International Immunology, Vol. 12, No. 5, 701-709,
May 2000
© 2000 Japanese Society for Immunology
Differential IL-12 responsiveness of T cells but not of NK cells from tumor-bearing mice in IL-12-responsive versus -unresponsive tumor models
Department of Oncology, Biomedical Research Center, Osaka University Graduate School of Medicine, 2-2 Yamada-oka, Suita, Osaka 565-0871, Japan
Correspondence to: H. Fujiwara
| Abstract |
|---|
|
|
|---|
While IL-12 administration induces tumor regression through stimulating T cells in tumor-bearing mice, this IL-12 effect is observed in some but not all tumor models. The present study aimed to compare IL-12 responsiveness of T cells from tumor-bearing mice in IL-12-responsive (CSA1M and OV-HM) and -unresponsive (Meth A) tumor models. Tumor regression in IL-12-responsive tumor models required the participation of T cells, but not of NK1.1+ cells. Because a NK1.1+ cell population was the major producer of IFN-
, comparable levels of IFN-
production were induced in IL-12-responsive and -unresponsive tumor-bearing mice. This indicates that the amount of IFN-
produced in tumor-bearing individuals does not correlate with the anti-tumor efficacy of IL-12. In contrast, IL-12 responsiveness of T cells differed between the responsive and unresponsive models: purified T cells from CSA1M/OV-HM-bearing or Meth A-bearing mice exhibited high or low IL-12 responsiveness respectively, when evaluated by the amounts of IFN-
produced in response to IL-12. T cells from CSA1M- or OV-HM-bearing but not from Meth A-bearing mice exhibited enhanced levels of mRNA for the IL-12 receptor (IL-12R). These results indicate that a fundamental difference exists in IL-12 responsiveness of T cells between IL-12-responsive and -unresponsive tumor models, and that such a difference is associated with the expression of IL-12R on T cells.
Keywords: IL-12, NK cells, tumor models
| Introduction |
|---|
|
|
|---|
IL-12 has pleiotropic effects on T cells and NK cells (1,2), including the stimulation of lymphokine secretion, especially of IFN-
production (3,4). In contrast to NK cell reactivity, the responsiveness of T cells to IL-12 emerges only after TCR is triggered (57), indicating that NK cells and antigen-sensitized T cells are the targets for IL-12. Through acting on these lymphoid cell populations, this cytokine has been shown to exhibit potent anti-tumor activity in a number of murine tumor models (810).
Regarding cellular mechanisms underlying the IL-12-mediated anti-tumor effects, it has been shown that IL-12 exhibits potent anti-tumor efficacy through activating T cells (810) or NK/NKT (NK1.1+CD3+) cells (11,12). However, IL-12-induced regression of solid tumors requires the participation of T cells and the production of IFN-
because tumor regression is not induced in nude mice (8) and T cell-depleted recipient mice (9,10) following IL-12 treatment, and is completely inhibited by neutralization of IFN-
produced following IL-12 treatment (9,10). While the anti-tumor effect of IL-12 is observed in some but not in all tumor models (13,14), this does not depend simply on the amounts of IFN-
produced following IL-12 treatment. For example, nude mice that fail to induce tumor regression produce a large amount of IFN-
following IL-12 administration (15). Thus, the differential anti-tumor efficacy of IL-12 that is seen among various tumor models should be considered by examining IL-12 responsiveness of T cells from tumor-bearing mice.
In the present study, a comparison was made in IL-12 responsiveness of T cells as assessed by IFN-
production in various tumor models, i.e. two IL-12-responsive (CSA1M and OV-HM) and one IL-12-unresponsive (Meth A) tumor models. The results show that comparable amounts of IFN-
were produced following IL-12 administration irrespective of whether mice bore an IL-12-responsive or -unresponsive tumor and that IFN-
production was largely mediated by NK1.1+ but not by T cells. However, IL-12 responsiveness of T cells differed between IL-12-responsive and -unresponsive models. Purified T cells from CSA1M- or OV-HM-bearing mice produced large amounts of IFN-
in response to IL-12, but T cells from Meth A-bearing mice produced only small amounts of IFN-
. Such a differential IL-12 responsiveness was associated with the high and low levels of IL-12 receptor (IL-12R) mRNA expression on T cells from CSA1M/OV-HM- and Meth A-bearing mice respectively. The results indicate that the anti-tumor efficacy of IL-12 is not determined simply by the capacity of this cytokine to stimulate IFN-
production in whole individuals but correlates with whether T cells from tumor-bearing mice exhibit IL-12 responsiveness including IL-12R expression.
| Methods |
|---|
|
|
|---|
Tumor cell lines
The following three tumor cell lines were used: CSA1M fibrosarcoma (16), OV-HM ovarian carcinoma (17) and Meth A fibrosarcoma. CSA1M and OV-HM tumors were kindly provided by Dr Takato O. Yoshida (Hamamatsu University School of Medicine, Hamamatsu, Japan) and Dr Ohtsura Niwa (Kyoto University, Kyoto, Japan). These tumor cell lines were maintained in RPMI 1640 supplemented with 10% FCS at 37°C in a humidified atmosphere with 5% CO2. Meth A tumor was maintained by i.p. passages in syngeneic BALB/c mice.
Mice
Male BALB/c and female (C57BL/6xC3H/He)F1 (B6C3F1) mice were obtained from Shizuoka Experimental Animal Center (Hamamatsu, Japan) and used at 69 weeks of age.
Preparation of tumor-bearing mice
Mice were inoculated s.c. with CSA1M (1x106/mouse), OV-HM (5x105/mouse) or Meth A (5x105/mouse) tumor cells.
IL-12 treatment
Mice were injected i.p. with rIL-12 in a dose of 0.5 µg/mouse once daily for 3 days unless otherwise indicated.
Reagents
Mouse rIL-12 was provided from Genetics Institute (Cambridge, MA). Anti-mouse CD4 (GK1.5), anti-mouse CD8 (2.43) and anti-NK1.1 (PK136) hybridomas were obtained from ATCC (Rockville, MD). Each mAb was prepared from ascitic fluid of hybridoma cells. The purification was performed by precipitation with ammonium sulfate followed by YFLC gel filtration (Yamazen, Osaka, Japan). Control rat IgG was obtained from BioMeda (Foster City, CA).
Preparation of a purified T cell population by positive selection
Spleen cells were labeled with superparamagnetic microbeads conjugated to rat anti-mouse Thy1.2 mAb (Miltenyi Biotec, Sunnyvale, CA). Labeled cells were separated from unlabeled cells by magnetic cell sorting using the MiniMACS (Miltenyi Biotec) according to the procedure described in detail (18). The magnetically labeled cells were retained in a MiniMACS column inserted into a MiniMACS magnet while the unlabeled cells passed through. Labeled cells were eluted after the column was removed from the magnet.
IFN-
production by unfractionated spleen cells or purified T cells
Unfractionated spleen cells (4x106/well) or purified T cells (4x106/well) were cultured with various doses of rIL-12 in 24-well culture plates (Corning 25820; Corning Glass Works, Corning, NY). After 48 h, supernatants were harvested and stored at 40°C until use.
Measurement of IFN-
concentration
IFN-
concentration was measured by ELISA: mouse IFN-
ELISA kits were purchased from Genzyme (Cambridge, MA), and our own ELISA system was prepared using two types of anti-mouse IFN-
mAb [XMG1.2 (Endogen, Cambridge, MA)] and biotinylated R4-6A2 (R4-6A2 was purified from R4-6A2 hybridoma and biotinylated in our laboratory)] as well as mouse rIFN-
provided from Shionogi (Osaka, Japan).
cDNA probes for IL-12Rß1 and ß2 subunits
cDNA probes for IL-12R ß chains (12Rß1 and 12Rß2) were cloned from mouse whole spleen cells. Total RNA was isolated from mouse whole spleen cells that were treated for 48 h with 2 µg/ml concanavalin A. The RNA was then used as a template for first-strand cDNA synthesis. The mouse IL-12R cDNA fragments were cloned from this cDNA by use of Taq DNA polymerase, standard PCR conditions, and a 5' sense oligonucleotide GTTGAGAAGACATCGTTCCC and a 3' anti-sense oligonucleotide TCCAGTTGTACAGGTACTGG based on sequence 152171 and 475494 respectively, from the sequence of mouse IL-12Rß1 (19), as well as a 5' sense oligonucleotide TGAAATCAGGGTGCATGCAC and a 3' anti-sense oligonucleotide GTTTGCTGGATCTGGAATGG based on sequence 16681687 and 21772196 respectively from the sequence of mouse IL-12Rß2 (20). The PCR products were purified by agarose gel electrophoresis and ligated to the vector as described (21). Briefly, Bluescript (Stratagene, La Jolla, CA) plasmid was digested with EcoRV and incubated with Taq polymerase with the use of standard buffer conditions in the presence of 2 mM dTTP for 2 h at 70°C. After phenol extraction and precipitation, the T-vector was ready for cloning. PCR products were then ligated to the vector.
Measurement of mRNA expression
Total cellular RNA was isolated by the acid guanidium thiocyanatephenolchloroform method and mRNA levels were determined using the RNase protection assay according to the procedure as described (22). Briefly, 10 µg of total cellular RNA was hybridized in solution to a 32P-labeled antisense riboprobe for 16 h at 50°C in 80% formamide. The riboprobe prepared from the IL-12Rß1 or ß2 plasmid was linearized with HindIII (IL-12Rß1) or NdeI (IL-12Rß2) and in vitro transcription was initiated in the presence of [
-32P]UTP. The protected fragment (343 bp for IL-12Rß1 and 235 bp for IL-12Rß2) was separated on a denaturing sequencing gel followed by autoradiography. As an internal control for the amount of RNA loaded onto the gel, RNA was simultaneously hybridized to antisense 32P-labeled probe for the ß2-microglobulin gene, which yielded a 127 bp protected fragment.
| Results |
|---|
|
|
|---|
Requirement of T cells but not of NK1.1+ cells for IL-12-induced tumor regression
Systemic IL-12 administration has been shown to induce complete tumor regression in the CSA1M fibrosarcoma (BALB/c origin) and OV-HM ovarian carcinoma (B6C3F1 origin) models (7,14,23). We investigated the cellular requirement for IL-12-induced tumor regression. Three i.p. injections of IL-12 induced regression of s.c. growing tumors in both models, but elimination of either CD4+ or CD8+ T cell subset prior to tumor implantation resulted in the abrogation of the anti-tumor efficacy of IL-12 (Fig. 1
|
The effect of NK1.1+ cell depletion was next examined in the OV-HM tumor (B6C3F1 origin) model in which anti-NK1.1 mAb can be used. As shown in Fig. 2
|
NK1.1+ cells are a major population of IFN-
production in IL-12-treated individualsBoth NK1.1+ cells and T cells, especially antigen-sensitized T cells, produce IFN-
in response to IL-12 (3,4). We examined the relative roles of NK1.1+ cells and T cells in IFN-
production in vivo following IL-12 treatment. Elimination of NK1.1+ cells and/or CD4+CD8+ T cells was performed by injection of anti-NK1.1 mAb (3 times) and anti-CD4/CD8 mAb (twice). Normal B6C3F1 mice or OV-HM-bearing mice that had been treated with these mAb were given three injections of rIL-12. Serum was obtained from the mice 6, 12 and 24 h after the third IL-12 treatment. Serum IFN-
levels peaked ~6 h and the levels decreased within 24 h (data not shown). Table 1
levels 6 h after the third IL-12 injection in the groups not treated with mAb or treated with anti-NK1.1 or anti-CD4/anti-CD8 mAb. Elimination of CD4+CD8+ T cells induced a partial decrease (in normal recipients) or did not show a decrease (OV-HM-bearing recipients) in IFN-
production, whereas depletion of NK1.1+ cells resulted in a striking reduction of IFN-
production. This indicates that NK1.1+ cells are largely responsible for IFN-
production induced in vivo following IL-12 administration.
|
IFN-
production by whole individuals and purified T cells in IL-12-responsive and -unresponsive modelsIn contrast to the CSA1M and OV-HM models, IL-12 therapy is not effective in the Meth A (BALB/c origin) model (24). We confirmed this in Fig. 3(A)
produced in normal BALB/c mice or CSA1M- or Meth A-bearing mice following IL-12 treatment. The results show that comparable levels of IFN-
production are observed in these three groups of animals. Consistent with this, unfractionated spleen cells from normal BALB/c mice or CSA1M- or Meth A-bearing mice produced comparable amounts of IFN-
in response to IL-12 (Fig. 5A
. We next examined the capacity of T cells from tumor-bearing mice to respond to IL-12. T cells were purified from spleen cells of normal BALB/c mice or CSA1M- or Meth A-bearing mice and stimulated in vitro with rIL-12. As shown in Fig. 5(B)
in an IL-12 dose-dependent manner. The levels of IFN-
production by purified T cells were apparently lower compared to those induced by unfractionated spleen cells. However, these levels markedly contrasted with low levels of IFN-
production induced by T cells from Meth A-bearing mice as well as normal mice.
|
|
|
IL-12 responsiveness in T cells from OV-HM-bearing B6C3F1 mice was also examined in comparison with those from CSA1M- or Meth A-bearing BALB/c mice (Fig. 6
production in response to a lower concentration (10 pg/ml) of IL-12. T cells from OV-HM-bearing mice displayed more potent IFN-
production. When T cells were separated from spleen cells of OV-HM-bearing mice which had been treated with anti-NK1.1 mAb to eliminate NK1.1+ cells, similar levels of IL-12 responsiveness to those shown in Fig. 6
production mediated largely by NK1.1+ cells in whole tumor-bearing individuals does not differ between IL-12-responsive and -unresponsive models, there exists a substantial difference in IL-12 responsiveness of T cells from tumor-bearing mice between these two types of models.
|
Differential expression of IL-12Rß1 subunit mRNA on T cells from tumor-bearing mice between IL-12-responsive and -unresponsive models
To examine the expression of IL-12R on T cells in various tumor models, purified T cell populations were prepared from splenocytes of OV-HM-, CSA1M- and Meth A-bearing mice. Total RNA was isolated from these T cell populations and subjected to the RNase protection assay. The expression of mRNAs for IL-12Rß1 and ß2 subunits on T cells in OV-HM-, CSA1M- and Meth A-bearing mice is shown in Fig. 7(A)
|
Induction of IL-12 responsiveness and IL-12R mRNA expression in splenic T cells from mice immunized in vivo with Meth A tumor cells
The observations that IL-12 treatment is not effective in the Meth A model (Fig. 3A
Additional experiments were performed to compare the immunogenicity of CSA1M and Meth A as evaluated by the inducibility of anti-tumor immunity. BALB/c mice were immunized with different doses of MMC-treated CSA1M or Meth A cells and challenged with 106 CSA1M or 2x105 Meth A cells. These tumor cell numbers for the challenge were determined based on the fact that they were the minimum cell numbers for giving nearly 100% tumor take in normal BALB/c mice. As shown in Table 2
, there was no substantial difference in the inducibility of anti-CSA1M and anti-Meth A protective immunity following the immunization with different doses of the relevant tumor cells. Thus, the results suggest comparable levels of immunogenicity in these two types of tumors.
|
CSA1M-immunized BALB/c mice were prepared in a similar protocol to that used for the preparation of Meth A-immunized mice. T cell populations were prepared from these CSA1M- and Meth A-immunized and unimmmunized normal BALB/c mice and examined for IL-12 responsiveness. Figure 8(A)
in response to IL-12 although slightly lower when compared to the amounts of IFN-
produced by T cells from CSA1M-immunized mice. Consistent with this, T cells prepared from CSA1M- or Meth A-immunized BALB/c mice exhibited comparable levels of enhanced expression of both IL-12Rß1 and ß2 mRNAs (Fig. 7B
production between these two types of T cell populations. Thus, these results indicate that Meth A tumor cells per se have the capacity to induce an anti-Meth A immune response including the expression of IL-12R expression, whereas the development of such an immune response is prevented in the tumor-bearing state.
|
| Discussion |
|---|
|
|
|---|
The present study shows that IFN-
production in vivo following IL-12 treatment is induced similarly in IL-12-curable (responsive) and IL-12-incurable (unresponsive) tumor models because NK1.1+ cells are responsible for a large portion of IFN-
production. However, a substantial difference exists in IL-12-stimulated IFN-
production of T cells between these two types of models: purified T cells from tumor-bearing mice in the former and latter models exhibit high and low IL-12 responsiveness respectively. Such a differential responsiveness is associated with the mRNA levels of IL-12R expressed on T cells. Considering that IL-12-induced tumor regression depends on the participation of T cells (6,7 and this study) and their IL-12 responsiveness including IFN-
production (7,14), the present results provide an aspect of explanation for the differential anti-tumor efficacy of IL-12 in various tumor models. Cellular mechanisms underlying the anti-tumor effects mediated by IL-12 have been investigated in a number of tumor models (812). Initially, the majority work has indicated that the involvement of T cells is critical (810), whereas IL-12 retains its anti-tumor efficacy in NK-depleted mice (8). Subsequently, other studies (11,12) have shown that IL-12 exhibits potent anti-tumor efficacy through activating NK cells or NKT (NK1.1+CD3+) cells. Although both lines of studies appear to be contradictory, they may be reconciled after careful evaluation of the results. In the latter studies, the IL-12 effect was demonstrated by inhibiting the growth of metastasizing tumor cells in the liver and lung. In contrast, IL-12-mediated NK cell activation is not sufficient to induce regression of primary tumor masses as shown in this study. T cells are absolutely required because tumor regression is not induced in nude mice (8) or T cell-depleted recipient mice (9,10 and this study) following IL-12 treatment.
Among various IL-12 bioactivities (reviewed in 1,2), the critical requirement of IFN-
was shown for the IL-12-induced regression of solid tumors, because tumor regression was completely inhibited by neutralization of IFN-
produced following IL-12 treatment (9,10). However, it was shown that the amount of IFN-
produced in tumor-bearing mice does not correlate with the degree of the IL-12 efficacy (15). In fact, nude mice incapable of inducing tumor regression produced large amounts of IFN-
following IL-12 administration irrespective of whether they bear tumors (15). Consistent with this, the present study demonstrated that NK1.1+ cells, but not T cells, produce a large portion of IFN-
following IL-12 injections, and that normal mice and tumor-bearing mice, irrespective of the type of tumors they bear, show comparable levels of IFN-
production. The fact that T cells producing smaller amounts of IFN-
have an obligatory role in IL-12-induced tumor regression needs a consideration of how T cells and IFN-
function for anti-tumor effects in concert.
Our previous studies have shown that administration of IL-12 in the CSA1M and OV-HM but not in Meth A tumor models induces tumor regression that is associated with T cell migration to tumor sites (10,13,14). In the former two IL-12-responsive models, IL-12 was demonstrated to up-regulate the capacity of T cells to migrate to tumor sites (24,26). Our results also illustrated that IFN-
produced by tumor-infiltrating T cells plays important roles in mediating various pathways of anti-tumor effects including the activation of cytotoxic T lymphocyte and macrophages (14,27). Thus, our series of studies show that tumor regression is induced by IL-12-responsive T cells which migrate to tumor sites and produce there IFN-
required for the activation of intratumoral anti-tumor effector mechanisms. These results account for the above-mentioned cooperation of T cells and IFN-
, and indicate that the anti-tumor efficacy of IL-12 depends on IL-12 responsiveness of T cells.
An important aspect of the present study concerns the differential IL-12 responsiveness of T cells in various tumor models. In two IL-12-responsive tumor (OV-HM and CSA1M) models, purified T cells exhibited IL-12 responsiveness upon stimulation with >10 pg/ml rIL-12. In contrast, T cells purified from Meth A (an IL-12-unresponsive tumor)-bearing mice failed to respond to 10 pg/ml rIL-12 and showed apparently reduced levels of responsiveness even after stimulation with higher doses (1001000 pg/ml) of rIL-12. Thus, while IFN-
production induced in whole individuals (mainly by NK1.1+ cells) takes place similarly in IL-12-responsive and -unresponsive models, T cell-mediated IFN-
production following IL-12 stimulation differs substantially in these two types of models. It may be reasonable to consider that T cells in IL-12-unresponsive tumor-bearing mice fail to acquire IL-12 responsiveness, including the capacities to migrate to tumor masses as well as to produce IFN-
.
Further, the present results showed that differential IL-12 responsiveness of T cells correlates with the mRNA levels of IL-12R expressed in T cells. Whereas resting NK cells can respond to IL-12, resting T cells are unable to show IL-12 responsiveness. When T cells (TCR and CD28) are stimulated with antigen plus antigen-presenting cells (APC), IL-12Rß1 and ß2 subunits are induced on these antigen-sensitized T cells (6) and they exhibit IL-12 responsiveness (7). Therefore, the expression of IL-12Rß1 and ß2 on the T cell represents its sensitization to antigen. Splenic T cells in normal mice express low but detectable levels of IL-12Rß1 and ß2, suggesting that the expression of these is due to basal levels of immune responses in normal mice. T cells harvested from CSA1M- and OV-HM-bearing mice expressed enhanced levels of IL-12Rß1 and ß2 mRNAs. The results obtained in our previous studies (25,29) demonstrated that spleen cells from tumor-bearing mice contain APC presenting processed tumor antigens and T cells sensitized to tumor antigens. Together with these previous observations, our present findings suggest that a portion of splenic T cells from tumor-bearing mice in the IL-12-responsive tumor models express IL-12ß1 and ß2 as a result of their sensitization to tumor antigens.
In contrast, T cells from Meth A (an IL-12-unresponsive tumor)-bearing mice failed to exhibit enhanced levels of IL-12R expression. The induction of IL-12 responsiveness/IL-12R expression requires antigen sensitization of T cells. The failure to induce IL-12 responsiveness/IL-12R expression in Meth A-bearing mice would not be ascribed to the lack of immunogenicity in the Meth A tumor, because similar levels of immunogenicity were observed in CSA1M and Meth A (Table 2
). Consistent with this, immunization with MMC-treated Meth A tumor cells resulted in IL-12 responsiveness including IL-12R expression. However, IL-12 responsiveness was generated minimally in Meth A-bearing mice. Moreover, IL-12 treatment capable of stimulating NK/NKT cells for IFN-
production did not induce IL-12 responsiveness in T cells: T cell from IL-12-treated Meth A-bearing mice did not exhibit enhanced levels of IFN-
production in vitro when compared to T cells from untreated Meth A-bearing mice (our unpublished results). An essential question remains to be solved why an anti-tumor T cell response leading to IL-12R induction does not develop in Meth A tumor-bearing mice despite the existence of immunogenicity in the Meth A tumor.
The biologic activities of IL-12 are mediated through the high-affinity IL-12R, which is composed of IL-12Rß1 and ß2 chains (20). The importance of IL-12Rß2 in IL-12 signaling has been documented by two reports which showed that loss of IL-12 responsiveness by Th2 cells is related to down-regulation of the IL-12Rß2 subunit (30,31). Recently, this down-regulation was shown to be mediated by low doses of transforming growth factor (TGF)-ß (32). IL-12Rß1 is also necessary for IL-12 signaling (33). Nevertheless, the role of IL-12Rß1 in IL-12-mediated signal transduction is less well defined. TGF-ß was also reported to down-regulate the expression of IL-12Rß1 (34). However, such an attenuating effect is partial compared to that on the expression of IL-12Rß2. Moreover, the cytokine-mediated regulation of IL-12Rß1 and ß2 expression is considered to be more complex because additional cytokines such as IL-10 and IL-4 also have regulatory effects (32,34), and TGF-ß exhibits bimodal effects with low and high concentrations exerting distinct physiologic effects (32,35,36). In the present study, the lack of up-regulation of IL-12R was observed in the IL-12-unresponsive tumor model. Further studies will be required to investigate the mechanisms underlying the failure to induce the expression of IL-12R in such a tumor model. This line of investigation could contribute to a better understanding of why the anti-tumor efficacy of IL-12 differs depending on the tumor model studied and to attempting enhanced induction of IL-12 responsiveness through correcting the failure of IL-12R up-regulation.
| Acknowledgments |
|---|
The authors are grateful to Dr John Leonard for critical reviewing of this paper, and Miss Tomoko Katsuta and Miss Mari Yoneyama for secretarial assistance. This work was supported by Grants-in-Aid for Scientific Research from the Ministry of Education, Science and Culture, Japan.
| Abbreviations |
|---|
| APC antigen-presenting cell |
| MMC mitomycin C |
| IL-12R IL-12 receptor |
| TGF transforming growth factor |
| Notes |
|---|
Transmitting editor: T. Saito
Received 22 September 1999, accepted 3 February 2000.
| References |
|---|
|
|
|---|
-
Trinchieri, G. 1994. Interleukin-12: a cytokine produced by antigen-presenting cells with immunoregulatory functions in the generation of T-helper cells type 1 and cytotoxic lymphocytes. Blood 84:4008.
[Free Full Text] - Brunda, M. J. 1994. Interleukin-12. J. Leuk. Biol. 55:280.[Abstract]
-
Kobayashi, M., Fitz, L., Ryan, M., Hewick, R. M., Clark, S. C., Chan, S., Loudon, R., Sherman, F., Perussia, B. and Trinchieri, G. 1989. Identification and purification of natural killer cell stimulatory factor (NKSF), a cytokine with multiple biologic effects on human lymphocytes. J. Exp. Med. 170:827.
[Abstract/Free Full Text] -
Chan, S. H., Perussia, B., Gupta, J. W., Kobayashi, M., Pospisil, M., Young, H. A., Wolf, S. F., Young, D., Clark, S. C. and Trinchieri, G. 1991. Induction of interferon
production by natural killer cell stimulatory factor: characterization of the responder cells and synergy with other inducers. J. Exp. Med. 173:869.[Abstract/Free Full Text] - Desai, B. B., Quinn, P. M., Wolitzky, A. G., Mongini, P. K., Chizzonite, R. and Gately, M. K. 1992. IL-12 receptor. II. Distribution and regulation of receptor expression. J. Immunol. 148:3125.[Abstract]
-
Igarashi, O., Yamane, H., Imajoh-Ohmi, S. and Nariuchi, H. 1998. IL-12 receptor (IL-12R) expression and accumulation of IL-12R ß1 and IL-12R ß2 mRNAs in CD4+ T cells by costimulation with B7-2 molecules. J. Immunol. 160:1638.
[Abstract/Free Full Text] -
Tomura, M., Maruo, S., Mu, J., Zhou, X. Y., Ahn, H. J., Hamaoka, T., Okamura, H., Nakanishi, K., Clark, S., Kurimoto, M. and Fujiwara, H. 1998. Differential capacities of CD4+, CD8+, and CD4CD8 T cell subsets to express IL-18 receptor and produce IFN-
in response to IL-18. J. Immunol. 160:3759.[Abstract/Free Full Text] -
Brunda, M. J., Luistro, L., Warrier, R. R., Wright, R. B., Hubbard, B. R., Murphy, M., Wolf, S. F. and Gately, M. K. 1993. Antitumor and antimetastatic activity of interleukin 12 against murine tumors. J. Exp. Med. 178:1223.
[Abstract/Free Full Text] -
Nastala, C. L., Edington, H. D., McKinney, T. G., Tahara, H., Nalesnik, M. A., Brunda, M. J., Gately, M. K., Wolf, S. F., Schreiber, R. D., Storkus, W. J. and Lotze, M. T. 1994. Recombinant IL-12 administration induces tumor regression in association with IFN-
production. J. Immunol. 153:1697.[Abstract]
-
Zou, J. P., Yamamoto, N., Fujii, T., Takenaka, H., Kobayashi, M., Herrmann, S. H., Wolf, S. F., Fujiwara, H. and Hamaoka, T. 1995. Systemic administration of rIL-12 induces complete tumor regression and protective immunity: response is correlated with a striking reversal of suppressed IFN-
production by anti-tumor T cells. Int. Immunol. 7:1135.[Abstract/Free Full Text] -
Takeda, K., Seki, S., Ogasawara, K., Anzai, R., Hashimoto, W., Sugiura, K., Takahashi, M., Satoh, M. and Kumagai, K. 1996. Liver NK1.1+ CD4+
ß T cells activated by IL-12 as a major effector in inhibition of experimental tumor metastasis. J. Immunol. 156:3366.[Abstract]
-
Cui, J., Shin, T., Kawano, T., Sato, H., Kondo, E., Toura, I., Kaneko, Y., Koseki, H., Kanno, M. and Taniguchi, M. 1997. Requirement for V
14 NKT cells in IL-12-mediated rejection of tumors. Science 278:1623.[Abstract/Free Full Text] -
Yu, W. G., Yamamoto, N., Takenaka, H., Mu, J., Tai, X. G., Zou, J. P., Ogawa, M., Tsutsui, T., Wijesuriya, R., Yoshida, R., Herrmann, S., Fujiwara, H. and Hamaoka, T. 1996. Molecular mechanisms underlying IFN-
-mediated tumor growth inhibition induced during tumor immunotherapy with rIL-12. Int. Immunol. 8:855.[Abstract/Free Full Text] - Fujiwara, H., Clark, S. C. and Hamaoka, T. 1996. Cellular and molecular mechanisms underlying IL-12-induced tumor regression. Ann. NY Acad. Sci. 795:294.[Medline]
-
Brunda, M. J., Luistro, L., Hendrzak, J. A., Fountoulakis, M., Garotta, G. and Gately, M. K. 1995. Role of interferon-
in mediating the antitumor efficacy of interleukin-12. J. Immunother. Emphasis Tumor Immunol. 17:71.[Medline]
- Yoshida, T. O., Haraguchi, S., Miyamoto, H. and Matsuo, T. 1979. Recognition of RSV-induced tumor cells in syngeneic mice and semisyngeneic reciprocal hybrid mice. Gann Monogr. Cancer Res. 23:201.
- Hashimoto, M., Niwa, O., Nitta, Y., Takeichi, M. and Yokoro, K. 1989. Unstable expression of E-cadherin adhesion molecules in metastatic ovarian tumor cells. Jpn. J. Cancer Res. 80:459.[Web of Science][Medline]
- Miltenyi, S., Muller, W., Weichel, W. and Radbruch, A. 1990. High gradient magnetic cell separation with MACS. Cytometry 11:231.[Web of Science][Medline]
- Chua, A. O., Wilkinson, V. L., Presky, D. H. and Gubler, U. 1995. Cloning and characterization of a mouse IL-12 receptor-ß component. J. Immunol. 155:4286.[Abstract]
-
Presky, D. H., Yang, H., Minetti, L. J., Chua, A. O., Nabavi, N., Wu, C. Y., Gately, M. K. and Gubler, U. 1996. A functional interleukin 12 receptor complex is composed of two ß-type cytokine receptor subunits. Proc. Natl Acad. Sci. USA 93:14002.
[Abstract/Free Full Text] -
Marchuk, D., Drumm, M., Saulino, A. and Collins, F. S. 1991. Construction of T-vectors, a rapid and general system for direct cloning of unmodified PCR products. Nucleic Acids Res. 19:1154.
[Free Full Text] -
Wilson, K. C. and Finbloom, D. S. 1992. Interferon
rapidly induces in human monocytes a DNA-binding factor that recognizes the
response region within the promoter of the gene for the high-affinity Fc
receptor. Proc. Natl Acad. Sci. USA 89:11964.[Abstract/Free Full Text] -
Mu, J., Zou, J. P., Yamamoto, N., Tsutsui, T., Tai, X. G., Kobayashi, M., Herrmann, S., Fujiwara, H. and Hamaoka, T. 1995. Administration of recombinant interleukin 12 prevents outgrowth of tumor cells metastasizing spontaneously to lung and lymph nodes. Cancer Res. 55:4404.
[Abstract/Free Full Text] -
Ogawa, M., Tsutsui, T., Zou, J. P., Mu, J., Wijesuriya, R., Yu, W. G., Herrmann, S., Kubo, T., Fujiwara, H. and Hamaoka, T. 1997. Enhanced induction of very late antigen 4/lymphocyte function-associated antigen 1-dependent T-cell migration to tumor sites following administration of interleukin 12. Cancer Res. 57:2216.
[Abstract/Free Full Text] - Shimizu, J., Zou, J. P., Ikegame, K., Katagiri, T., Fujiwara, H. and Hamaoka, T. 1991. Evidence for the functional binding in vivo of tumor rejection antigens to antigen-presenting cells in tumor-bearing hosts. J. Immunol. 146:1708.[Abstract]
-
Ogawa, M., Yu, W. G., Umehara, K., Iwasaki, M., Wijesuriya, R., Tsujimura, T., Kubo, T., Fujiwara, H. and Hamaoka, T. 1998. Multiple roles of interferon-
in the mediation of interleukin 12-induced tumor regression. Cancer Res. 58:2426.[Abstract/Free Full Text] -
Yu, W. G., Ogawa, M., Mu, J., Umehara, K., Tsujimura, T., Fujiwara, H. and Hamaoka, T. 1997. IL-12-induced tumor regression correlates with in situ activity of IFN-
produced by tumor-infiltrating cells and its secondary induction of anti-tumor pathways. J. Leuk. Biol. 62:450.[Abstract]
- Zou, J. P., Shimizu, J., Ikegame, K., Yamamoto, N., Ono, S., Fujiwara, H. and Hamaoka, T. 1992. Tumor-bearing mice exhibit a progressive increase in tumor antigen-presenting cell function and a reciprocal decrease in tumor antigen-responsive CD4+ T cell activity. J. Immunol. 148:648.[Abstract]
-
Yamamoto, N., Zou, J. P., Li, X. F., Takenaka, H., Noda, S., Fujii, T., Ono, S., Kobayashi, Y., Mukaida, N., Matsushima, K., Fujiwara, H. and Hamaoka, T. 1995. Regulatory mechanisms for production of IFN-
and TNF by antitumor T cells or macrophages in the tumor-bearing state. J. Immunol. 154:2281.[Abstract]
-
Szabo, S. J., Dighe, A. S., Gubler, U. and Murphy, K. M. 1997. Regulation of the interleukin (IL)-12R ß2 subunit expression in developing T helper 1 (Th1) and Th2 cells. J. Exp. Med. 185:817.
[Abstract/Free Full Text] -
Rogge, L., Barberis-Maino, L., Biffi, M., Passini, N., Presky, D. H., Gubler, U. and Sinigaglia, F. 1997. Selective expression of an interleukin-12 receptor component by human T helper 1 cells. J. Exp. Med. 185:825.
[Abstract/Free Full Text] -
Gorham, J. D., Guler, M. L., Fenoglio, D., Gubler, U., and Murphy, K. M. 1998. Low dose TGF-ß attenuates IL-12 responsiveness in murine Th cells. J. Immunol. 161:1664.
[Abstract/Free Full Text] - Wu, C., Ferrante, J., Gately, M. K. and Magram, J. 1997. Characterization of IL-12 receptor ß1 chain (IL-12Rß1)-deficient mice: IL-12Rß1 is an essential component of the functional mouse IL-12 receptor. J. Immunol. 159:1658.[Abstract]
- Wu, C., Warrier, R. R., Wang, X., Presky, D. H. and Gately, M. K. 1997. Regulation of interleukin-12 receptor ß1 chain expression and interleukin-12 binding by human peripheral blood mononuclear cells. Eur. J. Immunol. 27:147.[Web of Science][Medline]
- Battegay, E. J., Raines, E. W., Seifert, R. A., Bowen-Pope, D. F. and Ross, R. 1990. TGF-ß induces bimodal proliferation of connective tissue cells via complex control of an autocrine PDGF loop. Cell 63:515.[Web of Science][Medline]
-
Centrella, M., McCarthy, T. L. and Canalis, E. 1987. Transforming growth factor ß is a bifunctional regulator of replication and collagen synthesis in osteoblast-enriched cell cultures from fetal rat bone. J. Biol. Chem. 262:2869.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
Y. Uekusa, P. Gao, N. Yamaguchi, M. Tomura, T. Mukai, C. Nakajima, M. Iwasaki, N. Takeuchi, T. Tsujimura, M. Nakazawa, et al. A role for endogenous IL-12 in tumor immunity: IL-12 is required for the acquisition of tumor-migratory capacity by T cells and the development of T cell-accepting capacity in tumor masses J. Leukoc. Biol., November 1, 2002; 72(5): 864 - 873. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Segal, N. C. Lee, Y. L. Tsung, J. A. Norton, and K. Tsung The Role of IFN-{gamma} in Rejection of Established Tumors by IL-12 : Source of Production and Target Cancer Res., August 15, 2002; 62(16): 4696 - 4703. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Uekusa, W.-G. Yu, T. Mukai, P. Gao, N. Yamaguchi, M. Murai, K. Matsushima, S. Obika, T. Imanishi, Y. Higashibata, et al. A Pivotal Role for CC Chemokine Receptor 5 in T-Cell Migration to Tumor Sites Induced by Interleukin 12 Treatment in Tumor-bearing Mice Cancer Res., July 1, 2002; 62(13): 3751 - 3758. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. N. Le, N. C. Lee, K. Tsung, and J. A. Norton Pre-Existing Tumor-Sensitized T Cells Are Essential for Eradication of Established Tumors by IL-12 and Cyclophosphamide Plus IL-12 J. Immunol., December 15, 2001; 167(12): 6765 - 6772. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||










