International Immunology, Vol. 12, No. 3, 295-303,
March 2000
© 2000 Japanese Society for Immunology
Synthetic oligodeoxynucleotide containing CpG motif induces an anti-polysaccharide type 1-like immune response after immunization of mice with Haemophilus influenzae type b conjugate vaccine
Laboratorio di Batteriologia e Micologia Medica, Istituto Superiore di Sanità, Viale Regina Elena 299, 00161 Roma, Italy
Correspondence to: R. Nisini
| Abstract |
|---|
|
|
|---|
Synthetic oligodeoxynucleotides containing CpG motifs [immunostimulatory sequences (ISS)] have been described as potent adjuvants of type 1 immune responses when co-administered with protein or peptide vaccines. To investigate their role in the immune response to polysaccharides (CHO), different preparations of anti-Haemophilus influenzae type b (Hib) conjugate vaccine were administered to mice. The unconjugated CHO did not induce the synthesis of specific antibodies even in the presence of ISS. On the other hand, anti-CHO-specific antibodies significantly increased in the presence of ISS, when tetanus (TT) or diphtheria [cross-reacting material (CRM)] toxoid-conjugated CHO were used to immunize mice. The adjuvant effect was also observed for the immune response against the carrier protein (TT and CRM). ISS insured an early and long-lasting specific IgG production. The effects of ISS on the anti-CHO immune response could be attributed to the amplification of the T help provided by the carrier. The analysis of anti-CHO IgG subclasses showed a significant increase of IgG2a and IgG3 in the presence of ISS. ISS caused a rapid release of IL-12 and IFN-
in sera from treated mice. This data provide a first evidence for the ability of ISS to induce an anti-CHO type 1-like immune response and demonstrate that ISS have the potential to increase host antibody response against both the CHO and the protein component of a conjugated vaccine.
Keywords: Hib conjugate vaccine, immunostimulatory sequences, polysaccharide, type 1 immune response
| Introduction |
|---|
|
|
|---|
Polysaccharides (CHO) are considered T-independent antigens because of their inability to specifically activate T cells (1). Moreover, the ability to respond to purified CHO is age dependent and children <18 months usually are unable to mount an anti-CHO antibody response (2). The conjugation of CHO to a carrier protein improves the immunogenicity because of the T-dependent help conferred by the protein (3,4). Thus, also in the case of responses to conjugated CHO, it can be speculated that the type of Th cells (Th1 or Th2) can modulate the amount and the isotype switch of anti-CHO IgG. Antigen-specific CD4+ cell responses can be divided into type 1 and type 2 on the basis of cytokine secretion and effector function (5). Type 1 responses involve Th1 cells that differentiate in an IL-12 (produced by macrophages) and IFN-
(produced by NK and T cells) milieu. On the contrary, type 2 responses involve IL-4-dependent differentiation of Th2 cells, and are associated with IL-5 secretion and decreased macrophage activation (6). Recently, it has been shown that along with whole bacterial DNA, synthetic oligodeoxynucleotides (ODN) containing unmethylated CpG dinucleotides in particular base contexts [immunostimulatory sequences (ISS)] (7) cause activation of B and NK cells (8,9) as well as antigen-presenting cells (APC) (10). When co-administered in experimental animals with proteins or peptides, ISS act as potent adjuvants and induce type 1 immune responses (11) even with poor immunogenic antigens (12). Nonetheless, when used to increase an anti-CHO immune response, ISS not only failed in their adjuvant effect, but significantly reduced the synthesis of anti-CHO antibodies (13). This effect was interpreted by the authors as a probable consequence of a B cells polyclonal activation (13). However, at odds with T-independent antigens, the immune response to conjugated CHO relies upon different basis and the use of ISS as adjuvant could influence the amount and the subclasses of anti-CHO antibody produced following the vaccination.
Haemophilus influenzae type b (Hib) possesses a CHO capsule of polyribosyl ribitol phosphate. Antibodies against the specific capsular CHO have been shown to be protective against Hib. Several conjugate vaccines, used in infants during the first year of life, contributed to the decline of incidence of Hib-related diseases (14). The commercially available vaccines use different carrier proteins, such as tetanus toxoid (TT) or diphtheria toxoid (DT).
In this work, the effect of adding ISS to unconjugated Hib CHO as well as to TT- or cross-reacting material (CRM)-conjugated Hib vaccines was investigated in mice by studying whether ISS may influence the immune response to conjugated CHO. The antibody responses to both the CHO and the carrier as well as anti-CHO-specific IgG subclasses were evaluated. Furthermore, the cytokines production in mice vaccinated in the presence or absence of ISS and their kinetics of release in the serum was investigated, to obtain evidence of the type 1/type 2 specificity of the immune response to conjugated CHO. The aims of this study were to contribute to the understanding of the mechanisms involved in the T cell dependency of anti-CHO immune response, and to identify possible advantages of using ISS in the anti-Hib vaccination in terms of antibody response against both the CHO and the protein component of a conjugated vaccine.
| Methods |
|---|
|
|
|---|
Immunization protocol
Hib CHO and Neisseria meningitidis group A CHO (MenA) were a kind gift from Chiron (Siena, Italy). The DT (CRM197)-conjugated CHO and the TT-conjugated CHO used were part of the commercially available anti-Hib vaccines (Vaxem Hib; Chiron and Act-Hib; Pasteur Mérieux MSD, Lyon, France respectively) as well as the anti-tetanus vaccine (Imovax Tetano, Pasteur Mérieux MSD).
Phosphorotioated CpG ODN and non-ISS-containing ODN (M-ODN) were synthesized (M-Medica, Firenze, Italy) according to published sequences (7) (TGACTGTGAACGTTCGAGATGA and TGACTGTGAAGCTTCGAGATGA respectively).
Groups (n = 510) of female BALB/c or CD1 mice (68 weeks old; Charles River, Calco, Lecco, Italy) were immunized by intradermal (i.d.) injection of 2.5 µg/mouse of CHO or conjugated-CHO (CHOTT or CHOCRM) in combination with M-ODN or ISS at 50 µg in a total volume of 50 µl. In some experiments, mice were immunized by s.c. injection. Unconjugated CHO and CHOCRM conjugate vaccine were administered in a three-dose schedule (0, 10 and 20 days). CHOTT conjugate vaccine was administered in a two-dose schedule (0 and 14 days). M-ODN or ISS were administered in the first inoculum only. Where indicated, CHOCRM or ISS were used at decreasing concentrations (2.50.67 and 401.25 µg respectively). Unconjugated CHO was also administered i.d. mixed with 4 IU of anti-tetanus vaccine per mouse (mix CHO/TT) or s.c. in incomplete Freund's adjuvant (IFA), alone or in combination with ISS.
Collection of samples
Plasma was collected by retro-orbital puncture 40 days after the first inoculum of CHO or CHOCRM and 21 days after the first inoculum of CHOTT, unless specified in selected experiments. Samples were frozen at 80°C until use.
Evaluation of the immune response
Anti-Hib CHO serum antibody levels were determined by ELISA. A human albumin-conjugated Hib CHO (HSACHO; gift from Chiron) was used at 10 µg/ml in PBS (100 µl/well) to coat flat-bottomed 96-well microtiter plates (Dynatech, Chantilly, VA) overnight at 4°C. The HSACHO conjugate was used to detect anti-CHO antibodies because it binds to the plates better than unconjugated CHO and does not react with anti-TT or -CRM antibodies elicited by the conjugate vaccines used. Plates were then incubated for 1 h at 4°C with 2% BSA in PBS (post-coat). Sera (non-immune controls and test sera) diluted 1:100 and 2-fold dilutions (1:501:3400) of the reference serum in PBS containing 0.2% BSA and 0.1% Tween 20 were added to appropriate wells. After overnight incubation at 4°C and washings, plates were incubated with anti-Ig (IgG + IgM + IgA) or anti-IgG (
chain specific) goat anti-mouse antibodies conjugated with alkaline phosphatase (Southern Biotechnology Associates, Birmingham, AL). After a 1 h incubation and washings, p-nitrophenylphosphate (Sigma, St Louis, MO) was added as a substrate. The reaction was blocked with 2 M NaOH and the absorbance evaluated at 405 nm using the Microtiter reader Victor-1420 multilabel counter (EG & G/Wallac, Turku, Finland). All tests were designed to compare in the same ELISA plate sera from mice belonging to different experimental groups. To minimize plate-to-plate variations, data were normalized using, as reference in each plate, a hyperimmune mouse serum containing anti-Hib CHO antibody (kind gift from Pasteur Mérieux MSD) and expressed as ELISA units (EU). Mice were considered responders when the serum anti-CHO EU values were >2 times the mean EU value of non-immune mice.
To assess the specificity of anti-CHO ELISA, 50 µl of 10-fold dilutions (20000.0002 pg/ml) of Hib CHO or MenA were added to HSACHO-coated plates immediately before 50 µl of the reference serum diluted 1:50. The plates were then treated as reported above.
The antibody response to the carrier proteins was evaluated as previously described (15). Briefly, TT or CRM were used to coat microtiter plates at 10 µg/ml in carbonatebicarbonate buffer overnight. After washings and a 1 h post-coat, sera diluted 1:100 in PBS-T were added and incubated for 3 h at room temperature. Bound antibodies were detected using alkaline phosphatase-conjugated goat anti-mouse IgG as described above.
Subclasses of anti-Hib CHO IgG+ sera were determined using rat anti-mouse IgG subclass mAb labeled with biotin (PharMingen, San Diego, CA) and horseradish peroxidase-conjugated streptavidin (PharMingen). After the addition of o-phenylenediamine (Sigma fast; Sigma) the reaction was stopped with 2 N H2SO4 and the absorbance was evaluated with the plate reader at 490 nm. A pool of sera from mice vaccinated s.c. with CHO-conjugate vaccine was used as reference serum. In this serum, IgG1 and IgG3 were respectively the most and the least represented anti-CHO IgG subclasses. Thus, 1000 U for IgG1, IgG2a and IgG2b, and 100 U for IgG3 were arbitrarily chosen as anti-CHO subclass contents of the reference serum (16). In each assay 2-fold dilution of the reference serum were tested. The results were expressed relative to the arbitrary units (AU) of the reference serum.
Cytokine determination
Groups of CD1 mice were vaccinated i.d. with CHOTT in the presence or absence of ISS in the first inoculum or treated with 50 µg/mouse of ISS and saline 14 days apart. Three mice per group were sacrificed at 6, 24, 48 and 72 h after the first and the second inoculation. Sera within each group were pooled and the kinetics of cytokines secretion evaluated using commercially available ELISA kits (R & D, Minneapolis, MN) according to the manufacturer's procedures.
Statistical analysis
Data were expressed as arithmetic mean ± SD and analyzed by the Statview 4.1 program (Abacus Concepts, Berkeley, CA). Data were analyzed for normal distribution and the statistical significance of the difference between groups was determined by the two-tailed unpaired Student's t-test. Differences were considered significant with P < 0.05.
| Results |
|---|
|
|
|---|
Anti-CHO antibodies following vaccination with CHO, CHOTT or CHOCRM in the presence or absence of ISS
Mice were immunized with CHO, CHOCRM or CHOTT in the presence or absence of ISS and anti-CHO antibodies were detected by ELISA. The use of a protein-conjugated CHO (CHOHSA) to coat ELISA plates allowed a good and reproducible CHO binding to the plates, and the detection of anti-CHO antibodies without the interference of anti-TT or anti-CRM antibodies elicited by the conjugated vaccines used. In fact, sera from TT and CRM vaccinated mice did not react in anti-CHO ELISA (data not shown). Anti-Hib CHO ELISA was specifically inhibited by soluble Hib CHO, but not by another polysaccharide such as MenA (Fig. 1A
|
In preliminary experiments we determined the optimal dose and schedule for each conjugate vaccine without ISS. CHOCRM vaccine gave the best results when administered 3 times (day 0, 10 and 20) at 2.5 µg/mouse, while CHOTT did the best when administered twice at the same dose (days 0 and 14). Unconjugated CHO failed to induce specific antibodies, whatever the schedule.
The influence of ISS was first assessed in BALB/c mice vaccinated i.d. with unconjugated or conjugated CHO (Table I
). There was a measurable anti-CHO IgG production when using the conjugate vaccines, but the response was notably increased when the vaccines were administered with ISS. In particular, in the CHOCRM vaccination model, where BALB/c mice responded (CHOCRM versus non-immune controls: P < 0.05) constantly with a low anti-CHO IgG production, the adjuvant effect of ISS was magnified (CHOCRM + ISS versus CHOCRM, P < 0.001). In the absence of ISS, the majority of BALB/c mice vaccinated with CHOTT showed high levels of anti-CHO IgG, thus rendering less evident the adjuvanticity of ISS. The unconjugated CHO was not capable to induce a significant specific response even when co-administered with ISS i.d. in saline (Table 1
) or s.c. in IFA (data not shown). In addition, no anti-CHO response was observed following immunization with the Hib CHO non-chemically bound to TT, irrespective on the co-administration of ISS: the CHO/TT mixture resulted in elevated anti-TT (see below), but not anti-CHO antibodies.
|
The adjuvant effect of ISS was also tested in the outbred CD1 mouse strain. Inasmuch as in preliminary experiments CD1 mice showed good immune responses to the CHO-conjugate vaccines when immunized s.c. and data from the literature indicated the i.d. as the route of injection of ISS (26), we chose CD1 mice to test the adjuvant effect of ISS in dependence on the injection route. No significant differences in the mean anti-CHO IgG levels were observed following immunization with CHO-conjugate vaccine inoculated i.d. or s.c. (i.d. versus s.c., P > 0.05), but the number of responding mice was increased when the vaccine was given i.d. (Fig. 2A
|
To determine the influence of ISS on the persistence of specific antibodies, CD1 mice were tested for the anti-CHO IgG levels 120 days after the vaccination (Fig. 2B
All together, these data indicate that ISS are effective adjuvants for CHO-conjugate vaccines. When ISS were co-administered in the first dose of vaccines, not only was the antibody response more vigorous, but also its persistence was enhanced. The adjuvant effect was evident in inbred as well as in outbred mouse strains, when the i.d. administration route was used. However, the adjuvant activity of ISS was clearly observed only when the CHO was chemically linked to a carrier protein: no anti-CHO antibodies were detected immunizing mice in the presence of ISS with CHO or CHO/protein vaccine mixtures.
Dose-dependent adjuvant activity of ISS
BALB/c mice were immunized i.d. with CHOCRM vaccine (2.5 µg/mouse) and different doses of ISS in the first inoculum to assess the minimal amount of ISS required for a measurable adjuvant activity. A significant increase of anti-CHO specific IgG levels was observed when ISS was used at 40 and 20 µg (CHOCRM + ISS-40 µg and CHOCRM + ISS-20 µg versus CHOCRM, P < 0.05) (Fig. 3
). At the dose of 10 µg, the increase of IgG levels approached borderline significance (P = 0.0543).
|
Influence of ISS on the dose of CHO-conjugate vaccines
Preliminary experiment showed that the use of 2.5 µg of CHO-conjugate vaccine resulted in the maximal antibody response. BALB/c mice were vaccinated with decreasing doses of CHOCRM, in the presence of 50 µg/mouse of ISS in the first inoculum, to verify the adjuvant effect of ISS with lower amounts of the conjugate vaccine. The mean anti-CHO IgG level in mice vaccinated with doses as low as 0.67 µg of CHOCRM in the presence of ISS was higher than that obtained with the standard 2.5 µg dose without ISS (data not shown). These data indicate that by the use of ISS the dose of CHOCRM vaccine needed to obtain the same levels of serum anti-CHO specific IgG can be reduced to one-fourth.
Influence of ISS on the anti-CHO IgG subclasses detected following s.c. or i.d. immunization with conjugated vaccine
The specific IgG subclasses pattern induced by a vaccination is indirect evidence for the preferential type 1 or type 2 immune response evoked by the antigen and/or for the influence of the adjuvant. ISS are described as inducer of type 1 immune response. In this contest, it was interesting to analyze the IgG subclass production against a classical T-independent antigen such as a CHO upon the adjuvant effect of ISS in the CHO-conjugate vaccine model. When CD1 mice were immunized s.c. in the absence of ISS, IgG1 was the main anti-CHO IgG subclass detected (Fig. 4A
). A single 50 µg dose of ISS in the first inoculum determined the increase of IgG2a and IgG2b with a dramatic increase of IgG3 (IgG2a s.c. versus IgG2a s.c. + ISS, P < 0.005; IgG2b s.c. versus IgG2b s.c. + ISS, P < 0.01; IgG3 s.c. versus IgG3 s.c. + ISS, P < 0.001). When the vaccine was administered i.d. (Fig. 4B
) an IgG3 level higher than that obtained with the administration s.c. was observed. A single 50 µg dose of ISS in the first inoculum determined an anti-CHO IgG subclasses profile that characterizes type 1 responses. In particular, a relative increase of IgG2a and IgG3 was observed (IgG2a i.d. versus IgG2a i.d. + ISS, P < 0.001; IgG2b i.d. versus IgG2b i.d. + ISS, P = 0.4; IgG3 i.d. versus IgG3 i.d. + ISS, P < 0.05). Interestingly, ISS did not affect the mean anti- CHO IgG1 production, that remained at a level similar to that obtained in their absence, irrespective of the route of inoculum (IgG1 s.c. versus IgG1 s.c. + ISS, P = 0.57; IgG1 i.d. versus IgG1 i.d. + ISS, P = 0.74).
|
Influence of ISS on the antibody response against the carrier protein
We examined whether the increased anti-CHO response obtained in the presence of ISS paralleled the anti-carrier IgG synthesis. As shown in Fig. 5
|
Influence of ISS on serum cytokine levels in mice vaccinated with conjugated Hib CHO
It has been shown that one of the reasons for the adjuvant effect of ISS is their ability to induce the synthesis of cytokines by APC, B lymphocytes and NK cells. We measured the in vivo cytokine production after the administration of ISS alone or the CHOTT vaccine in the presence or absence of ISS. Table 2
already detectable at 6h. At 48 h the serum cytokine level was lower than at 24 h. There was a low IFN-
serum release and a detectable (~10 pg/ml) production of IL-5 at 24 h after the second inoculum (data not shown). ISS given alone induced an increasing production of cytokines up to 48 h after the injection, that was mainly characterized by a continuous release of IFN-
from 6 to 72 h after the first inoculum; no measurable IL-5 was detected (data not shown). The co-administration of vaccine and ISS caused the release of high cytokine levels already detectable at 6 h. The highest levels of IL-12 and IFN-
were respectively observed at 6 and 48 h after the injection. No measurable IL-5 was detected (data not shown). These data indicate that the i.d. inoculum of ISS induces the systemic release of type 1-defining cytokines and that the serum release is enhanced when the conjugated vaccine is co-administered.
|
| Discussion |
|---|
|
|
|---|
In this work we investigated the adjuvant role of synthetic ODN containing CpG motifs defined as ISS in the anti-Hib vaccination, that is a prototype of CHO-carrier conjugate vaccine. Two commercially available vaccine preparations, CHOTT and CHOCRM, were tested in mice. ISS have been proposed to act as a danger signal that warns of bacterial infections and activates immune defenses (17). ISS induce activation of APC (10,18) providing the initial cytokine milieu that sustains the development of type 1 immune responses. Thus, we tested whether the signal provided by ISS might function as adjuvant to induce a type 1-like immune response against Hib CHO. In a previous paper (13), ISS were shown to fail in promoting an anti-CHO immune response. Here we demonstrate that ISS are good adjuvants of the anti-CHO response, if a CHO conjugate vaccine is used. Furthermore, while the anti-CHO IgG obtained with the CHO-conjugate vaccine were mainly IgG1, in the presence of ISS the additional production of anti-CHO IgG2a and IgG3 was observed. This finding can be considered as a consequence of a type 1-like immune response (19) induced by ISS. It is remarkable that these IgG subclasses fix the complement (20) and their production is particularly desirable in anti-capsulated bacteria immune responses.
We also studied the cytokine secretion after administration of ISS alone or ISS and CHOTT vaccine, in comparison to the CHOTT vaccine in the absence of ISS. We confirmed that ISS induce the production of IL-12 and IFN-
, that define type 1 immune responses, but with a kinetics of secretion slightly different to that previously described (2123), probably because of the different route of inoculum (i.d. in our experiments, i.p. in others). In addition, we could demonstrate that the production of IL-12 and IFN-
was greatly increased when ISS was administered together with the CHOTT vaccine, indicating that ISS and the vaccine have a summative stimulating activity on the innate immunity (24).
The effects of ISS on the anti-CHO immune response can be attributed to the amplification of the T help provided by the carrier. We observed in fact that the increase of anti-CHO antibodies paralleled the increase of anti-carrier antibodies in the presence of ISS. Thus, our data confirm the hypothesis that after immunization with CHO-carrier conjugate vaccines, anti-CHO-specific B cells precursors receive help by CD4+ T cells (Th) that are simultaneously activated by the carrier processed and presented by professional APC. In addition, anti-CHO-specific B cells, capturing the conjugate vaccine through the CHO, could process the carrier. CHO-specific B cells could then present epitopes derived from the carrier to carrier-specific Th cells, thus receiving help in a cognate interaction (25). In any case, spatial and temporal vicinity between CHO-specific B and carrier-specific T cells are required: the activation of the innate immunity and the cytokine milieu induced by ISS were not sufficient to trigger B cells to initiate an anti-CHO antibody production when using unconjugated CHO, even if administered s.c. in IFA (26), or non-chemically bound to anti-tetanus vaccine. Hib capsular CHO behaves like an apten and our results confirm that cell-to-cell contacts of B cells, T cells or APC are essential to determine B cell maturation and Ig secretion even in the presence of soluble help provided by cytokines (27).
Finally, we showed that the inoculation route is relevant for both the anti-CHO response and the adjuvant effect of ISS. In general, the administration i.d. was shown to be more effective than the s.c. in inducing anti-CHO antibody and in maintaining high amount of detectable anti-CHO antibodies at the end of a 4 month follow-up. The adjuvant effect of ISS, measured as an increment of anti-CHO antibody levels, was significant when vaccines were administered i.d., but the anti-CHO subclass pattern was influenced by ISS also when administered s.c.. Differences in antigen-specific antibody levels have already been shown in dependence on the route of both soluble and DNA-based vaccine delivery (16,28). A possible interpretation of these differences may rely on the assumption that antigens encounter different APC when delivered in different body compartments. Vaccines administered i.d. have probably more chance to be captured by dermal dendritic cells (DC) and be delivered to regional lymph nodes (18). Antigen presentation by highly efficient APC such as DC (29) and the maintenance of antigen memory in terms of MHCpeptide complexes (30) on the membrane of mature DC for long periods may be responsible for the differential outcome of the i.d. vaccination.
In conclusion, this study demonstrates that the response to a CHO can be modulated by ISS, if the CHO is conjugated to a carrier protein. This observation gives indirect further evidence on the need of cell-to-cell contact between CHO-specific B cells, APC and carrier-specific Th cells for the differentiation of plasma cells secreting anti-CHO antibodies. Finally, this work provides first evidence for the ability of ISS to induce an anti-CHO type 1-like immune response and shows that the adjuvant activity of ISS in the immune response to proteins can be exploited to foster anti-CHO responses when using CHO-carrier conjugate vaccines. Shams and Heron (31) showed that Hib-conjugate vaccines induced neutralizing antibody against the carrier protein (TT). However, serum levels of anti-TT antibody were shown (3234) to be so low to require further anti-TT vaccinations to reach protective levels. It is tempting to speculate that the use of ISS could be useful in vaccines composed by a CHO conjugated to a carrier protein (such as TT or CRM) to obtain a simultaneous immunization effective on both the carrier and the CHO, without the need of discrete vaccinations.
| Acknowledgments |
|---|
We thank Professors A. Cassone and V. Barnaba for advice and critical review of the manuscript. This work was in part supported by Istituto Superiore Sanità, grant no. 50B/D.
| Abbreviations |
|---|
| APC antigen-presenting cells |
| CHO polysaccharide |
| CRM cross-reacting material |
| DC dendritic cells |
| DT diphtheria toxoid |
| EU ELISA units |
| Hib Haemophilus influenzae type b |
| i.d. intradermal injection |
| IFA incomplete Freund's adjuvant |
| ISS immunostimulatory sequences |
| ODN oligodeoxynucleotides |
| TT tetanus toxoid |
| Notes |
|---|
Transmitting editor: G. Doria
Received 6 September 1999, accepted 10 November 1999.
| References |
|---|
|
|
|---|
- Mond, J. J., Lees, A. and Snapper, C. M. 1995. T cell-independent antigens type 2. Annu. Rev. Immunol. 13:655.[Web of Science][Medline]
-
Peltola, H., Käyhty, H., Sivonen, A. and Mäkelä, P. H. 1977. Haemophilus influenzae type b capsular polysaccharide vaccine in children: a double-blind field study of 100 000 vaccinees 3 months to 5 years of age in Finland. Pediatrics. 60:730.
[Abstract/Free Full Text] -
Anderson, P. 1983. Antibody responses to Haemophilus influenza type b and diphtheria toxin induced by conjugates of oligosaccharides of the type b capsule with the nontoxic protein CRM197. Infect. Immun. 39:233.
[Abstract/Free Full Text] -
Schneerson, R., Barrera, O., Sutton, A. and Robbins, J. D. 1980. Preparation, characterization and immunogenicity of Haemophilus influenzae type b polysaccharide-protein conjugated. J. Exp. Med. 152:361.
[Abstract/Free Full Text] - Abbas, A. K., Murphy, K. M. and Sher, A. 1996. Functional diversity of helper T lymphocytes. Nature 383:787.[Medline]
- Seder, R. A. and Paul, W. E. 1994. Acquisition of lymphokine-producing phenotype by CD4+ T cells. Annu. Rev. Immunol. 12:635.[Web of Science][Medline]
- Roman, M., Martin-Orozco, E., Goodman, J. S., Nguyen, M. D., Sato, Y., Ronaghy, A., Kornbluth, R. S., Richman, D. D., Carson, D. A. and Raz, E. 1997. Immunostimulatory DNA sequences function as T helper-1-promoting adjuvants. Nat. Med. 3:849.[Web of Science][Medline]
-
Klinman, D. M., Yi, A. K., Beaucage, S. L., Conover, J. and Krieg, A. M. 1996. CpG motifs present in bacterial DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12, and interferon
. Proc. Natl Acad. Sci. USA 93:2879.[Abstract/Free Full Text] - Yamamoto, S., Yamamoto, T., Shimada, S., Kuramoto, E., Yano, O., Kataoka, T. and Tokunaga, T. 1992. DNA from bacteria, but not from vertebrates induces interferons, activates Natural Killer cells and inhibits tumor growth. Microbiol. Immunol. 36:983.[Web of Science][Medline]
- Pisetsky, D. S. 1996. Immune activation by bacterial DNA: a new genetic code. Immunity 5:303.[Web of Science][Medline]
-
Chu, R. S., Targoni, O. S., Krieg, A. M., Lehmann, P. V. and Harding, C. V. 1997. CpG oligodeoxynucleotides act as adjuvants that switch on T helper 1 (Th1) immunity. J. Exp. Med. 186:1623.
[Abstract/Free Full Text] -
Sun, S., Kishimoto, H. and Sprent, J. 1998. DNA as an adjuvant: capacity of insect DNA and synthetic oligodeoxynucleotides to augment T cell responses to specific antigen. J. Exp. Med. 187:1145.
[Abstract/Free Full Text] - Threadgill, D. S., McCormick, L. L., McCool, T. L., Greenspan, N. S. and Schreiber, J. R. 1998. Mytogenic synthetic polynucleotides suppress the antibody response to a bacterial polysaccharide. Vaccine 16:76.[Web of Science][Medline]
-
Murphy, T. V., White, K. E., Pastor, P., Gabriel, L., Medley, F., Granoff, D. M. and Osterholm, M. T. 1993. Declining incidence of Haemophilus influenzae type b disease since introduction of vaccination. J. Am. Med. Ass. 269:246.
[Abstract/Free Full Text] - Fagiolo, A., Amadori, A., Biselli, R., Paganelli, R., Nisini, R., Cozzi, E., Zamardini, R. and D'Amelio, R. 1993. Quantitative and qualitative analysis of anti-tetanus toxoid antibody response in the elderly. Humoral immune response enhancement by thymostimulin. Vaccine 11:1336.[Web of Science][Medline]
- Pertmer, T. M., Roberts, T. R. and Haynes, J. R. 1996. Influenza virus nucleoprotein-specific immunoglobulin G subclass and cytokine responses elicited by DNA vaccination are dependent on the route of vector DNA delivery. J. Virol. 70:6119.[Abstract]
- Krieg, A. M. 1996. Lymphocyte activation by CpG dinucleotide motifs in prokaryotic DNA. Trends Microbiol. 4:73.[Web of Science][Medline]
- Jacob, T., Walker, P. S., Krieg, A. M., Udey, M. C. and Vogel, J. C. 1998. Activation of cutaneous dendritic cells by CpG-containing oligodeoxynucleotides: a role for dendritic cells in the augmentation of Th1 responses by immunostimulatory DNA. J. Immunol. 28:2045
- Germann, T., Bongartz, M., Dlugonska, H., Hess, H., Schmitt, E., Kolbe, L., Kölsch, E., Podlaski, F. J., Gatley, M. K. and Rüde, E. 1995. Interleukin-12 profoundly up-regulates the synthesis of antigen-specific complement fixing IgG2a, IgG2b and IgG3 antibody subclasses in vivo. Eur. J. Immunol. 25:823.[Web of Science][Medline]
- Finkelman, F. D., Holmes, J., Katona, I. M., Urban, J. F., Beckmann, M. P., Park, L. S., Schooley, K. A., Coffman, R. L., Mosmann, T. R. and Paul, W. E. 1990. Lymphokine control of in vivo immunoglobulin isotype selection. Annu. Rev. Immunol. 8:303.[Web of Science][Medline]
-
Ruzek, M. C., Miller, A. H., Opal, S. M., Pearce, B. D. and Biron, C. A. 1997. Characterization of early cytokine responses and an Interleukine (IL)-6-dependent pathway of endogenous glucocorticoid induction during murine cytomegalovirus infection. J. Exp. Med. 185:1185.
[Abstract/Free Full Text] - Yi, A. E., Klinmann, D. M., Martin, T. L., Matson, S. and Krieg, A. M. 1966. Rapid immune activation by CpG motifs in bacterial DNA. Systemic induction of IL-6 transcription through an antioxidant-sensitive pathway. J. Immunol. 157:5394.[Abstract]
- Zhao, Q., Temsamani, J., Zhou, R. Z. and Agrawal, S. 1997. Pattern and kinetics of cytokine production following administration of phosphorothioate oligonucleotides in mice. Antisense Nucleic Acids Drug Dev. 7:495.[Web of Science][Medline]
-
Martin-Orozco, E., Kobayashi, H., Van Uden, J., Nguyen, M.-D., Kornbluth, R. S. and Raz, E. 1999. Enhancement of antigen-presenting cell surface molecules involved in cognate interactions by immunostimulatory DNA sequences. Int. Immunol. 11:1111.
[Abstract/Free Full Text] - Lanzavecchia, A. 1987. Antigen uptake and accumulation in antigen-specific B cells. Immunol Rev. 99:39.[Web of Science][Medline]
- Forsthuber, T., Yip, H. C. and Lehemann, P. V. 1996. Induction of Th1 and Th2 immunity in neonatal mice. Science 271:1728.[Abstract]
- Dullforce, P., Sutton, D. C. and Heath, A. W. 1998. Enhancement of T cell-independent immune responses in vivo by CD40 antibodies. Nat. Med. 4:88.[Web of Science][Medline]
-
Hocart, M. J., Mackenzie, J. S. and Stewart, J. A. 1989. The IgG subclass responses to Influenza virus haemagglutinin in the mouse: effect of route of inoculation. J. Gen. Virol. 70:809.
[Abstract/Free Full Text] -
Sallusto, F. and Lanzavecchia, A. 1999. Mobilizing dendritic cells for tolerance, priming, and chronic inflammation. J. Exp. Med. 189:611.
[Free Full Text] - Lanzavecchia, A, Reid, P.A. and Watts, C. 1992. Irreversible association of peptides with class II MHC molecules in living cells. Nature 357:249.[Medline]
- Shams, H. and Heron, I. 1998. The effect of conjugation on immunogenicity and potency of protein carriers of polyribosylribitol phosphate (PRP) conjugated vaccines in mouse model. APMIS 106:526.[Web of Science][Medline]
- Claesson, B. A., Trollfors, B., Lagergård, T., Taranger, J., Bryla, D., Otterman, G., Cramton, T., Yang, Y., Reimer, C. B, Robbins, J. B. and Schneerson, R. 1988. Clinical and immunologic response to the capsular polysaccharide of Haemophilus influenzae type b alone or conjugated to tetanus toxoid in 18 to 23 month-old children. J. Pediatr. 112:695.[Web of Science][Medline]
- Carlsson, R. M., Claesson, B. A., Iwarson, S., Lagergård, T. and Käyhty, H. 1994. Antibodies against Haemophilus influenzae type b and tetanus in infants after subcutaneous vaccination with PRP-T/diphtheria, or PRP-OMB/diphtheria-tetanus vaccines. Pediatr. Infect. Dis. J. 13:27.[Web of Science][Medline]
- Carlsson, R. M., Claesson, B. A., Lagergärd, T. and Käyhty, H. 1996. Serum antibodies against Haemophilus influenzae type b and tetanus at 2.5 years of age: a follow-up of 2 different regimens of infant vaccination. Scand. J. Infect. Dis. 28:519.[Web of Science][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




