Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Wu, Z.
Right arrow Articles by Bottazzo, G. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, Z.
Right arrow Articles by Bottazzo, G. F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 12, No. 4, 405-413, April 2000
© 2000 Japanese Society for Immunology

Transcriptional regulation of the MHC II gene DRA in untransformed human thyrocytes

Zhonglin Wu3, Paul Andrew Biro, Rita Mirakian, Francesco Curcio1, Francesco Saverio Ambesi-Impiombato1 and Gian Franco Bottazzo2

Department of Immunology, St Bartholomew's and the Royal London School of Medicine and Dentistry, London EC1A 7BE, UK
1 Dipartimento di Patologia e Medicina Sperimentale e Clinica, Università degli Studi di Udine, 33100 Udine, Italy
2 Direzione Scientifica, Ospedale Pediatrico Bambino Gesù, Scientific Institute, Piazza S. Onofrio 4, 00165 Rome, Italy

Correspondence to: G. F. Bottazzo


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
MHC class II molecules are heterodimeric, polymorphic transmembrane glycoproteins physiologically expressed on cells of the immune system and pathologically expressed on the affected target cells of autoimmunity. Their function is to present processed peptides to antigen-specific CD4+ T cells. To understand the molecular mechanism of the regulation of class II genes in autoimmune target cell thyrocytes, we investigated the transcriptional regulation of DRA on untransformed, differentiated human thyroid cells following IFN-{gamma} stimulation, which is potentially relevant to the inappropriate class II expression found in Graves' disease. Data from this study show that IFN-{gamma} enhances a promoter Y box binding protein and induces an X box binding protein in untransformed thyrocytes, but not in SV-40-transfected thyrocytes. Initial characterization of the proteins has indicated that the Y box binding protein is ~132 kDa in size while the X box binding protein binds to the X2 region and is ~116 kDa. The X box binding protein may correspond to poly(ADP-ribose) polymerase, a recently described component of the X2 box binding protein, X2BP. In addition, the signal transducer and activator of transcription 1{alpha} protein (STAT1{alpha}) is also induced by IFN-{gamma} in these cells. These results further suggest that there are differences in class II gene regulation between differentiated cells and transformed cell lines.

Keywords: MHC class II, thyrocytes, transcriptional regulation


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
MHC class II molecules are transmembrane glycoproteins which can present processed antigenic peptides to CD4+ T lymphocytes and initiate specific immune responses (1). MHC class II molecules are constitutively expressed on cells specialized for antigen presentation such as B lymphocytes, dendritic cells and macrophages, and are inducible in other cells such as endothelial cells, fibroblasts and thyrocytes, potentially allowing these cells to present antigen (2). Since MHC class II expression is a feature of T cell activation, its regulation may be important in the control of the immune response (3,4). The expression of MHC class II genes is tightly regulated at multiple levels of control by a series of cis-regulatory DNA elements interacting with transcription proteins or factors (2).

MHC class II genes contain several conserved sequences largely located in a region ~200 bp upstream from the site of transcription initiation (2). Three principal elements have been described: from 5' to 3' they are the S (W, Z or H), X (subdivided into X1 and X2 regions) and Y boxes (5). They act as target sites for the specific DNA-binding proteins that regulate the transcription of the class II genes (6,7). Several binding proteins have been isolated: regulatory factor-X (RFX) binds to the X1 box of DRA while the general transcription factor CREB (X2 box binding protein, X2BP), binds to the X2 box (8). CREB binding can itself be inhibited by the cAMP early repressor (ICER) following an increase in cAMP levels (8). Recently, three subunits of RFX have been characterized: RFXANK/RFX-B, RFX5 and RFXAP. Defects in each of these proteins are responsible for the bare lymphocyte syndrome genetic complementation groups B, C and D respectively (9,10).

There are at least two human Y box binding proteins. The Y element binding protein (YEBP) is likely to be the human homologue of the mouse NF-Y, which is a positive regulator of transcription and increases interactions between RFX and the X box, and the second protein, YB-1, which negatively regulates class II gene expression (11,12). The binding of the individual factors promotes essential co-operative protein–protein interactions over the whole of the MHC class II promoter region (13) and leads to the formation of a single multiprotein (RFX/X2BP/NF-Y/X-Y box) regulatory complex (14), although RFX and X2BP can also bind independently to the X box region of DRA.

The class II transactivator (CIITA) gene product is an additional essential component of the class II expression pathway and defects in CIITA are responsible for bare lymphocyte syndrome (complementation group A) (15). In contrast to other regulatory proteins, CIITA does not bind directly to DNA but interacts with other DNA binding protein(s) and activates the transcription of MHC class II genes through protein–protein interactions (16). CIITA is believed to be the only MHC class II-specific transcription factor that is inducible by IFN-{gamma} (10).

The induction of most genes by IFN-{gamma} is mediated by the Jak– signal transducer and activator of transcription (STAT) pathway of signal transduction (17) and the phosphorylation of STAT1{alpha} (18). Upon phosphorylation STAT1 migrates to the nucleus and binds to its target sequence, the sis-inducible element (SIE), present in the promoters of many genes that are activated by STAT1. Recent studies have directly demonstrated the functional role of STAT1{alpha} activation in relation to CIITA expression (19,20). Our separate study (21) using the differentiated human thyrocyte line HTV-59A has shown that CIITA expression is enhanced by IFN-{gamma} treatment, and precedes that of the class II and associated genes, HLA-DMB, Ii and DRA.

Inappropriate class II regulation has been correlated with autoimmune disease (22,23) and severe immunodeficiency (24). Immunization of mice with fibroblasts transfected with both a class II molecule and human thyrotropin receptor induced a Graves'-like disease (25). Studies on autoimmune thyroid disease have demonstrated greater inducibility of MHC class II expression by IFN-{gamma} in thyrocytes from patients with Graves' disease (23) and this might be explained by inappropriate transcriptional regulation.

So far, extensive studies of class II gene expression have only been done using transformed or immortalized cell lines of different tissue origin, which may not represent the cells involved in the autoimmune process (26). Recently, human MHC class II gene expression has been studied in rat FRTL-5 thyroid cells, which demonstrated that CIITA and single strand binding protein-1 increased class II expression while the TSH receptor suppressor element binding protein-1 and Methimazole inhibited IFN-{gamma}-induced class II gene expression (2729). However, few analyses have been performed with untransformed or primary cells and, to our knowledge, no work has been reported on the affected target cells of human autoimmunity (26,30). The availability of cultures of human thyrocytes (HTV-59A) now makes it possible for us to investigate the transcriptional regulation of MHC class II genes in untransformed, differentiated human thyroid cells (31). In common with many other investigators we have chosen to study the regulation of the DRA gene as it is single copy, non-polymorphic and is the most fully characterized of the MHC class II genes (6).


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Cell culture and antisera
The normal thyroid epithelial cell strain HTV-59A was originally isolated from the intact part of the thyroid of a patient with a calcitonin-producing tumor. The culture medium consists of modified F-12 supplemented with bovine hypothalamus and pituitary extracts (31). Characterization of the cells in vitro yielded results comparable to those previously reported (31). The cells were cultured in 5% CO2 at 37°C and parallel cultures were grown in which half the cells were additionally supplemented with 200 U/ml of recombinant human IFN-{gamma} (Genzyme, Cambridge, MA) for 4 days. The cells were then detached by incubation with 1xtrypsin/EDTA (Gibco/BRL, Rockville, MD) for 5–10 min at 37°C and washed.

For comparison, the SV-40-transfected thyrocyte clone 3A10 was also cultured with or without IFN-{gamma}. CEM, an HLA class II, uninducible, T lymphoblastoid cell line, and Hom-2, an HLA class II+ B lymphoblastoid cell line, were cultured in RPMI 1640 medium plus 10% FCS, and served as negative and positive controls respectively (32,33).

Rabbit anti-RFX antisera and partially purified RFX protein were kindly provided by Dr J. M. Boss (Emory University School of Medicine, Atlanta).

Nuclear extract preparation
Nuclear extracts were prepared by a modification of the method of Dignam (34,35) from 3–5x107 cells. The nuclear extracts were aliquoted and stored at –70°C by snap-freezing in dry ice/ethanol. Protein concentrations were determined using the BioRad protein assay kit (BioRad, Munich, Germany).

Oligonucleotide synthesis
High-affinity binding SIE oligonucleotides were kindly provided by Dr J. Girdlestone (The Medical School, University of Birmingham). All others were obtained commercially (Amersham Pharmacia Biotech, Little Chalfont, UK). Oligonucleotide sequences are shown in Table 1Go. X1M and X2M are both equivalent to X1X2 except that some key residues in the X1 and X2 box sequences were mutated to eliminate binding of their respective proteins (36). For DNase I footprinting assays, both strands between 36 and 162 bases upstream of the start site of transcription of the DRA gene promoter were synthesized. The sequence of the coding strand (2) is: TTTATCCAATGAACGGAGTATCTTGTGTCCTGGACCCTTTGCAAGAACCCTTCCCCTAGCAACAGATGCGTCATCTCAAAATATTTTTCTGATTGGCCAAAGAGTAATTGATTTGCATTTTAATGGT.


View this table:
[in this window]
[in a new window]
 
Table 1. Oligonucleotide sequences
 
Gel mobility shift assay
Double-stranded oligonucleotides were prepared by denaturing and annealing equimolar amounts of the two complementary oligonucleotides. Annealed oligonucleotides (2 pmol) were end-labeled with 20 µCi [{gamma}-32P]ATP (Amersham Pharmacia Biotec), in the presence of 1xend-labeling buffer and 5–10 U of T4 DNA kinase (Promega, Madison, WI), followed by separation from unincorporated label using a NICK Spin Column (Pharmacia Biotech). The amounts of double-stranded DNA competitor poly(dI–dC)·poly(dI–dC) used in binding reactions were optimized with fixed amounts of nuclear extracts. Binding was carried out in 20 µl of 20 mM HEPES (pH 7.9), 1 mM MgCl2, 0.5 mM DTT, 4% Ficoll (Fisons, Loughborough, UK), 0.5 µg poly(dI–dC)·poly(dI–dC) (Amersham Pharmacia Biotec) and KCl to a final salt concentration of 100 mM, containing 6 µg nuclear extract and 1 µl (10 fmol) 32P-labeled probe with or without excess specific or non-specific DNAs at 4°C for 45 min (34). For competition experiments antibodies, a 100-fold molar excess of unlabeled, non-specific, irrelevant (NS) or specific oligonucleotide was added and pre-incubated for 30–60 min at 4°C before the addition of the 32P-labeled probe. Protein–DNA complexes were resolved on 4% native polyacrylamide gels containing 0.25xTBE (0.02M Tris–borate/0.001 M EDTA ). Gels were pre-run at 150 V for 2 h with re-circulating buffer and electrophoresis carried out at 150 V for 2–2.5 h. Gels were dried under vacuum at 80°C for 1 h and exposed to XAR-5 film (Kodak, Rochester, NY) for 6–72 h with or without intensifying screens at room temperature or –70°C.

DNase I footprinting
Oligonucleotides (2 pmol) were labeled using 100 µCi of [{gamma}-32P]ATP (Amersham), 20 U of T4 DNA kinase (Promega) in 50 µl of end-labeling buffer at 37°C for 45 min. The labeled DNA fragments were purified on polyacrylamide gels and isolated by the `crush and soak' technique (37). DNA binding reactions of 50 µl were performed as above with 2 µl of labeled probe using the Sure Track footprinting kit (Pharmacia). After binding, 5 µl of Ca2+/Mg2+ solution (10 mM MgCl2/5 mM CaCl2) was added, followed by DNase I (1.32–1.49 U) for 1–30 min. The DNA samples were then phenol–chloroform extracted, precipitated and resolved on 8% acrylamide/7 M urea gels. Sequences were aligned by comparison with the G + A Maxam–Gilbert ladder of the end-labeled DNA.

UV cross-linking of transcription factors to DNA
For X2 box binding proteins, the coding strand of a 33 base oligonucleotide containing the mutant Y box (YM) sequence was annealed with the non-coding strand of the X2 box plus mutant X1 box sequence (X1M). Similarly, for Y box-binding proteins, the coding strand of a 33 base oligonucleotide containing the Y box was annealed with the non-coding strand of the X1 box plus mutant X2 box oligonucleotide (X2M) (Table 1Go). After annealing, 5' extensions (2 pmol) were filled in using 50 µM dGTP, 50 µM 5-bromo-dUTP (Sigma, St Louis, MO), 100 µCi [{alpha}-32P]dATP, 100 µCi[{alpha}-32P] dCTP (Amersham) and 25 U Klenow fragment (Promega) at 37°C for 30 min in appropriate buffer. The reaction was heated at 65°C for 10 min to inactivate the enzyme and the labeled probes purified by centrifugation through Sephadex G-50 (Pharmacia). After binding, the protein–DNA complex was irradiated with a UV transilluminator at 305–310 nm for ~30 min. Then 10 µg of DNase I, 4 U of micrococcal nuclease (Worthington Biochemical, Freehold, NJ) and 5 µl of 0.1 M CaCl2 were added at 37°C for 30 min. Samples were analyzed on 8% SDS–polyacrylamide gels. The gels were dried under vacuum and subjected to autoradiography with an intensifying screen at –70°C.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Proteins that interact with the Y box of the DRA promoter
Gel mobility shift assays using nuclear extracts isolated from HTV-59A cells treated with IFN-{gamma} were performed to identify Y box binding protein(s) associated with the observed IFN-{gamma} response (Fig. 1AGo). All gel mobility shift assays were performed after 4 days of IFN-{gamma} treatment (16). DRA levels in primary cultures of human thyrocytes increased for 6 days following IFN-{gamma} induction and maintained a plateau for a further 66 days (38). Similarly, in the HTV-59A cells DRA levels were still rising 7 days post IFN treatment and continued at this level for at least a further 3 days (Z. Wu, unpublished observations).



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 1. Y and X box gel mobility shift assays. (A) Y box assays were conducted using radiolabeled Y box oligonucleotide of the DRA promoter plus 6 µg nuclear extract (NE) from HTV-59A thyrocytes untreated (lane 2) or treated with IFN-{gamma} (200 U/ml) for 4 days (lanes 3–5). Lanes 6 and 7 show the binding patterns from CEM and Hom-2 respectively. The binding patterns for the SV-40-transfected thyrocyte clone are shown in lanes 8 (IFN-{gamma} untreated) and 9 (IFN-{gamma} treated). Competitor Y is 100-fold molar excess of unlabeled Y box oligonucleotide (lane 4), while competitor NS is the non-specific oligonucleotide (lane 5). The arrows (B1–B3) indicate the positions of the protein–DNA complexes. F indicates the position of the free Y box oligonucleotide. (B) X box assays were similarly conducted using radiolabeled X box oligonucleotide of the DRA promoter and 6 µg of nuclear extract from HTV-59A cells treated with (lanes 3–7) or without (lane 2) IFN-{gamma} (200 U/ml) for 4 days. Competitor X is a 100-fold molar excess of unlabeled X oligonucleotide (lane 4) while competitor NS is the non-specific oligonucleotide (lane 5). Band shift assays were also carried out in the presence of polyclonal RFX antibodies 1 µl (1:19 dilution, lane 6) and 6.6 µl (1:3 dilution, lane 7) and in the presence of partially purified RFX protein (4.5 µg) without nuclear extract (lane 8). Lane 9 shows the binding patterns for the class II CEM cells and lane 10 for the class II+ Hom-2 cells. B1, B2, B3 and B4 arrows indicate the positions of the protein–DNA complexes. F indicates the position of the free X box oligonucleotide.

 
A faint band was observed (Fig. 1AGo, lane 2) when nuclear extract from HTV-59A cells without IFN-{gamma} treatment was added to the reaction. However, the intensity of the band was substantially increased following treatment of HTV-59A cells with IFN-{gamma} (Fig. 1AGo, lane 3) and inhibited by a 100-fold molar excess of unlabeled competing Y box oligonucleotide (Fig. 1AGo, lane 4). The same amount of irrelevant oligonucleotide (NS) failed to compete with the DNA–protein binding (Fig. 1AGo, lane 5). The competition tests demonstrate that the IFN-{gamma}-enhanced Y box–protein complex in HTV-59A cells is Y box sequence specific.

The same complex was seen in both untreated CEM (class II) and Hom-2 (class II+) cells (Fig. 1AGo, lanes 6 and 7). The CEM cells contained two additional slower migrating bands, B2 and B3 (Fig. 1AGo, lane 6). By FACS analysis, the SV-40-transfected thyrocyte clone 3A10 and the HTV-59A thyrocytes both contained similar proportions of class II+ cells (~15% positive in basal conditions and 96% after IFN-{gamma} treatment) (21). However, the intensities of the Y box binding complex were the same in nuclear extracts from 3A10 cells without (Fig. 1AGo, lane 8) or with IFN-{gamma} treatment (Fig. 1AGo, lane 9) and the intensity of the complex in these two reactions was much stronger than that observed in HTV-59A cells (Fig. 1AGo, lanes 2–5).

Proteins that interact with the X box of the DRA promoter
To investigate X box binding protein–DNA complex formation in the thyrocytes, similar gel mobility shift assays were carried out using the X1X2 oligonucleotide. A strong band (B1) was identified in the reaction with nuclear extract from the HTV-59A cells treated with IFN-{gamma} (Fig. 1BGo, lane 3) but not in uninduced extracts (Fig. 1BGo, lane 2). Formation of the IFN-{gamma} induced band was successfully competed out by 100-fold molar excess of unlabeled X box oligonucleotide (Fig. 1BGo, lane 4) but not by the unrelated oligonucleotide (Fig. 1BGo, lane 5).

The X box binding protein was further characterized using antisera to RFX. We included either 1 or 6.6 µl of polyclonal anti-RFX antibodies in a 20 µl gel shift assay, together with nuclear extracts and radiolabeled X box probe. In addition, partially purified RFX protein was incubated with the labeled X box probe and run in parallel as a control. No band appeared at the position of the IFN-{gamma}-induced X box binding protein (B1) with RFX protein alone, instead both slower migrating (B2) and faster migrating (B4) bands were observed (Fig. 1BGo, lane 8). Experiments using a rabbit pre-immune serum showed that the band B3, seen in Fig. 1Go(B, lanes 6 and 7) is an irrelevant DNA–protein complex of rabbit origin (data not shown).

High-intensity bands were observed both in nuclear extracts from CEM and from Hom-2. Two separate bands appeared in nuclear extracts of CEM (Fig. 1BGo, lane 9), whereas a broader and faster migrating band was present in the extracts of Hom-2 (Fig. 1BGo, lane 10). In contrast to HTV-59A thyrocytes, nuclear extracts from SV-40-transfected thyrocytes contained strong X box binding proteins in both the induced and uninduced preparations (data not shown).

In summary, no specific X box binding protein complex was detected in nuclear extracts from untreated HTV-59A thyrocytes, but an X box binding protein–DNA complex was identified in the extracts from the cells treated by IFN-{gamma}. However, SV-40-transfected thyrocytes already contained a strong X box protein, even in the uninduced state. The X box binding complexes were also identified in both CEM and Hom-2 cells.

The X box binding protein in the HTV-59A thyrocytes binds specifically to the X2 box
To further define which element the X box binding protein interacted with, X1M (mutated X1 sequence) and X2M (mutated X2 sequence) oligonucleotides were synthesized and incubated with nuclear extracts from IFN-{gamma}-treated HTV-59A thyrocytes. Formation of the X binding protein complex was observed in reactions incubated with the X1X2 oligonucleotide (Fig. 2Go, lane 1) and X1M, containing the normal X2 box and mutated X1 box sequences (Fig. 2Go, lane 2), but not in the reaction with X2M, containing the normal X1 box and mutated X2 box sequences (Fig. 2Go, lane 3), showing that the X box binding protein from HTV-59A cells specifically recognizes the X2 element and not the X1 element of the DRA promoter.



View larger version (74K):
[in this window]
[in a new window]
 
Fig. 2. X, X1M and X2M oligonucleotide gel mobility shift assay. Nuclear extract (6 µg) prepared from IFN-{gamma}-treated HTV-59A thyrocytes was incubated with X (lane 1), X1M (lane 2) or X2M (lane 3) oligonucleotides. No bands were detected with the X2M oligonucleotide.

 
Localization of the Y protein binding site within the DRA promoter
DNase protection studies confirmed the specificity of the Y box binding protein and showed that it protected the whole Y region of the coding strand of the DRA promoter (Fig. 3AGo, lane 2). In addition, several nucleotides, both downstream and upstream of the Y box, were also protected. The overall protected region of the coding strand was between –85 and –59 (27 bp). The Y box binding protein protects two regions in and adjacent to the Y box sequence element of the non-coding strand of the DRA promoter between –68 and –59, and between –85 and –77 with three protein-induced DNase I hypersensitive sites (Fig. 3BGo, lane 2). The DNase I footprinting pattern is summarized in Fig. 3Go(C).



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 3. DNase I footprinting assays. (A) The 126 base coding strand of the DRA promoter element was end-labeled and purified by PAGE, isolated, and cleaved with DNase I, in the absence (lane 1) or in the presence (lane 2) of the nuclear extracts. Lane 3 is the G + A reaction of the same element. The protected sequences are indicated by bars, whereas the DNase I hypersensitive sites are indicated by arrows. (B) The 126 base non-coding strand of the DRA promoter element was similarly labeled and subjected to DNase I digestion in the absence (lane 1) or in the presence (lane 2) of the nuclear extracts. (C) Summary of the DNase I footprinting patterns of nuclear extracts from HTV-59A thyrocytes. The X1 and Y box sequences are single underlined, the X2 box sequence is double underlined, and the positions of nucleotides relative to the cap site are indicated by numbers. The italicized nucleotides are those which are protected in footprinting experiments when either the coding or non-coding strand is labeled. The DNase I hypersensitive sites are represented by bold letters.

 
Localization of the X2 box binding protein within the DRA promoter
On the coding strand of the promoter, the X2 box binding protein protects a 23 base region between –93 and –115, which includes the whole X region and a 7 base region upstream of the X box (lane 2) with two hypersensitive bands (Fig. 3A and CGo). On the non-coding strand of the DRA promoter (Fig. 3.BGo), two discontinuous regions were defined. One region consisted of a 6 base stretch, which covers most of the X2 box, and the other contained 15 nucleotides, which covers part of X1 box site and sites adjacent to it. In addition, two hypersensitive sites were observed within the X2 box region (Fig. 3B and CGo).

Determination of the relative mol. wt of the Y box binding protein
The mol. wt of the Y box binding protein was estimated by UV cross-linking. A 57 bp probe was prepared by annealing the coding strand of the Y box oligonucleotide (Y) with the partially overlapping non-coding strand of the X1 and mutated X2 boxes (X2M). Since no X1 box binding proteins were detected in HTV59A extracts and the X2 box was mutated in this sequence, only Y box proteins would bind to the probe. The radiolabeled, BrdU-substituted double-strand probe was UV cross-linked to the protein, digested by nucleases and then resolved by electrophoresis. A predominant band of 132 kDa appeared in nuclear extracts from IFN-{gamma}-treated HTV-59A thyrocytes (Fig. 4AGo, lane 1). This protein–DNA complex formation was totally abolished by a 250-fold molar excess of the XY oligonucleotide (Fig. 4AGo, lane 2) but could not be diminished by the same amount of non-specific oligonucleotide (Fig. 4AGo, lane 3).



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 4. Mol. wt determination of the Y and X box binding protein(s) by UV cross-linking. (A) The 57 bp probe containing the Y and X1X2M elements was prepared by 32P radiolabeling and substitution with BrdU. The nuclear extracts from IFN-{gamma}-treated HTV-59A thyrocytes were incubated with the probe in the absence (lane 1) or in the presence of sequence-specific (lane 2) or non-specific (lane 3) competitors, UV cross-linked and incubated with DNase I. The DNA–protein complex was separated by SDS–PAGE, with the rainbow colored mol. wt markers. Positions of mol. wt markers are indicated along the left side and the estimated mol. wt of the Y box binding protein is indicated to the right (~132 kDa). (B) The 32P-labeled, BrdU substituted 57 bp probe containing the native X2 box sequence and mutations in the Y and X1 box sequences was incubated with nuclear extract from IFN-{gamma}-treated HTV-59A thyrocytes in the presence of either sequence-specific (lane 1) or non-specific (lane 2) competitors. The reactions were subject to UV cross-linking, digestion by DNase I and separation by SDS–PAGE. Positions of mol. wt markers are at the left side and the estimated mol. wt of the X2 box binding protein is at the right (~116 kDa).

 
Determination of the relative mol. wt of the X2 box binding protein.
A second 57 bp was prepared by annealing the coding strand of the mutant Y box sequence (YM) with the non-coding strand of the X2 box and mutant X1 box sequence (X1M). Since both the Y box and X1 box protein binding sequences were mutated only an X2 box protein would bind to this probe. UV cross-linking was performed and a sequence-specific band, ~116 kDa in size, was observed in IFN-{gamma}-treated HTV-59A thyrocytes (Fig. 4BGo). This band could not be competed out by a 250-fold molar excess of non-specific DNA (Fig. 4BGo, lane 2). However, band formation was totally inhibited by the comparable amount of XY sequence oligonucleotide (Fig. 4BGo, lane 1). In contrast, multiple bands of different intensities appeared in SV-40-transfected thyrocytes, with or without IFN-{gamma} treatment, in CEM and in Hom-2. An extra band ~105 kDa in size was only found in nuclear extracts from CEM (data not shown).

STAT1{alpha} expression
The intracellular signal transduction pathway of IFN-{gamma} in thyrocytes is unknown. The presence of STAT1{alpha} in nuclear extracts from HTV-59A thyrocytes was determined to evaluate the possible involvement of this signal transduction mechanism in thyrocytes. The high-affinity SIE (39) oligonucleotide was radiolabeled, incubated with nuclear extracts from thyrocytes either in the absence of, or in the presence of, IFN-{gamma} and gel mobility shift assays carried out. A fainter band (B1) was observed after incubation of the probe with nuclear extract from HTV-59A thyrocytes in the absence of IFN-{gamma} (Fig. 5AGo, lanes 2 and 6) and a stronger fast migrating band (B2) appeared, accompanied by slower-migrating fuzzy bands, in IFN-{gamma}-treated extracts (Fig. 5AGo, lanes 3 and 7). Three bands could be discerned in a separate experiment (Fig. 5BGo, lane 2). The specificity of these bands was tested by oligonucleotide competition and by a mAb to STAT1{alpha}. These bands were totally competed out by a 100-fold molar excess of unlabeled SIE oligonucleotide. Incubation of nuclear extracts with 2 µg of antibody to STAT1{alpha} resulted in the elimination of the IFN-{gamma}-induced faster migrating band (Fig. 5AGo, lane 8), but only partially diminished the slower migrating band (Fig. 5AGo, lane 9). These results are very similar, if not identical, to those from studies on A431 cells (39). A slow migrating complex (termed SIF-A) existed in A431 cells without IFN-{gamma} treatment, while two faster migrating complexes (SIF-B and SIF-C) were detected with the SIE probe after treatment with IFN-{gamma}. The SIF-A complex may contain STAT3 and the faster migrating complex SIF-C is STAT1{alpha}, and the complex between them contains both STAT3 and STAT1{alpha} (17,39). Since STAT1{alpha} has homology to STAT3, the binding of STAT3 to the SIE probe was partially inhibited by anti-STAT1{alpha} antibody in our experiment.



View larger version (49K):
[in this window]
[in a new window]
 
Fig. 5. Gel mobility shift assay using a high-affinity SIE oligonucleotide. (A) Radiolabeled oligonucleotide was incubated with 6 µg of nuclear extract from HTV-59A thyrocytes untreated (lanes 2, 6 and 9) or treated (lanes 3, 4, 5, 7 and 8) with IFN-{gamma} (200 U/ml) for 4 days. Competitor SIE is 100-fold molar excess of the high-affinity SIE oligonucleotide (lane 4), whereas NS is the equal amount of the irrelevant, non-specific oligonucleotide (lane 5). In lanes 8 and 9, the nuclear extracts were pre-incubated with 2 µg of anti-STAT1{alpha} antibody for 1 h at 4°C before adding the labeled probe. Equal amounts of nuclear extracts from CEM (lane 10), Hom-2 (lane 11), SV-40-transfected thyrocytes (lane 12) and IFN-{gamma}-treated SV-40-transfected thyrocytes (lane 13) were incubated with the labeled oligonucleotide. The gel running time was different for lanes 1–11 and 12–13. B1 and B2 arrows indicate the positions of the protein–DNA complexes. (B) The 22 bp double-stranded SIE oligonucleotide was incubated with nuclear extracts from HTV-59A thyrocytes untreated (lane 1) or treated (lane 2) with IFN-{gamma}. The two additional bands detected with nuclear extracts from IFN-{gamma}-treated thyrocytes (lane 2) are indicated by arrows.

 
A single, slow migrating band appeared in the reaction with the extracts from CEM (Fig. 5AGo, lane 10), while both slow migrating and fast migrating bands were observed at higher intensity using the extract from Hom-2 (Fig. 5AGo, lane 11).


    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
In this study, the results showed that a sequence-specific Y box binding protein was present constitutively in HTV-59A and was enhanced substantially following IFN-{gamma} treatment, and that an X box binding protein was induced by IFN-{gamma} treatment. Induction of the X box binding protein correlated with MHC class II expression on the cell surface. These results are similar to those found in primary rat brain astrocytes in which an IFN-{gamma}-enhanced X box binding protein (IFNEX) was identified (26).

In contrast to the HTV-59A untransformed thyrocytes, we failed to find the same pattern for SV-40-transfected thyrocytes which show comparable numbers of class II+ cells in both basal and in IFN-{gamma}-enhanced conditions. In addition, high-intensity bands were observed in nuclear extracts from the class II control, CEM, and from the class II+ control cell, Hom-2, both of which are transformed lines.

It is not known why the X and Y box binding proteins are only induced/enhanced by IFN-{gamma} in untransformed HTV-59A cells and not in SV-40-transformed thyrocytes. It is unlikely that the differences between the two cells were caused by different experimental procedures, since the nuclear extracts were prepared and gel shift assays were performed under identical conditions. The most plausible explanation is that different cell types (untransformed or transformed) may differ in cell biology or contain different regulatory mechanisms.

Our results from HTV-59A thyrocytes and Moses' results from primary rat astrocytes (26) might fit the simplest model in which activation of class II expression by IFN-{gamma} is caused by increased DNA binding activity of transcription factors (40). The data obtained by both transfection and gel mobility shift assays in the astrocytes support this model, although we ourselves were unsuccessful in carrying out transfection experiments on HTV-59A with constructs containing the X and Y box sequences and CAT reporter gene. By contrast, over-expression of DNA binding proteins in transformed thyrocytes in the absence of IFN-{gamma} treatment and in CEM might be another aspect of transcription deregulation in transformed cell lines (41). Since additional bands were observed in the transformed cell lines in the present study, and we only studied the X and Y box binding proteins, we cannot rule out the possibility that unknown transcription factors, especially negative regulatory factors, were also over-expressed or that other mechanisms such as altered promoter accessibility are involved in the regulation (6).

Two Y box binding proteins have been characterized. YB-1 is 35–45 kDa and is a negative regulatory factor (42). The IFN-{gamma}-enhanced Y box binding protein we found in HTV-59A thyrocytes is unlikely to be YB-1 as IFN-{gamma}-enhanced protein expression correlates positively with MHC class II expression, whereas YB-1 inversely correlates with class II expression. A rat homologue of YB-1 (TSEP-1) decreases the expression of transfected DRA genes in the rat thyroid (FRTL-5) cell line (27). YEBP increases DRA transcriptional activity. YEBP is probably the human homologue of mouse NF-Y which is a transcriptional activator and consists of a heterodimer of NF-YA and NF-YB of 40–43 and 32 kDa respectively (43,44). The large difference in mol. wt between the IFN-{gamma}-enhanced Y box binding protein (132 kDa) and NF-Y makes it unlikely that the enhanced protein is YEBP, and, instead, it may be an unknown or uncharacterized protein present in human nuclear extracts (42).

A predominant protein, CREB-binding protein (CBP), is inducible by IFN-{gamma} in rat FRTL-5 cells (28). CBP is a common co-activator with a mol. wt of 265 kDa and is required in mediating cAMP-dependent transcription (45,46). However, the size difference between CBP and the Y box protein indicates that they are not homologues.

We detected an X2 box binding protein of mol. wt 116 kDa. hXBP-1 is an established positive regulatory protein which also binds to the X2 box (4749). However, as it has a mol. wt of 29 kDa, the IFN-{gamma}-induced X2 box binding protein from HTV-59A thyrocytes is unlikely to be hXBP-1. The functional similarity between IFNEX and the induced X2 binding protein suggests that the induced protein may be the human counterpart of rat IFNEX. Of the characterized X2 box binding proteins (X2BP, IFNEX, c-Jun and HB16), only the larger 120 kDa protein of X2BP is similar in mol. wt (13,26,50,51). Recent studies have identified this protein as poly(ADP-ribose) polymerase (PARP) (8,9), abundant nuclear chromatin-associated enzyme. PARP calalyzes the transfer of ADP-ribose units from NAD+ to nuclear protein, and is involved in DNA repair and apoptosis (52). PARP has been identified as a co-activator of several transcription factors (53), including AP-2 (54) and TEF-1 (transcription enhancer factor 1) (55), which is present in a variety of tissues. It is also a susceptibility gene for systemic lupus erythematosus (56). However, the significance of PARP on MHC class II regulation is, at present, unknown.

Our previous study (21) demonstrates the expression of CIITA mRNA and also its inducibility by IFN-{gamma} in the human thyrocytes. Together our two studies show that CIITA was found in both transformed and untransformed cells, and its pattern of expression tightly correlates with that of MHC class II. Hence CIITA may also be the key regulator of class II transcription in thyroid cells (21,27,57). Gel mobility shift assays showed that STAT1{alpha} was only inducible by IFN-{gamma} in HTV-59A thyrocytes. In addition, we identified slow and fast migrating bands in nuclear extracts from the class II+ B lymphoblastoid cell line, Hom-2, suggesting the presence of constitutively activated STAT1{alpha} in this transformed cell line. Our results are consistent with recently published data that STAT1{alpha} and other STATs are constitutively activated in cells from acute leukemia patients (58).

In summary: (i) IFN-{gamma}-enhanced/induced DNA binding proteins are only found in the differentiated thyrocytes HTV-59A, (ii) an IFN-{gamma}-enhanced Y box binding protein is present in HTV-59A cells, (iii) an X2-box binding protein (probably PARP) is inducible by IFN-{gamma} in HTV-59A cells and (iv) the expression of STAT1{alpha} is induced by IFN-{gamma} in HTV-59A thyrocytes.


    Acknowledgments
 
We wish to thank Dr Jeremy M. Boss for providing anti-RFX antibodies and Dr. John Girdlestone for providing oligonucleotides. Z. W. and this work were supported by the Autoimmune Diseases Charitable Trust. The work was also supported by grants from the ASI (Agenzia Spaziale Italiana), CNR (Consiglio Nazionale delle Ricerche, P. F. Oncologia) and MURST (Ministero dell'Università e della Ricerca Scientifica e Tecnologica).


    Abbreviations
 
CBP CREB-binding protein
CIITA class II transactivator
IFNEX IFN-{gamma}-enhanced X box binding protein
NS non-specific
PARP poly(ADP-ribose) polymerase
RFX regulatory factor-X
SIE sis-inducible element
STAT signal transducer and activator of transcription
YEBP Y element binding protein

    Notes
 
3 Present address: Division of Renal Medicine, St George's Hospital Medical School, Cranmer Terrace, London SW17 0RE, UK Back

Transmitting editor: G. Doria

Received 2 June 1999, accepted 24 November 1999.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Germain, R. N. 1994. MHC-dependent antigen processing and peptide presentation: providing ligands for T lymphocyte activation. Cell 76:287.[ISI][Medline]
  2. Glimcher, L. H. and Kara, C. J. 1992. Sequences and factors: a guide to MHC class-II transcription. Annu. Rev. Immunol. 10:13.[ISI][Medline]
  3. Benacerraf, B. 1981. Role of MHC gene products in immune regulation. Science 212:1229.[Free Full Text]
  4. Boss, J. M. 1997. Regulation of transcription of MHC class II genes. Curr. Opin. Immunol. 9:107.[ISI][Medline]
  5. Benoist, C. and Mathis, D. 1990. Regulation of major histocompatibility complex class-II genes: X, Y and other letters of the alphabet. Annu. Rev. Immunol. 8:681.[ISI][Medline]
  6. Ting, J. P. and Baldwin, A. S. 1993. Regulation of MHC gene expression. Curr. Opin. Immunol. 5:8.[ISI][Medline]
  7. Mach, B., Stemle, V., Martinez-Soria, E. and Reith, W. 1996. Regulation of MHC class II genes: lessons from a disease. Annu. Rev. Immunol. 14:301.[ISI][Medline]
  8. Moreno, C. S, Beresford, G. W., Louis-Plence, P., Morris, A. C. and Boss, J. M. 1999. CREB regulates MHC class II expression in a CIITA-dependent manner. Immunity 10:143.[ISI][Medline]
  9. Masternak, K., Barras, E., Zufferey, M., Conrad, B., Corthals, G., Aebersold, R. Sanchez, J.-C., Hochstrasser, D. F., Mach, B. and Reith, W. 1998. A gene encoding a novel RFX-associated transactivator is mutated in the majority of MHC class II deficiency patients. Nat. Genet. 20:273.[ISI][Medline]
  10. Nagarajan, U. M., Louis-Plence, P., DeSandro, A., Nilsen, R., Bushey, A. and Boss, J. M. 1999. RFX-B is the gene responsible for the most common cause of the bare lymphocyte syndrome, an MHC class II immunodeficiency. Immunity 10:153.[ISI][Medline]
  11. Zeleznik-Le, N. J., Azizkhan, J. C. and Ting, J. P. 1991. Affinity-purified CCAAT-box-binding protein (YEBP) functionally regulates expression of a human class II major histocompatibility complex gene and the herpes simplex virus thymidine kinase gene. Proc. Natl Acad. Sci. USA 88:1873.[Abstract/Free Full Text]
  12. Ting, J. P., Painter, A., Zeleznik-Le, N. J., MacDonald, G., Moore, T. M., Brown, A. and Schwartz, B. D. 1994. YB-1 DNA-binding protein represses interferon gamma activation of class II major histocompatibility complex genes. J. Exp. Med. 179:1605.[Abstract/Free Full Text]
  13. Moreno, C. S., Emery, P., West, J. E., Durand, B., Reith, W., Mach, B. and Boss, J. M. 1995. Purified X2 binding protein (X2BP) cooperatively binds the class II MHC X box region in the presence of purified RFX, the X box factor deficient in the bare lymphocyte syndrome. J. Immunol. 155:4313.[Abstract]
  14. Louis-Plence, P., Moreno, C. S. and Boss, J. M. 1997. Formation of a regulatory factor X/X2 box-binding protein/nuclear factor-Y mutiprotein complex on the conserved regulatory regions of HLA class II genes. J. Immunol. 159:3899.[Abstract]
  15. Steimle, V., Otten, L. A., Zufferey, M. and Mach, B. 1993. Complementation cloning of an MHC class II transactivator mutated in hereditary MHC class II deficiency (or bare lymphocyte syndrome). Cell 75:135.[ISI][Medline]
  16. Riley, J. L., Westerheide, S. D., Price, J. A., Brown, J. A. and Boss, J. M. 1995. Activation of class II MHC genes requires both the X box region and the class II transactivator (CIITA). Immunity 2:533.[ISI][Medline]
  17. Darnell, J. E., Jr, Kerr, I. M. and Stark, G. R. 1994. Jak–STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 264:1415.[Abstract/Free Full Text]
  18. Shuai, K., Schindler, C., Prezioso, V. R. and Darnell, J. E., Jr. 1992. Activation of transcription by IFN-gamma: tyrosine phosphorylation of a 91-kD DNA binding protein. Science 258:1808.[Abstract/Free Full Text]
  19. Lee, Y. J. and Benveniste, E. N. 1996. Stat1 alpha expression is involved in IFN-gamma induction of the class II transactivator and class II MHC genes. J. Immunol. 157:1559.[Abstract]
  20. Meraz, M. A., White, J. M., Sheehan, K. C., Bach, E. A., Rodig, S. J., Dighe, A. S., Kaplan, D. H., Riley, J. K., Greenlund, A. C., Campbell, D., Carver-Moore, K., DuBois, R. N., Clark, R., Aguet, M. and Schreiber, R. D. 1996. Targeted disruption of the Stat1 gene in mice reveals unexpected physiologic specificity in the JAK–STAT signaling pathway. Cell 84:431.[ISI][Medline]
  21. Wu, Z., Biro, P. A., Mirakian, R., Hammond, L., Curcio, F., Ambesi-Impiombato, S. and Bottazzo, G. F. 1999. HLA-DMB expression by thyrocytes: indication of the potentially antigen-processing and presenting capability of thyroid cells. Clin. Exp. Immunol. 116:62.[ISI][Medline]
  22. Bottazzo, G. F., Pujol-Borrell, R., Hanafusa, T. and Feldmann, M. 1983. Role of aberrant HLA-DR expression and antigen presentation in induction of endocrine autoimmunity. Lancet ii:1115.
  23. Sospedra, M., Obiols, G., Babi, L. F., Tolosa, E., Vargas, F., Roura-Mir, C., Lucas-Martin, A., Ercilla, G. and Pujol-Borrell, R. 1995. Hyperinducibility of HLA class II expression of thyroid follicular cells from Graves' disease. A primary defect? J. Immunol. 154:4213.[Abstract]
  24. Reith, W., Satola, S., Sanchez, C. H., Amaldi, I., Lisowska-Grospierre, B., Griscelli, C., Hadam, M. R. and Mach, B. 1988. Congenital immunodeficiency with a regulatory defect in MHC class II gene expression lacks a specific HLA-DR promoter binding protein, RFX. Cell 53:897.[ISI][Medline]
  25. Shimojo, N., Kohno, Y., Yamaguchi, K., Kikuoka, S., Hoshioka, A., Niimi, H., Hirai, A., Tamura, Y., Saito, Y., Kohn, L. D. and Tahara, K. 1996. Induction of Graves-like disease in mice by immunization with fibroblasts transfected with the thyrotropin receptor and a class II molecule. Proc. Natl Acad. Sci. USA 93:11074.[Abstract/Free Full Text]
  26. Moses, H., Panek, R. B., Benveniste, E. N. and Ting, J. P. 1992. Usage of primary cells to delineate IFN-gamma-responsive DNA elements in the HLA-DRA promoter and to identify a novel IFN-gamma-enhanced nuclear factor. J. Immunol. 148:3643.[Abstract]
  27. Montani, V., Taniguchi, S.-I., Shong, M., Suzuki, K., Ohmori, M., Giuliani, C., Napolitano, G., Saji, M., Fiorentino, B., Reimold, A. M., Ting, J. P., Kohn, L. D. and Singer, D. S. 1998. Major histocompatibility class II HLA-DR{alpha} gene expression in thyrocytes: counter regulation by the class II transactivator and the thyroid Y box protein. Endocrinology 139:280.[Abstract/Free Full Text]
  28. Montani, V., Shong, M., Taniguchi, S.-I., Suzuki, K., Giuliani, C., Napolitano, G., Saito, J., Saji, M., Fiorentino, B., Reimold, A. M., Singer, D. S. and Kohn, L. D. 1998. Regulation of major histocompatibility class II gene expression in FRTL-5 thyrocytes: opposite effects of interferon and Methimazole. Endocrinology 139:290.[Abstract/Free Full Text]
  29. Balducci-Silano, P. L., Suzuki, K., Ohta, M., Saito, J., Ohmori, M., Montani, V., Napolitano, G., Shong, M., Taniguchi, S. I., Pietrarelli, M., Lavaroni, S., Mori, A., Singer, D. S. and Kohn, L. D. 1998. Regulation of major histocompatibility (MHC) class II human leukocyte antigen-DR{alpha} gene expression in thyrocytes by single strand binding protein-1, a transcription factor that also regulates thyrotropin receptor and MHC class I gene expression. Endocrinology 139:2300.[Abstract/Free Full Text]
  30. Rigaud, G., De Lerma Barbaro, A., Nicolis, M., Cestari, T., Ramarli, D., Riviera, A. P. and Accolla, R. S. 1996. Induction of CIITA and modification of in vivo HLA-DR promoter occupancy in normal thymic epithelial cells treated with IFN-gamma: similarities and distinctions with respect to HLA-DR-constitutive B cells. J. Immunol. 156:4254.[Abstract]
  31. Curcio, F., Ambesi-Impiombato, F. S., Perrella, G. and Coon H. G. 1994. Long-term culture and functional characterization of follicular cells from adult normal human thyroids. Proc. Natl Acad. Sci. USA 91:9004.[Abstract/Free Full Text]
  32. Foley, G. E., Lazarus, H., Farber, S., Uzman, B. G., Boone, B. A. and McCarthy, R. E. 1965. Continuous culture of human lymphoblasts from peripheral blood of a child with acute leukemia. Cancer 18:522.[ISI][Medline]
  33. Williams, K. M. and Raybourne, R. B. 1990. Demonstration of cross-reactivity between bacterial antigens and class I human leukocyte antigens by using monoclonal antibodies to Shigella flexneri. Infect. Immun. 58:1774.[Abstract/Free Full Text]
  34. Dent, C. L. and Lactchman, D. S. 1993. The DNA mobility shift assay. In Latchman, D. S., ed., Transcription Factors: A Practical Approach, p. 1. IRL Press, Oxford.
  35. Dignam, J. D., Lebovitz, R. M. and Roeder, R. G. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475.[Abstract/Free Full Text]
  36. Iton-Lindstrom, Y., Peterlin, B. M. and Ting, J. P-Y. 1995. Affinity enrichment and functional characterization of TRAX1, a novel transcription activator and X1-squence-binding protein of HLA-DRA. Mol. Cell. Biol. 15:282.[Abstract]
  37. Sambrook, J., Fritsch, E. F. and Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  38. Todd, I., Pujol-Borrell, R., Hammond, L., Bottazzo, G. F. and Feldmann, M. 1985. Interferon-{gamma} induces HLA-DR expression by thyroid epithelium. Clin. Exp. Immunol. 61:265.[ISI][Medline]
  39. Sadowski, H. B., Shuai, K., Darnell, J. E., Jr and Gilman, M. Z. 1993. A common nuclear signal transduction pathway activated by growth factor and cytokine receptors. Science 261:1739.[Abstract/Free Full Text]
  40. Boothby, M., Liou, H. C. and Glimcher, L. H. 1989. Differences in DNA sequence specificity among MHC class II X box binding proteins. J. Immunol. 142:1005.[Abstract]
  41. Cox, P. M. and Goding, C. R. 1992. An ATF/CREB binding motif is required for aberrant constitutive expression of the MHC class II DR alpha promoter and activation by SV40 T-antigen. Nucleic Acids Res. 20:4881.[Abstract/Free Full Text]
  42. MacDonald, G. H., Itoh-Lindstrom, Y. and Ting, J. P. 1995. The transcriptional regulatory protein., YB-1., promotes single-stranded regions in the DRA promoter. J. Biol. Chem. 270:3527.[Abstract/Free Full Text]
  43. van Huijsduijnen, R. H., Li, X. Y., Black, D., Matthes, H., Benoist, C. and Mathis, D. 1990. Co-evolution from yeast to mouse: cDNA cloning of the two NF-Y (CP-1/CBF) subunits. EMBO J. 9:3119.[ISI][Medline]
  44. Mantovani, R., Pessara, U., Tronche, F., Li, X. Y., Knapp, A. M., Pasquali, J. L., Benoist, C. and Mathis, D. 1992. Monoclonal antibodies to NF-Y define its function in MHC class II and albumin gene transcription. EMBO J. 11:3315.[ISI][Medline]
  45. Chrivia, J. C., Kwok, P. R., Lamb, N., Hagiwara, M., Montminy, M. R. and Goodman, R. H. 1993. Phosphorylated CREB binds specifically to the nuclear protein CBP. Nature 365:855.[Medline]
  46. Kee, B. L., Arias, J. and Montminy, M. R. 1996. Adaptor-mediated recruitment of RNA polymerase II to a signal-dependent activator. J. Biol. Chem. 271:2373.[Abstract/Free Full Text]
  47. Liou, H. C., Boothby, M. R., Finn, P. W., Davidon R., Nabavi, N., Zeleznik-Le, N. J., Ting, J. P. and Glimcher, L. H. 1990. A new member of the leucine zipper class of proteins that binds to the HLA DR alpha promoter. Science 247:1581.[Abstract/Free Full Text]
  48. Ono, S. J., Bazil, V., Levi, B. Z., Ozato, K. and Strominger, J. L. 1991. Transcription of a subset of human class II major histocompatibility complex genes is regulated by a nucleoprotein complex that contains c-fos or an antigenically related protein. Proc. Natl Acad. Sci. USA 88:4304.[Abstract/Free Full Text]
  49. Ono, S. J., Liou, H. C., Davidon, R., Strominger, J. L. and Glimcher, L. H. 1991. Human X-box-binding protein 1 is required for the transcription of a subset of human class II major histocompatibility genes and forms a heterodimer with c-fos. Proc. Natl Acad. Sci. USA 88:4309.[Abstract/Free Full Text]
  50. Andersson, G. and Peterlin, B. M. 1990. NF-X2 that binds to the DRA X2-box is activator protein 1. Expression cloning of c-Jun. J. Immunol. 145:3456.[Abstract]
  51. Kara, C. J., Liou, H. C., Ivashkiv, L. B. and Glimcher, L. H. 1990. A cDNA for a human cyclic AMP response element-binding protein which is distinct from CREB and expressed preferentially in brain. Mol. Cell. Biol. 10:1347.[Abstract/Free Full Text]
  52. Pieper, A. A., Verma, A., Zhang, J. and Snyder, S. H. 1999. Poly(ADP-ribose) polymerase, nitric oxide and cell death. Trends Pharmacol. Sci. 20:171.[Medline]
  53. Meisterernst, M., Stelzer, G. and Roeder, R. G. 1997. Poly(ADP-ribose) polymerase enhances activator-dependent transcription in vitro. Proc. Natl Acad. Sci. USA 94:2161.
  54. Kannan, P., Yu, Y., Wankhade, S. and Tainsky, M. A. 1999. PolyADP-ribose polymerase is a coactivator for AP-2 mediated transcriptional activation. Nucleic Acids Res. 27:866.[Abstract/Free Full Text]
  55. Butler, A. J. and Ordahl, C. P. 1999. Poly(ADP-ribose) polymerase binds with transcription enhancer factor 1 to MCAT1 elements to regulate muscle-specific transcription. Mol. Cell. Biol. 19:296.[Abstract/Free Full Text]
  56. Tsao, B. P., Cantor, R. M., Grossman, J. M., Shen, N., Teophilov, N. T., Wallace, D. J., Arnett, F. C., Hartung, K., Goldstein, R., Kalunian, K. C., Hanh, B. H. and Rotter, J. I. 1999. PARP alleles within the linked chromosomal region are associated with systemic lupus erythematosus. J. Clin. Invest. 103:1135.[ISI][Medline]
  57. Otten, L. A., Steimle, V., Bontron, S. and Mach, B. 1998. Quantitative control of MHC class II expression by the transactivator CIITA. Eur. J. Immunol. 28:473.[ISI][Medline]
  58. Gouilleux-Gruart, V., Gouilleux, F., Desaint, C., Claisse, J. F., Capiod, J. C., Delobel, J., Weber-Nordt, R., Dusanter-Fourt, I., Dreyfus, F., Groner, B. and Prin, L. 1996. STAT-related transcription factors are constitutively activated in peripheral blood cells from acute leukemia patients. Blood 87:1692.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Wu, Z.
Right arrow Articles by Bottazzo, G. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, Z.
Right arrow Articles by Bottazzo, G. F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us