Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Nagata, K.
Right arrow Articles by Irimura, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nagata, K.
Right arrow Articles by Irimura, T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 12, No. 4, 487-492, April 2000
© 2000 Japanese Society for Immunology

Redistribution of selectin counter-ligands induced by cytokines

Kisaburo Nagata1,4, Tsutomu Tsuji1,5, Kouji Matsushima2, Nobuo Hanai3 and Tatsuro Irimura1

1 Laboratory of Cancer Biology and Molecular Immunology, Graduate School of Pharmaceutical Sciences, and
2 Department of Molecular Preventive Medicine, School of Medicine, University of Tokyo, 7-3-1- Hongo, Bunkyo-ku, Tokyo 113-0033, Japan
3 Tokyo Research Laboratories, Kyowa Hakko Kogyo Co. Ltd, Machida, Tokyo 194-0023, Japan

Correspondence to: T. Irimura


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Soluble recombinant (r) P-selectin and rP-selectin immobilized on plastic surfaces were tested for their capacity to activate neutrophils to produce superoxide anion. Soluble rP-selectin was incapable of activating leukocytes, whereas immobilized rP-selectin was able to induce leukocyte activation. When neutrophils were pretreated with a low dose of IL-8, granulocyte colony stimulating factor or granulocyte macrophage colony stimulating factor, soluble rP-selectin was no longer inert. These cytokine-primed leukocytes produced superoxide anion in the presence of soluble rP-selectin. During this priming period, sialyl Lewis X (sLeX) epitopes redistributed to one end of the leukocytes. Similar polarization of sLeX epitopes was observed at the attachment site of cells that adhered to immobilized rP-selectin. Cap formation and superoxide anion production induced by solid-phase P-selectin or by IL-8 and soluble rP-selectin treatment were inhibited by treatment of the leukocytes with cytochalasin B. These observations suggest that the redistribution of the carbohydrate ligands and the polarization of the leukocyte surface through an active process is a prerequisite but not sufficient to leukocyte superoxide production through P-selectin.

Keywords: neutrophils, selectin ligand, sialyl Lewis X, superoxide anion


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Neutrophils undergo activation and differentiation in the presence of soluble extracellular stimuli such as cytokines and activated complement components or organized structures such as the surface of other cells and extracellular matrices. We showed that neutrophils adhered to activated platelets led to the activation of leukocytes and generated the extracellular superoxide anion (13). The signal for this activation was found to be sent through P-selectin (CD62P, GMP-140 or PADGEM) expressed on activated platelets and the sialyl LewisX (sLeX) carbohydrate structure of cell surface receptors on neutrophils. Adhesion between neutrophils and activated platelets or endothelial cells is known to play a crucial role in the recruitment of leukocytes into inflammatory and hemorrhagic sites as shown by many investigators (46). P-selectin-dependent platelet adhesion to neutrophils and monocytes induced the production of superoxide anion, which suggested that P-selectin functions as an extracellular ligand to activate neutrophils in the initiation and progression of the inflammatory process.

The enhanced release of the oxygen radical from leukocytes caused by activated platelets was blocked by the addition of an antibody directed to the sLeX structure. This blockade suggested that the putative counter-receptor on leukocytes probably contains sLeX carbohydrate chains [sialic acid{alpha}2–3Galß1–4(Fuc{alpha}1–3)GlcNAcß1-R] (sialylated form of CD15). This carbohydrate chain is known to function as a ligand for P- and E-selectin in the initial step of neutrophil adhesion to endothelial cells as initially reported by Polly et al. (7). The structural requirement of carbohydrate chains has been reviewed by Varki (8). Thus, it was likely that P-selectin sent an activation signal, that led to the production and release of superoxide anion, through sLeX on the neutrophil surface. In fact, we have shown that sLeX at the terminus of O-linked carbohydrate chains of 120 and 250 kDa is essential for the initiation of such a cascade (2).

During the course of these studies we observed that soluble recombinant (r) P-selectin did not activate leukocytes but instead blocked the activation of neutrophils by platelets (1). This result was consistent with the earlier findings by Wong et al. that soluble P-selectin inhibits superoxide anion production (9). Two questions were obvious. What is the mechanistic basis for the difference between soluble and immobilized P-selectin? Is there any condition in which soluble P-selectin mediates superoxide anion production? We assumed that the redistribution of the P-selectin ligand (sLeX epitopes) was a prerequisite to leukocyte superoxide production. It was likely that immobilized but not soluble P-selectin induces such a redistribution. A previous study by Lorant et al. suggested that redistribution of P-selectin ligands reduced the cells' adhesion to P-selectin (10). Dorè et al. also found that neutrophil chemoattractants induce relocalization of P-selectin ligand to the uropod (11). However, it was not previously studied whether the redistribution influenced the superoxide production and release by leukocytes.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Reagents
Cytochrome c, superoxide dismutase, cytochalasin B and N-formyl-methionyl-leucyl-phenylalanine (FMLP) were products of Sigma (St Louis, MO). Ficoll was purchased from Pharmacia (Uppsala, Sweden) and Urografin was from Schering (Berlin, Germany). FITC–avidin was from Vector (Burlingame, CA). Human granulocyte macrophage colony stimulating factor (GM-CSF) and macrophage colony stimulating factor (M-CSF) were from R & D System (Minneapolis, MN). rIL-8, which was reported by Yuo et al. to stimulate neutrophils (12), was prepared as described by Furuta et al. (13). Recombinant granulocyte colony stimulating factor (G-CSF) was provided by Dr Hiroshi Miyazaki (Kirin Brewery, Tokyo, Japan).

Antibodies
Biotin-conjugated goat anti-mouse IgM antibody was purchased from the Organon Teknika (West Chester, PA). Monoclonal anti-sLeX antibody (KM93, IgM) developed by Shitara et al. (14) was provided by the Kyowa Hakko Kogyo (Tokyo, Japan). Monoclonal anti-P-selectin antibody (2T60, IgG1) developed by Tanoue et al. (15) was a gift from Dr Kenjiro Tanoue (Tokyo Metropolitan Institute of Medical Science). Monoclonal anti-CD18 (ß2 integrin) antibody (L130, IgG1) was purchased from Becton-Dickinson (Franklin Lakes, NJ).

rP-selectin fusion protein
The cDNA encoding the N-terminal region of P-selectin (amino acid residues 1–282, which include the lectin domain, the epidermal growth factor domain and two short consensus repeats) was amplified from cDNA prepared from the poly(A)+ mRNA of the human megakaryocytic leukemia cell line HEL by PCR using the oligonucleotides AGATCTTGGACTTATCATTACAGCACA and AGATCTTCACTGCACAGCTTTACACACT as primers based on the sequence reported by Johnston et al. (16). The amplified cDNA was inserted into the BamHI site of the Escherichia coli expression vector pGEX-2T (Pharmacia), which contains a glutathione-S-transferase (GST) gene upstream of the insertion site. The sequence of the amplified cDNA was identical to that reported by Johnston et al. (16). The P-selectin–GST fusion protein was produced using E. coli JM109 as a host strain and purified by affinity chromatography on a glutathione–Sepharose (Pharmacia) column according to the manufacturer's instructions. The P-selectin–GST fusion protein thus obtained was functionally active, as determined by an adhesion assay using the myelocytic leukemia cell line, HL-60. The adhesion of HL-60 cells to plastic surfaces coated with the fusion protein was inhibited by the addition of either anti-P-selectin antibody 2T60, anti-sLeX antibody KM93 or EDTA. Electrophoretic analysis in the presence of SDS indicated that the P-selectin–GST fusion protein migrated at a position corresponding to an apparent Mr of 59,800, which was in good agreement with the expected value of GST and truncated P-selectin. The level of bacterial endotoxin in the rP-selectin preparation was lower than 0.7 pg/µg rP-selectin, as determined by the Limulus test using Endotoxin Test Kit (Seikagaku Kogyo, Tokyo, Japan).

Neutrophil preparation
Neutrophils were purified from normal human peripheral blood by the combination of the dextran sedimentation and Ficoll-Urografin (5:1) gradient centrifugation as described previously by Gamble and Vadas (17). The purity of the neutrophil preparations was >90%, as evaluated with May–Grünwald–Giemsa staining. The Trypan blue exclusion assay showed that >99% of the cells were viable.

Measurement of superoxide anion
Superoxide anion produced by neutrophils was determined by the cytochrome c method as described previously by Pick and Mizel (18). Each well in 96-well culture plates was coated with 0.05 ml of rP-selectin solution (0.2–5 µg/ml) in PBS at 4°C for 16 h. The well was then blocked with 0.05 ml of PBS containing 0.5% bovine serum albumin at 4°C for 2 h. After the well was washed with PBS three times, a neutrophil suspension (0.1ml, 2 x 105 cells) was placed in the well. The control experiments without rP-selectin-coating were performed in a BSA-coated plate. In these cases, rP-selectin solution (0.2–5 µg/ml), thrombin-activated platelets (4 x 107 cells) (1), or FMLP (1 µM) was added to the well. After cell suspension was incubated at 22°C for 5 min, 0.1 ml of 0.1 mM cytochrome c was added to each well. The mixture was incubated at 37°C for 90 min. After centrifugation at 250 g for 10 min, the superoxide anion in the supernatant was determined from the change in absorbance at 550 nm caused by the reduction of cytochrome c.

Distribution of sLeX epitopes on neutrophils
The distribution of sLeX epitopes on neutrophils was analyzed with either a laser-scanning confocal microscope (MRC-1024; BioRad, Hercules, CA) or a fluorescence microscope (Nikon, Tokyo, Japan). For the laser-scanning confocal microscopic observation, human neutrophils (1x104 cells, 50 µl) were incubated on rP-selectin (0.1 µg/well)- or BSA (0.1 µg/well)-coated chamber slides for 30 min at 37°C. After fixation with 1% formaldehyde for 10 min, the adherent cells were stained with anti-sLeX antibody (mouse IgM), biotinylated goat anti-mouse IgM and FITC-labeled streptavidin. For the fluorescence microscopic observation, human peripheral blood neutrophils (2x106 cells, 1 ml) were treated with IL-8 (50 ng/ml) and fixed with 10 mM PBS (pH 7.4) containing 1% formaldehyde at 22°C for 10 min. The cells were washed twice with PBS, resuspended in 0.2 ml of PBS containing 0.1% BSA and 0.1% NaN3 (PBS/BSA/NaN3), and incubated with monoclonal anti-sLeX antibody (5 µg/ml) at 0°C for 30 min. After washing with PBS/BSA/NaN3, the cells were treated sequentially with biotinylated goat anti-mouse IgM and then FITC-labeled streptavidin.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
rP-selectin, when immobilized on a solid surface, elicits superoxide anion production in neutrophils in a dose-dependent manner (Fig. 1AGo). Although the maximum level was lower than that induced by activated platelets, the difference between soluble and locally concentrated immobilized rP-selectin was obvious. The increase in the production of superoxide anion by immobilized rP-selectin was inhibited by the addition of an anti-P-selectin antibody (2T60) in a dose-dependent manner (Fig. 1BGo), but not significantly by an anti-CD18 antibody. We assumed that these differential effects on superoxide anion production in neutrophils were due to differences in the distribution of attachment sites of P-selectin on neutrophils bound to soluble rP-selectin as compared with those bound to immobilized rP-selectin. Observation with a laser-scanning confocal microscope indicated that sLeX epitopes were localized at the attachment site of a cell adhered to solid-phase rP-selectin, whereas sLeX epitopes were uniformly distributed on neutrophils cultured in control (BSA-coated) plates (Fig. 2Go). These results suggest that locally concentrated P-selectin induced an accumulation of sLeX epitopes, presumably at the P-selectin binding site on neutrophils.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 1. Induction of superoxide anion release from neutrophils by P-selectin immobilized on solid surfaces. Neutrophils (2x106 cells/ml, 0.1 ml) isolated from human peripheral blood were incubated at 37°C for 90 min in a culture plate coated with soluble rP-selectin at the indicated concentrations (A). The effects of antibodies against P-selectin or CD18 were also examined (B). The superoxide anion release in the supernatant was determined by the cytochrome c method as described in Methods.

 


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 2. Redistribution of sLeX epitopes on neutrophils as analyzed with a confocal microscope. Human peripheral blood neutrophils (1x104 cells) were incubated on rP-selectin (0.1 µg/ml)-coated chamber slides (lower panel) or BSA (0.1 µg/ml)-coated chamber slides (upper panel) for 30 min at 37°C. After fixation with 1% formaldehyde for 10 min, the adherent cells were stained as described in Methods. These stained cells were observed with a laser-scanning confocal microscope. Sequential images, from the bottom to the top of the cell were reconstituted with 3-D graphic software (micro VOXEL) and the reconstituted images were projected in a horizontal direction.

 
In another series of efforts to elucidate the mechanistic difference between the effects of immobilized rP-selectin and those of soluble rP-selectin, we investigated conditions under which soluble P-selectin induced superoxide anion production. Interesting observations were made when leukocytes were pretreated with several cytokines. As shown in Fig. 3Go, neutrophils pretreated with IL-8 produced a high level of superoxide anion when soluble P-selectin was added to the incubation medium. Similar but moderate effects following pretreatment with G-CSF and GM-CSF were also observed. The increase in the superoxide anion production induced by a combination of G-CSF or GM-CSF with rP-selectin was statistically significant (P < 0.01) when compared with the production by neutrophils treated with the respective cytokines alone. In contrast, pretreatment with M-CSF showed no significant effects. The enhanced production of superoxide anion by neutrophils treated with IL-8, G-CSF or GM-CSF in a combination of rP-selectin was almost completely inhibited by an anti-P-selectin antibody (2T60) at a concentration of 40 µg/ml (data not shown). Fig. 4Go shows the dose-response curve of superoxide anion production with cytokines in the combination with soluble rP-selectin. The results demonstrated that IL-8, G-CSF or GM-CSF dose-dependently potentiated superoxide anion production by neutrophils upon treatment with rP-selectin.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 3. Effects of pretreatment of neutrophils with various cytokines on soluble P-selectin-dependent superoxide anion production. Neutrophils (2x106 cells/ml, 1 ml) isolated from human peripheral blood were incubated with IL-8 (50 ng/ml), G-CSF (50 ng/ml), GM-CSF (5 ng/ml) or M-CSF (50 ng/ml) at 37°C for 20 min, then mixed with soluble rP-selectin (at a final concentration of 50 µg/ml) (solid bars) or control buffer (open bars). The mixture was further incubated for 90 min in the presence of 0.05 mM cytochrome c. The superoxide anion released in the supernatant was determined from absorbance at 550 nm.

 


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 4. Potentiating effects of cytokines on soluble P-selectin-induced superoxide anion production by neutrophils. Human peripheral blood neutrophils (2 x 106 cells/ml, 0.1 ml) were incubated with IL-8 (•), G-CSF ({blacksquare}), GM-CSF ({blacktriangleup}), or M-CSF ({blacklozenge}) at indicated concentrations at 37°C for 20 min. Soluble recombinant P-selectin was then added at a final concentration of 50 µg/ml. The mixture was further incubated at 37°C for 90 min in the presence of 50 µg/ml cytochrome c. Control experiments without soluble recombinant P-selectin but with IL-8 ({circ}), G-CSF ({square}), GM-CSF ({triangleup}), or M-CSF ({lozenge}) at a concentration of 200 ng/ml were also performed.

 
We then examined how IL-8 and other cytokines altered the susceptibility of leukocytes to soluble P-selectin. It was previously known that IL-8 induced the expression of a variety of proteins involved in the activation of neutrophils. Pretreatment with IL-8 and other cytokines was for 20 min and transcriptional changes were not likely to occur. Considering that locally concentrated P-selectin activated unprimed neutrophils, we hypothesized that the density of the P-selectin counter-ligands on the surface of neutrophils might change during the short treatment. The distribution of a FITC-labeled anti-sLeX mAb bound on the surfaces of IL-8-treated neutrophils was strikingly different from its distribution on untreated cells (Fig. 5Go). The binding sites segregated and polarized at one position on the surface of most cells. As shown in Table 1Go, a similar but less pronounced capping phenomenon was observed on neutrophils treated with G-CSF or GM-CSF. M-CSF induced cap formation much less often. The percentage of cells with polarized sLeX distribution roughly correlated with their susceptibility to soluble P-selectin for superoxide anion production; this correlation suggested that there was a causal relationship between cap formation and ligand-dependent neutrophil activation. None of the four cytokines altered overall levels of sLeX antigens on the surface, as assessed by flow cytometry (data not shown).



View larger version (66K):
[in this window]
[in a new window]
 
Fig. 5. Redistribution of sLeX epitopes on human neutrophils following treatment with IL-8. Human peripheral blood neutrophils (2x106 cells, 1 ml) were treated with IL-8 under the same conditions as described in Fig. 3Go and fixed with 10 mM PBS (pH 7.4) containing 1% formaldehyde at 22°C for 10 min. The untreated cells (top) or IL-8-treated cells (bottom) were sequentially stained with anti-sLeX antibody (KM-93), biotinylated anti-mouse IgM and FITC-conjugated streptavidin, and then observed with a fluorescence microscope.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Capping of sLeX antigens and soluble rP-selectin-dependent neutrophil activation after cytokine treatments
 
It was shown in experiments using cytochalasin B, an inhibitor of actin polymerization, that the formation of cap-like structures of sLeX epitopes on neutrophils was an active process. As shown in Fig. 6Go, induction of the cap formation of these epitopes by IL-8 was inhibited. Induction by immobilized rP-selectin was also inhibited by this treatment (data not shown). Neutrophils treated with cytochalasin B produced less superoxide anion upon stimulation with P-selectin than did untreated neutrophils (Fig. 7Go); in contrast, the treatment of neutrophils with cytochalasin B did not affect phorbol 12-myristate 13-acetate-induced superoxide anion production. Collectively, these results strongly suggest that the binding of extracellular P-selectin to sLeX carbohydrates on neutrophils generates a signal leading to superoxide anion formation; this occurs when the counter-ligand molecule with sLeX epitopes becomes distributed at one end of the cells through an active, actin-driven process.



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 6. Effect of cytochalasin B on cap formation of sLeX epitopes induced by IL-8. Untreated human peripheral blood neutrophils (2x106 cells/ml, 1 ml) (A) and cytochalasin B-treated neutrophils (0.1 mM, 37°C, 60 min) (B) were incubated with IL-8 (50 ng/ml) and fixed with 10 mM PBS (pH 7.4) containing 1% formaldehyde at 22°C for 10 min. The cells were sequentially stained with anti-sLeX antibody (KM-93), biotinylated anti-mouse IgM and FITC-conjugated streptavidin, then observed with a fluorescence microscope.

 


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 7. Effects of cytochalasin B on superoxide anion production by neutrophils induced by rP-selectin. Untreated human peripheral blood neutrophils (2x106 cells/ml, 1 ml) (open bars) and those treated with cytochalasin B (0.1 mM, 37°C, 60 min) (solid bars) were incubated with IL-8 (50 ng/ml), soluble rP-selectin (50 µg/ml), IL-8 (50 ng/ml) plus soluble rP-selectin (50 µg/ml) or immobilized rP-selectin at 37°C for 90 min. The IL-8 treatment of neutrophils was performed at 37°C for 20 min prior to the addition of rP-selectin. Another set of untreated or cytochalasin B-treated cells was incubated at 37°C for 90 min with phorbol 12-myristate 13-acetate (at a final concentration of 1 µg/ml) as a control experiment. The superoxide anion release in the supernatant was determined by the cytochrome c method as described in Methods.

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
In the present study, rP-selectin was examined to determine its ability to induce superoxide production and release by neutrophils through its interaction with sLeX carbohydrate chains. Solid-phase rP-selectin released superoxide anion from neutrophils, but soluble-phase rP-selectin did not. Several important findings should be highlighted. First, the direct involvement of P-selectin and selectin ligand in the induction of superoxide anion production was shown. Second, the induction process was found to require two distinct signals–the binding of P-selectin to carbohydrate chains on counter-receptor molecules and the redistribution of P-selectin counter-receptor molecules to one end of each leukocyte. From the present study, it became clear that activated platelets and immobilized P-selectin were able to induce both of these changes; in contrast, soluble P-selectin bound to leukocyte surface sLeX epitopes but did not cause redistribution of the binding sites. Several cytokines such as IL-8, G-CSF and GM-CSF, which presumably bound to their receptors but not to P-selectin ligands, induced redistribution of sLeX epitopes. When sLeX epitopes on leukocytes were occupied by P-selectin or when redistribution of the epitopes occurred without bound ligands, neutrophils were not activated. Only when these two events occurred simultaneously was superoxide anion production induced.

The degree of redistribution of sLeX epitopes required for this activation seemed to be extensive. When leukocytes were incubated with immobilized P-selectin or with IL-8, almost all sLeX epitopes moved to one end of each cell. Lorant et al. used platelet activating factor, LTB4, FMLP and IL-8 to activate neutrophils, and observed that P-selectin ligand molecules were redistributed (10). They also observed that the activation reduced the adhesion of neutrophils to P-selectin. Our results strongly suggest that redistribution of ligands is a prerequisite to superoxide anion production and release. In the presence of cytochalasin B, IL-8 induced the formation of small clusters of the epitopes along the cell surfaces (Fig. 6Go) but cap formation was not observed. Under these conditions, superoxide anion production was not induced. Thus, a drastic redistribution of sLeX to one end of the cells is absolutely necessary. However, a possibility cannot be eliminated where a signal is sent through the interaction between P-selectin and its counter-receptor followed by actin-dependent processes. In other words, redistribution of the counter-receptor might be one of the bystander effects. Because the correlation between cap formation by sLeX carbohydrate chains and superoxide anion production was observed with soluble and immobilized P-selectin, redistribution of the counter-ligand must be involved in the P-selectin-induced superoxide anion production. The mechanisms of signal transduction following receptor polarization remain to be elucidated in this system. It is probable that localization of the ligand for P-selectin at a certain region on the surface of neutrophils affects their rolling along activated vascular endothelia, which is considered to be the initial step for extravasation of neutrophils to inflammatory tissues. We were extremely careful of possible contamination of bacterial endotoxin because the soluble rP-selectin used in this study was produced in E. coli. The rP-selectin preparation did not contain detectable endotoxin, as monitored by the Limulus test. The oxidative burst shown in this study should be P-selectin dependent because P-selectin purified from human platelets exhibits similar activity to rP-selectin. Furthermore, a monoclonal anti-P-selectin antibody inhibited leukocyte activation induced by immobilized P-selectin.

mAb directed against P-selectin were shown to prevent tissue damage caused by acute inflammation after ischemia and reperfusion as reported by Weyrich et al. (19). Anti-IL-8 antibody also blocked ischemia and reperfusion injury (20). The inhibition of neutrophil infiltration by these antibodies is thought to be an important mechanism in such attenuation of tissue damage. According to the experimental results reported here, abrogation of P-selectin/sLeX-dependent superoxide anion production might also explain the effect of blocking antibodies in vivo.

As reported by Katayama et al. and by Chong et al., soluble P-selectin circulates in human blood at concentrations of 0.1–1µg/ml (21, 22). These reports also showed that the level was significantly elevated in patients with consumptive thrombotic disorders, including disseminated intravascular coagulation, heparin-induced thrombocytopenia, and thrombotic thrombocytopenic purpura/haemolytic uremic syndrome. Therefore, the production of superoxide anion induced by the synergistic action of inflammatory cytokines and soluble P-selectin might be involved in the pathogenesis of these thrombotic diorders.


    Acknowledgments
 
We are grateful to Drs Akira Takebe and Shigeru Hasegawa (BioRad) for their technical assistance in the 3D graphical analysis of the laser-scanning confocal microscopy, to Dr Hiroshi Miyazaki (Kirin Brewery) for his generous donation of G-CSF, to Dr David M. Wildrick for his editorial assistance, and to Ms Chizu Hiraiwa for her assistance in preparing this manuscript. This work was supported by grants-in-aid from the Ministry of Education, Science, Sports and Culture of Japan (05274101, 05557104 and 07407063), the Ministry of Health and Welfare, the Japan Health Science Foundation, the Research Association for Biotechnology, PROBRAIN, and the New Energy and Industrial Technology Development Organization.


    Abbreviations
 
FMLP N-formyl-methionyl-leucyl-phenylalanine
G-CSF granulocyte colony stimulating factor
GM-CSF granulocyte macrophage colony stimulating factor
GST glutathione-S-transferase
M-CSF macrophage colony stimulating factor
r recombinant
sLeX sialyl Lewis X

    Notes
 
4 Present address: Department of Immunology, Tokyo Metropolitan Institute of Medical Science, 3-18-22 Honkomagome, Bunkyo-ku, Tokyo 113-8613, Japan Back

5 Present address: Department of Microbiology, Hoshi University, 2-4-41 Ebara, Shinagawa-ku, Tokyo 142-8501, Japan Back

Transmitting editor: K. Okumura

Received 10 May 1999, accepted 27 December 1999.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Nagata, K., Tsuji, T., Todoroki, N., Katagiri, Y., Tanoue, K., Yamazaki, H., Hanai, N. and Irimura, T. 1993. Activated platelets induce superoxide anion release by monocytes and neutrophils through P-selectin (CD62). J. Immunol. 151:3267.[Abstract]
  2. Nagata, K., Tsuji, T., Hanai, N. and Irimura, T. 1994. Role of O-linked carbohydrate chains on leukocyte cell membranes in platelet-induced leukocyte activation. J. Biol. Chem. 269:23290.[Abstract/Free Full Text]
  3. Tsuji, T., Nagata, K., Koike, J., Todoroki, N. and Irimura, T. 1994. Induction of superoxide anion production from monocytes and neutrophils by activated platelets through the P-selectin–sialyl Lewis X interaction. J. Leuk. Biol. 56:583.[Abstract]
  4. Lasky, L. A. 1992. Selectins: interpreters of cell-specific carbohydrate information during inflammation. Science 258:964.[Abstract/Free Full Text]
  5. Bevilacqua, M. P. and Nelson, R. M. 1993. Selectins. J. Clin. Invest. 91:379.
  6. Rinder, H. M., Bonan, J. L., Rinder, C. S., Ault, K. A. and Smith, B. R. 1991. Activated and unactivated platelet adhesion to monocytes and neutrophils. Blood 78:1760.[Abstract/Free Full Text]
  7. Polley, M. J., Phillips, M. L., Wayner, E., Nudelman, E., Singhal, A. K., Hakomori, S. and Paulson, J. C. 1991. CD62 and endothelial cell-leukocyte adhesion molecule 1 (ELAM-1) recognize the same carbohydrate ligand, sialyl-Lewis X. Proc. Natl Acad. Sci. USA 88:6224.[Abstract/Free Full Text]
  8. Varki, A. 1994. Selectin ligands. Proc. Natl Acad. Sci. USA 91:7390.[Abstract/Free Full Text]
  9. Wong, C. S., Gamble, J. R., Skinner, M. P., Lucas, C. M., Berndt, M. C. and Vadas, M. A. 1991. Adhesion protein GMP-140 inhibits superoxide anion release by human neutrophils. Proc. Natl Acad. Sci. USA. 88:2397.[Abstract/Free Full Text]
  10. Lorant, D. E., McEver, R. P., McIntyre, T. M., Moore, K. L., Prescott, S. M. and Zimmerman, G. A. 1995. Activation of polymorphonuclear leukocytes reduces their adhesion to P-selectin and causes redistribution of ligands for P-selectin on their surfaces. J. Clin. Invest. 96:171.
  11. Dorè, M., Burns, A. R., Hughes, B. J., Entman, M. L. and Smith, C. W. 1996. Chemoattractant-induced changes in surface expression and redistribution of a functional ligand for P-selectin on neutrophils. Blood 87:2029.[Abstract/Free Full Text]
  12. Yuo, A., Kitagawa, S., Kasahara, T., Matsushima, K., Saito, M. and Takaku, F. 1991. Stimulation and priming of human neutrophils by interleukin-8: cooperation with tumor necrosis factor and colony-stimulating factors. Blood 78:2708.[Abstract/Free Full Text]
  13. Furuta, R., Yamagishi, J., Katani, H., Sakamoto, F., Fukui, T., Matsui, Y., Sohmura, Y., Yamada, M., Yoshimura, T., Larsen, C. G., Oppenheim, J. J. and Matsushima, K. 1989. Production and characterization of recombinant human neutrophil chemotactic factor. J. Biochem. 106:436.[Abstract/Free Full Text]
  14. Shitara, K., Hanai, N. and Yoshida, H. 1987. Distribution of lung adenocarcinoma-associated antigens in human tissues and sera defined by monoclonal antibodies, KM-52 and KM-93. Cancer Res. 47:1267.[Abstract/Free Full Text]
  15. Tanoue, K., Akamatsu, N., Katagiri, Y., Fujimoto, T., Kurokawa, T., Isawa, S., Koike, M., Kawasaki, H., Suzuki, K. and Yamazaki, H. 1993. Detection of in vivo activated platelets in experimental cerebral thrombosis: studies using a new monoclonal antibody 2T60, specific for activated human and rabbit platelets. Platelet 4:31.
  16. Johnston, G. I., Cook, R. G. and McEver, R. P. 1989. Cloning of GMP-140, a granule membrane protein of platelets and endothelium: sequence similarity to proteins involved in cell adhesion and inflammation. Cell 56:1033.[Web of Science][Medline]
  17. Gamble, J. R. and Vadas, M. A. 1988. A new assay for the measurement of the attachment of neutrophils and other cell types to endothelial cells. J. Immunol. Methods 109:175.[Web of Science][Medline]
  18. Pick, E. and Mizel, D. 1981. Rapid microassays for the measurement of superoxide and hydrogen peroxide production by macrophages in culture using automatic enzyme immunoassay reader. J. Immunol. Methods 46:211.[Web of Science][Medline]
  19. Weyrich, A. S., Ma, X.-L., Lefer, D. J., Albertine, K. H. and Lefer, A. M. 1993. In vivo neutralization of P-selectin protects feline heart and endothelium in myocardial ischemia reperfusion injury. J. Clin. Invest. 91:2620.
  20. Sekido, N., Mukaida, N., Harada, A., Nakanishi, I., Watanabe, Y. and Matsushima, K. 1993. Prevention of lung reperfusion injury in rabbits by a monoclonal antibody against interleukin-8. Nature 365:654.[Medline]
  21. Katayama, M., Handa, M., Araki, Y., Ambo, H., Kawai, Y., Watanabe, K. and Ikeda, Y. 1993. Soluble P-selectin is present in normal circulation and its plasma level is elevated in patient with thrombotic thromcytopenic purpura and haemolytic uraemic syndrome. Br. J. Haematol. 84:702.[Web of Science][Medline]
  22. Chong, B. H., Murray, B., Berndt, M. C., Dunlop, L. C., Brighton, T. and Chesterman, C. N. 1994. Plasma P-selectin is increased in thrombotic consumptive platelet disorders. Blood 83:1535.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
S. Itoh, C. Susuki, K. Takeshita, K. Nagata, and T. Tsuji
Redistribution of P-selectin glycoprotein ligand-1 (PSGL-1) in chemokine-treated neutrophils: a role of lipid microdomains
J. Leukoc. Biol., June 1, 2007; 81(6): 1414 - 1421.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
G. B. Mitchell, B. N. Albright, and J. L. Caswell
Effect of Interleukin-8 and Granulocyte Colony-Stimulating Factor on Priming and Activation of Bovine Neutrophils
Infect. Immun., April 1, 2003; 71(4): 1643 - 1649.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Nagata, K.
Right arrow Articles by Irimura, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nagata, K.
Right arrow Articles by Irimura, T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?