, H.-W., Chizzonite, R. and Summers, M. D. 1985. Modification and secretion of human interleukin 2 produced in insect cells by a baculovirus expression vector. Proc. Natl Acad. Sci. USA 82:8404.[Abstract/Free Full Text]
  43. Adachi, Y., Mizuno, S. and Yoshida, M. 1990. Efficient large-scale purification of non-histone chromosomal proteins HMG1 and HMG2 by using Polybuffer-exchanger PBE94. J. Chromatogr. 530:39.[Web of Science][Medline]
  44. Pu, W. T. and Struhl, K. 1992. Uracil interference, a rapid and general method for defining protein–DNA interactions involving the 5-methyl group of thymines: the GCN4–DNA complex. Nucleic Acids Res. 20:771.[Abstract/Free Full Text]
  45. Sen, R. and Baltimore, D. 1986. Multiple nuclear factors interact with the immunoglobulin enhancer sequences. Cell 46:705.[Web of Science][Medline]
  46. Rodgers, K. K., Villey, I. J., Ptaszek, L., Corbett, E., Schatz, D. G. and Coleman, J. E. 1999. A dimer of the lymphoid protein RAG1 recognizes the recombination signal sequence and the complex stably incorporates the high mobility group protein HMG2. Nucleic Acids Res. 27:2938.[Abstract/Free Full Text]
  47. Aidinis, V., Bonaldi, T., Beltrame, M., Santagata, S., Bianchi, M. E. and Spanopoulou, E. The RAG1 homeodomain recruits HMG1 and HMG2 to facilitate recombination signal sequence binding and to enhance the intrinsic DNA-bending activity of RAG1–RAG2. Mol. Cell. Biol. 19:6532.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
A. N. Kriatchko, D. K. Anderson, and P. C. Swanson
Identification and Characterization of a Gain-of-Function RAG-1 Mutant
Mol. Cell. Biol., June 15, 2006; 26(12): 4712 - 4728.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Nagawa, S. Hirose, H. Nishizumi, T. Nishihara, and H. Sakano
Joining Mutants of RAG1 and RAG2 that Demonstrate Impaired Interactions with the Coding-end DNA
J. Biol. Chem., September 10, 2004; 279(37): 38360 - 38368.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
F. Nagawa, M. Kodama, T. Nishihara, K.-i. Ishiguro, and H. Sakano
Footprint Analysis of Recombination Signal Sequences in the 12/23 Synaptic Complex of V(D)J Recombination
Mol. Cell. Biol., October 15, 2002; 22(20): 7217 - 7225.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. J. Sadofsky
The RAG proteins in V(D)J recombination: more than just a nuclease
Nucleic Acids Res., April 1, 2001; 29(7): 1399 - 1409.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow An erratum has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (8)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Yoshida, T.
Right arrow Articles by Sakano, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yoshida, T.
Right arrow Articles by Sakano, H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?