International Immunology, Vol. 12, No. 2, 151-160,
February 2000
© 2000 Japanese Society for Immunology
IL-12 synergizes with IL-18 or IL-1ß for IFN-
production from human T cells
1 Third Department of Internal Medicine,
2 Department of Immunology and Medical Zoology, and
3 Laboratory of Host Defenses, Institute for Advanced Medical Sciences, Hyogo College of Medicine, Nishinomiya 663-8501, Japan
4 Fujisaki Institute, Hayashibara Biochemical Laboratories, Okayama 702-8006, Japan
5 CREST of Japan Science and Technology Corp., Tokyo 101-0062, Japan
Correspondence to: K. Nakanishi, Department of Immunology and Medical Zoology, Hyogo College of Medicine, 1-1 Mukogawa-cho, Nishinomiya, Hyogo 663-8501, Japan
| Abstract |
|---|
|
|
|---|
IL-18 is a proinflammatory cytokine that plays an important role in NK cell activation and Th1 response. IL-18 has a structural homology to IL-1, particularly IL-1ß. IL-18R, composed of IL-1R-related protein (IL-18R
) and IL-1R accessory protein-like (IL-18Rß), belongs to the IL-1R family. Furthermore, IL-18R at least partly shares the signal transducing system with IL-1R. Thus, the IL-18IL-18R system has a striking similarity to the IL-1IL-1R system. For this reason, we regarded it important to investigate whether, like IL-18, IL-1ß synergizes with IL-12 in inducing IFN-
production from human T cells and plays an important role in the Th1 response. Here we show that IL-12 and IL-1ß synergistically induce T cells to proliferate and produce IFN-
without their TCR engagement. IL-12 stimulation induced an increase in the proportion of T cells positive for IL-18R. Then, IL-12-stimulated T cells responded to IL-18 or IL-1ß by their proliferation and IFN-
production, although levels of IL-1ß-induced responses were lower. CD4+CD45RA+ T cells, although they constitutively expressed IL-18Rß mRNA, did not express IL-18R
mRNA. Phytohemagglutinin (PHA) stimulation alone induced IL-18R
mRNA without affecting the expression of IL-18Rß mRNA. Th1-inducing conditions (PHA, IL-12 and anti-IL-4) further increased this expression. We also show that Th1 cells but not Th2 cells have increased expression of IL-18R and IL-1R, and produce IFN-
in response to IL-18 and/or IL-1ß.
Keywords: IL-12, IL-18, IL-1ß, IFN-
, human Th1
| Introduction |
|---|
|
|
|---|
IL-18, originally described as IFN-
-inducing factor, is secreted from activated macrophages and Kupffer cells (13). The major activity associated with this cytokine is induction of IFN-
production from CD4+ Th1 cells, T cells, B cells and NK cells, especially in collaboration with IL-12 (1,2,410). IL-18 stimulates NK cells and Th1 cells to express Fas ligand as well as perforin-mediated cytotoxicity (4,1014). Moreover, IL-18 acts on Th1 cells to proliferate and produce IFN-
, IL-2, granulocyte macrophage colony stimulation factor and IL-2R
chain, whereas IL-18 has no such activity on Th2 cells (58).
We and others demonstrated that IL-12 induces IL-18R on T cells (7,1517). This was further confirmed by demonstrating that functional IL-18R is selectively expressed on Th1 but not on Th2 cells (15,16). Thus, IL-18R can be regarded as a differentiation marker on Th1 cells. Interestingly, IL-18 can increase the effect of IL-12 by up-regulating IL-12Rß2 on Th1 cells (16). Therefore, reciprocal up-regulation of the expression of the other's receptor partly but clearly explains the mechanism how IL-12 and IL-18 synergize for IFN-
production from Th1 cells. These results strongly indicate the importance of examination of expression of IL-18R on human T cells, especially on Th1 cells, although such study is entirely lacking in human T cells.
Accumulated lines of evidence suggest that the IL-18IL-18R system has similarity to the IL-1IL-1R system in various respects (1,1836). IL-18 has a structural homology to IL-1, particularly IL-1ß (24). Like IL-1ß, IL-18 is synthesized as a biologically inactive precursor form in activated macrophages and Kupffer cells, and becomes active after cleavage with caspase-1 (3,25). IL-18R is composed of a ligand-binding chain, IL-1R-related protein (IL-1Rrp) or IL-18R
(26,27), and a non-binding chain, IL-1R accessory protein-like (AcpL) or IL-18Rß (28), both of which belong to the IL-1R family (20,29,30). The IL-1R complex is composed of IL-1R type 1 (IL-1RI) and IL-1R Acp (29,30). Furthermore, IL-18 has, at least in part, a common signal transducing pathway shared with IL-1 (8,3136). After the activation of receptors, a common adaptor molecule, MyD88, binds to IL-1R type 1 (IL-1RI) or IL-18R
(31,32), which then activates IRAK to phosphorylate TRAF-6, resulting in nuclear transportation of NF
B in IL-1- or IL-18-stimulated cells (8,3136). The promoter region of the IFN-
gene contains the consensus sequences for STAT-4, AP-1, NFAT and NF
B (37,38). IL-12 activates STAT4, and IL-1 as well as IL-18 activates AP-1 and NF
B (36,37), suggesting the possibility of synergistic action of IL-12 and IL-1 on IFN-
production. Indeed, several studies have indicated that IL-1 and IL-12 synergistically stimulate murine NK cells,
ß and 
T cells or human peripheral blood mononuclear cells (PBMC) to produce IFN-
(3943). Thus, it is important to compare the action of IL-1 and IL-18 on IL-12-stimulated T cells or Th1 cells.
Naive human T cells can develop into Th1 or Th2 cells when they are stimulated under Th1- or Th2 cell-inducing conditions respectively (44,45). Here we examine whether IL-12 synergizes with IL-18 or IL-1ß for IFN-
production from human T cells through the induction of the corresponding receptor. We show that IL-12 has the capacity to induce an increase in the expression of IL-18R
without affecting the expression of IL-18Rß, that is constitutively expressed in CD45RA+ T cells. We also demonstrate that only Th1 cells increase expression of both IL-18R and IL-1R and show strong capacity to produce IFN-
in response to anti-CD3 plus IL-18 or IL-1ß.
| Methods |
|---|
|
|
|---|
Reagents
Recombinant human IL-12, IL-1ß and IFN-
were purchased from R & D systems (Minneapolis, MN), Genzyme (Cambridge, MA) and PharMingen (San Diego, CA) respectively. rIL-4 was kindly provided by Ono Pharmaceutical (Osaka, Japan). rIL-2 was kindly provided by Ajinomoto (Kanagawa, Japan). rIL-18 was prepared as described previously (4). The level of endotoxin in each recombinant sample was <50100 pg/µg cytokine as determined by the LAL method. Both anti-human IL-1RI mAb (4C1) and anti-IL-4 mAb (MP4-25D2) were obtained from PharMingen. Anti-IL-12 mAb (C8.6) and anti-CD3 mAb (OKT3) were obtained from Genzyme and Ortho Diagnostic Systems (Raritan, NJ) respectively. We also used mouse anti-human IL-18R mAb (#11710C), which was detailed in our previous reports (17,27). This antibody only recognizes the IL-18R
chain and specifically inhibits binding of [125I]IL-18 to human IL-18R-expressing cells. Phycoerythrin (PE)-conjugated mouse anti-human CD3 (UCHT1), CD4 (RPA-T4), CD8 (RPA-T8) and CD19 (HIB19) were purchased from PharMingen. FITCmouse anti-human CD3 (UCHT1), CD14 (322A-1), CD16 (3G8), CD45RA (HI100), CD45RO (UCHL1) and HLA-DR (Tu36) were also purchased from PharMingen.
T cell preparation.
Tonsils were obtained from 31 patients (19 males and 12 females) undergoing tonsillectomy. They were between 14 and 60 years old. Since they suffered from recurrent tonsillitis, tonsillectomy was performed for their treatment. Informed consent was obtained from them before the initiation of studies. To avoid the influence of infection on the status of T cells, we generally used tonsillar T cells from the patients at the time of no infection. Since two tonsils were taken from one patient at the same time, we chose the one with relatively normal size, shape and appearance. Mononuclear cells were obtained from minced tonsillar tissue by centrifugation on a Ficoll-Hypaque gradient (46). Monocytes were depleted by two rounds of plastic adherence. B cells were depleted by adherence to nylon wool. NK cells were depleted by treatment with 5 mM leucine methyl ester as described (47). Resultant cells were >98% CD3+ T cells as determined by FACS. Furthermore, CD4+CD45RA+ T cells were isolated by two rounds of immunomagnetic negative selection with a mixture of the following mAb: FITC-bound mouse anti-CD14, CD16, CD19, CD45RO, CD8 and HLA-DR. Cell suspensions were incubated with antiFITC MicroBeads (Miltenyi Biotec, Bergisch Gladbach, Germany) and exposed to the magnetic field of a MACS system (Miltenyi Biotec). This procedure routinely yields cells that are >98% CD4+CD45RA+, <0.2% CD19+ (B cells), <0.1% CD16+ (NK cells) and <0.1% CD14+ (monocytes) as determined by FACS analysis.
Cell cultures
RPMI 1640 supplemented with 10% FBS (Hyclone, Logan, UT), 2-mercaptoethanol (50 µM), L-glutamine (2 mM), penicillin (100 U/ml), streptomycin (100 µg/ml) and sodium pyruvate (1 mM) was used as culture medium. We conducted an experiment by using tonsillar T cells from one patient and repeated the same experiment at least 3 times. T cells (2x105/0.2 ml/well) were cultured alone or with IL-12 and/or IL-18 (12.5100 ng/ml) in triplicate wells of 96-well plates with or without immobilized anti-CD3 (100 ng/ml for coating) for 6 days. Supernatants were measured for their IFN-
and IL-4 contents by ELISA (BioSource International, Camarillo, CA). To determine IL-18 or IL-1ß responsiveness of IL-12-pretreated T cells, we first incubated T cells (2x106/ml) with 200 ng/ml of IL-12 in 24-well plates for 6 days. After extensive washing, we stimulated them (2x105/0.2 ml/well) with IL-18 (~500 ng/ml) or IL-1ß (~100 ng/ml) for 96 h. IFN-
contents in the supernatants were measured by ELISA. IL-12-pretreated T cells were also re-cultured at 5x104/0.2 ml/well with various doses of IL-18 (~500 ng/ml) or IL-1ß (~100 ng/ml) for 96 h and were then pulsed with 1 µCi of [3H]thymidine during the final 16 h. In some experiments, IL-12-pretreated T cells (105/0.2 ml/well) were cultured with IL-18 (500 ng/ml) or IL-1ß (10 ng/ml) in the presence or absence of anti-IL-18R mAb (~20 µg/ml) or anti-IL-1RI mAb (~20 µg/ml) for 3 days.
Induction of Th1 and Th2 cells
Th1 and Th2 cells were generated by stimulating CD4+CD45RA+ T cells (2x106/ml) with 1 µg/ml phytohemagglutinin (PHA), 40 ng/ml IL-12 and 500 ng/ml neutralizing anti-IL-4 mAb or with 1 µg/ml PHA, 200 ng/ml IL-4 and 10 µg/ml neutralizing anti-IL-12 mAb respectively (45). These stimulated T cells were washed on day 3 and expanded in the culture medium containing 100 U/ml of IL-2 for 7 days. Then they (2x105) were further stimulated in 96-well plates for 24 h with immobilized anti-CD3 mAb in the presence or absence of IL-18 (500 ng/ml) or IL-1ß (10 ng/ml). Culture supernatants were examined for their IFN-
contents by ELISA.
Flow cytometric analysis of expression of IL-18R
T cells (2x106/ml) were cultured by themselves or with IL-4 (200 ng/ml), IL-12 (200 ng/ml) or IL-12 (200 ng/ml) plus IL-18 (200 ng/ml) for 26 days. Cultured cells were first incubated with IgM anti-IL-18R mAb (2 µg/0.1 ml) on ice for 30 min. Then, they were washed extensively and followed by incubation with FITCgoat anti-mouse IgM (2 µg/0.1 ml) and PEanti-human CD3 (2 µg/0.1 ml) on ice for 30 min. The specificity of this binding is determined by the failure of binding of class-matched (mouse IgM) control antibody. Stained cells were analyzed using a dual laser FACSCalibur (Becton Dickinson, Mountain View, CA). Ten thousand cells were analyzed and data were processed with CellQuest (Becton Dickinson).
Intracellular IFN-
staining
For the analysis of intracellular IFN-
+ T cells, we followed the modified protocol of Vikingson et al. (48). Briefly, T cells (2x106/ml/well), cultured by themselves or with IL-12 (100 ng/ml), IL-18 (100 ng/ml) or IL-12 (100 ng/ml) plus IL-18 (100 ng/ml) in 24-well plates for 7 days, were pulsed with 3 µg/ml of monensin (Sigma, St Louis, MO) during the final 12 h to inhibit IFN-
secretion. Such treated T cells were first stained with PE-conjugated anti-human CD3 mAb (2 µg/0.1 ml), and followed by cell fixation with 4% (w/v) paraformaldehyde in PBS and cell membrane permeabilization with ice-cold PBS containing 1% FCS and 0.1% saponin. Resultant cells were further stained with FITCanti-IFN-
mAb (0.5 µg/0.1 ml) in the presence or absence of excess IFN-
(1 µg/0.1 ml). Cells were analyzed for their cytoplasmic IFN-
by two-color flow cytometry.
Analysis of expression of IL-18R
mRNA
Cytoplasmic RNA was prepared using the guanidinium method as described previously (49). As positive control for IL-18R
, RNA extracted from PBMC stimulated with phorbol myristate acetate (PMA) plus A23187 was used. We measured expression of IL-18R
, IL-18Rß, IL-1RI, IL-1R Acp and ß-actin by RT-PCR. mRNAs were amplified by a modified standard RT-PCR amplification procedure as described previously (49). Primers sequences were followings: IL-18R
: sense, GTTGAGTTGAATGACACAGG, antisense, TCCACTGCAACATGGTTAAG; AcpL: sense, ATGCTCTGTTTGGGCTGGATA, antisense, CATCTTGACACAACAGGCTAC; IL-1RI: sense, AGTGCTAGGCATCTGTGGTGT, antisense, ACAGGCATCAGTGAATCCCAA; IL-1R Acp: sense, GACACTGGCAACTATACCTG, antisense, GGAGAGCCTACTACCTTTAC; and ß-actin: sense, TGACGGGGTCACCCACACTGTGCCCATCTA, antisense, CTAGAAGCATTGCGGTGGACGATGGAGGG. cDNAs were amplified by 32 cycles, 94°C for 30 s, 58°C for 30 s and 72°C for 30 s (IL-18R
, IL-1RI, IL-1R Acp and IL-18Rß) or for 25 cycles, 94°C for 45 s, 60°C for 45 s and 72°C for 2 min (ß-actin), and then further extension at 72°C for 7 min. Since PCR reactions amplified by 32 or 24 cycles are in the log phase, we preferred these cycles. At the end of 32 or 25 cycles, samples were stored at 4°C until analyzed. After amplification, PCR products were separated by electrophoresis in 1.4% agarose gels and visualized by UV light illumination after ethidium bromide staining. In some experiments, densitometric analysis was performed with a Densitograph (Atto, Tokyo, Japan).
Statistics
All data are given as mean ± SD. Significance between the control group and a treated group was examined with the unpaired Student's test. P < 0.05 was regarded as significant.
| Results |
|---|
|
|
|---|
Synergistic action of IL-12 and IL-18 on IFN-
production and cell proliferationWe first examined whether IL-12 and IL-18 induce human T cells to produce IFN-
. A representative IL-12 and/or IL-18 stimulation experiment is illustrated in Fig. 1
, while its combination synergistically induced human T cells to produce IFN-
(Fig. 1
production (Fig. 1
|
To determine the optimal concentrations of IL-12 and IL-18 required for the stimulation of T cell IFN-
production, we stimulated T cells with various doses of IL-12 and/or IL-18 (~100 ng/ml) for 6 days. As illustrated in Fig. 2
production in response to IL-18 and/or IL-12. Again, additional anti-CD3 stimulation could not enhance T cell IFN-
production (Fig. 1
-producing cells without their TCR engagement.
|
We next examined the proportion of IFN-
-producing cells. As 100 ng/ml each of IL-12 and IL-18 strongly induced T cell IFN-
production (Fig. 2
secretion. Since we wished to know the real proportion of IFN-
-producing T cells during the last 12 h of 6 days culture, we did not stimulate T cells with PMA and A23187, which allow us to examine the potentiality of T cells to produce IFN-
. As a positive control for IFN-
-producing T cells, we used T cells stimulated with PMA plus A23187 for 4 h. As shown in Fig. 3, 1
+, whereas <0.4% of T cells treated with IL-12 or IL-18 alone were positive for cytoplasmic IFN-
. The specificity of intracellular IFN-
staining is indicated by the fact that it is completely blocked by the preincubation of the conjugated antibody with excess recombinant human IFN-
(data not shown). Thus, a small but significant fraction of T cells produced IFN-
in response to IL-12 and IL-18.
|
T cells stimulated with IL-12 are competent to respond to IL-18 by IFN-
productionWe next examined how many days are required for the maximal induction of IFN-
production by T cells. We stimulated T cells with IL-12 (100 ng/ml) and IL-18 (100 ng/ml) for 28 days and measured the levels of IFN-
at 2, 4, 6 and 8 days (data not shown), and found that stimulation of T cells with IL-12 and IL-18 for 6 days is appropriate for induction of IFN-
production.
To explore the relative role of IL-12 and IL-18 in synergistical induction of T cell IFN-
production, a time course experiment was conducted in which the order of addition of IL-12 and IL-18 was changed (Fig. 4A
). Since IL-18 also induces proliferation of IL-12-stimulated T cells (15), we simultaneously measured their proliferative response (Fig. 4B
). We treated T cells with IL-12 (200 ng/ml) for 6 days. Then, we collected, washed and subsequently stimulated them with IL-18 (~ 500 ng/ml) for 4 days. These IL-12-pretreated T cells showed dose-dependent IFN-
production (Fig. 4A
) and cell proliferation (Fig. 4B
) in response to IL-18. In contrast, IL-18 (200 ng/ml)-pretreated T cells did not proliferate and produce IFN-
as a result of subsequent stimulation with IL-12 (~ 500 ng/ml) for 4 days. These results clearly indicated that T cells pretreated with IL-12 for 6 days became responsive to IL-18 by T cell proliferation and IFN-
production.
|
Expression of IL-18R on IL-12-stimulated T cells
The requirement of pretreatment with IL-12 for rendering T cells responsive to IL-18 suggests that IL-12 stimulates T cells to express IL-18R. Thus, we investigated the changes in the proportion of T cells positive for IL-18R after stimulation with IL-12 or medium alone by measuring the binding of anti-IL-18R mAb to T cells (Fig. 5
|
Synergistic action of IL-12 and IL-1ß on IFN-
production by T cellsSince the IL-18IL-18R system has a striking similarity to the IL-1IL-1R system in terms of structure and signaling pathways (1,1836), we compared the action of IL-1ß (10 ng/ml) and IL-18 (100 ng/ml) on IL-12-stimulated T cells (Fig. 6
production. However, IL-1ß in collaboration with IL-12 (100 ng/ml) significantly induced it (Fig. 6A
production from T cells pretreated with 200 ng/ml of IL-12 for 6 days (Fig. 6B
production. Furthermore, like T cell proliferation induced by sequential stimulation with IL-12 and IL-18 (Fig. 4B
production, although the level of IFN-
production induced by IL-1ß was lower. T cells pretreated with IL-12 (200 ng/ml) produced IFN-
in response to IL-18 (500 ng/ml) or IL-1ß (10 ng/ml), and additions of anti-IL-18R mAb and anti-IL-1RI mAb specifically and dose-dependently inhibited IL-18- and IL-1ß-induced T cell IFN-
production respectively (Fig. 6C and D
|
IL-18 and IL-1ß are co-stimulatory factors for human Th 1 cells but not for Th 2 cells
We finally examined the reactivity of Th1 and Th2 cells to the stimulation with IL-18 or IL-1ß (Fig. 7
in response to immobilized anti-CD3. These T cells produced IFN-
modestly in response to anti-CD3 plus IL-18 (500 ng/ml) or anti-CD3 plus IL-1ß (10 ng/ml). In contrast, T cells cultured under Th1-inducing condition produced IFN-
in response to anti-CD3. They strongly increased IFN-
production when additionally stimulated with IL-18 or IL-1ß. T cells cultured under Th2-inducing conditions did not produce IFN-
in response to anti-CD3 alone or anti-CD3 and IL-18 or IL-1ß. Again, IL-18- or IL-1ß-augmented IFN-
production was specifically blocked by anti-IL-18R mAb or anti-IL-1RI mAb respectively (Fig. 7B
production from Th1 cells but not from Th2 cells.
|
To understand the mechanism underlying this difference in IL-18 and IL-1ß responsiveness between Th1 and Th2 cells, we tested whether IL-18R mRNA and IL-1R mRNA are preferentially expressed in Th1 cells by RT-PCR (Fig. 8
IL-18Rß. CD4+CD45RA+ T cells constitutively expressed IL-18Rß mRNA but not IL-18R
mRNA (Fig. 8A
IL-18Rß and IL-1RIIL-1R Acp (Fig. 8A and B
mRNA without affecting IL-18Rß mRNA (Fig. 8B
mRNA and IL-1RI mRNA (Fig. 8B
|
| Discussion |
|---|
|
|
|---|
In this study, we studied the mechanism how IL-12 and IL-18 synergize for IFN-
production from human T cells without their TCR engagement. We also investigated whether, like IL-18, IL-1ß synergizes with IL-12 in inducing IFN-
production from human T cells and plays an important role in the Th1 response. IL-18 by itself cannot stimulate human T cells to produce IFN-
. However, once human T cells are activated with IL-12, they expressed IL-18R
(Fig. 5
in response to IL-18 (Figs 4 and 6
production (Fig. 6B
or IL-1RI dose-dependently inhibited IL-18 or IL-1ß-induced IFN-
production from IL-12-pretreated T cells (Fig. 6C and D
. Furthermore, as we showed in our previous report using murine T cells (15), newly polarized human Th1 cells increased expression of IL-18R
(Fig. 8
in response to anti-CD3 and IL-18 (Fig. 7
, these Th1 cells weakly increased IL-1RI (Fig. 8
production (Fig. 7
production in response to anti-CD3 and IL-1ß (Fig. 7
As noted above, human T cells stimulated with IL-12 and IL-18 could strongly produce IFN-
. However, it has been reported that purified whole T cells or CD4+ T cells from PBMC can produce IFN-
in response to anti-CD3 plus IL-18 or to IL-18 alone respectively, although additional IL-12 stimulation augmented this IL-18-induced IFN-
production (5,37). Here we showed T cells prepared from human tonsils required both IL-12 and IL-18 to produce IFN-
. We rigorously removed NK cells that constitutively express IL-18R and produce IFN-
in response to IL-18 (12,14). Furthermore, the T cell-enriched fraction that we used in this report was not contaminated with monocytes that have potential to produce IL-12, because we depleted monocytes by two rounds of plastic adherence (see Methods). Thus the discrepancy seen between our results and those of others may be explained by assuming the possibility of the absence of endogenous IL-12, that synergizes with IL-18 for induction of IFN-
production.
The IL-18R complex is composed of IL-18R
and IL-18Rß. IL-18R
-deficient mice were recently generated (51). When T cells developed into Th1 cells after stimulation with anti-CD3 and IL-12, Th1 cells from wild-type mice displayed both high- and low-affinity IL-18R, whereas no such specific binding sites for IL-18 were found on Th1 cells from IL-18R
-deficient mice (51). These results clearly indicate that IL-18R
is a component of IL-18R that is essential for IL-18 binding on the surface of Th1 cells. IL-18Rß is a ligand non-binding chain and is required for signaling of IL-18 that binds with IL-18R
(28). However, it is still not certain whether high-affinity IL-18R is composed of IL-18R
and IL-18Rß. Recently, a soluble IL-18-binding protein (IL-18BP) was cloned (52). IL-18BP is constitutively expressed in the spleen and belongs to the Ig superfamily (52). IL-18BP directly binds to IL-18 and inhibits its action (52), suggesting that IL-18BP is similar to IL-1RII that inhibits the action of IL-1 as a decoy receptor (19,20).
We studied the regulation of expression of IL-18R
and IL-18Rß by IL-12 or IL-4 (Figs 5 and 8![]()
). Like increased IL-18R
mRNA expression in IL-12-stimulated murine T cells (15,16), expression of IL-18R
can be induced by IL-12 on human T cells (Fig. 5
). In contrast, stimulation with IL-4 down-regulates this expression. These results suggested that expression of IL-18R is reciprocally regulated by IL-12 and IL-4. IL-1R complex, composed of two chains, a ligand-binding subunit, IL-1RI, and a signal transducing subunit, the IL-1R Acp, has high-affinity binding capacity to IL-1. After the activation of the receptors, a common adapter molecule, MyD88, binds to IL-1RI of IL-1R and IL-18R
of IL-18R (31,32), which then activate IRAK, TRAF-6, NF
B, c-Jun N terminal kinase and AP-1 (8,3137). These similarities prompted us to compare the action of IL-1 and IL-18 on IL-12-stimulated T cells. IL-12-stimulated T cells exhibit dose-dependent proliferation and IFN-
production in response to IL-1ß (Fig. 6A and B
). Furthermore, this response is inhibitable by treatment with anti-IL-1RI mAb (Fig. 6D
). Thus, IL-12 and IL-1ß synergistically induce T cells to proliferate and produce IFN-
.
An important issue is to determine whether human T cells increase IL-18R when they develop into Th1 cells. Thus, we stimulated T cells with PHA, IL-12 and anti-IL-4 (Fig. 7
). These polarized Th1 cells increased IL-18R
mRNA (Fig. 8
) and produced IFN-
in response to IL-18 (Fig. 7
). Furthermore, they weakly increased IL-1RI mRNA and produced IFN-
in response to IL-1ß (Figs 7 and 8![]()
). In contrast, Th2 cells decreased expression of both IL-18R
mRNA and IL-1RI mRNA, and failed to produce IFN-
in response to IL-18 or IL-1ß (Figs 7 and 8![]()
). Thus, level of IL-18R
expression as well as IL-18 responsiveness may be used as useful phenotypic markers that distinguish Th1 cells from Th2 cells. We also suggested that IL-1 may play an important role in the activation of the Th1 response.
We examined the proportion of T cells positive for IL-18R after stimulation with Th1- or Th2-inducing conditions. T cells cultured with medium alone only contained 3% IL-18R+ cells. In spite of the striking difference in their responsiveness to the stimulation with anti-CD3 and IL-18 (Fig. 7A
), we could not observe any marked difference in the proportions of IL-18R+ T cells in Th1 cells and Th2 cells. Although there are several possibilities that may account for this discrepancy, we assumed that the major reason is that control T cells, obtained by sequential stimulation of naive T cells with PHA for 3 days and IL-2 for 7 days, had a high proportion (60%) of IL-18R+ T cells (17). We may need further study using Th1 or Th2 cells that are induced without PHA stimulation. Thus, here we only presented results of expression of mRNAs for IL-18R
and ß measured by RT-PCR (Fig. 8
). However, since PHA stimulation markedly induced IL-18R
mRNA expression, augmentation obtained by additional stimulation with IL-12 (Th1-inducing condition) was <2-fold (Fig. 8B
). Interestingly, although Th2 cells express IL-18R (Fig. 8A
), they cannot produce IFN-
in response to anti-CD3 and IL-18 (Fig. 7A
). Thus, expression of IL-18R is not restricted to Th1 cells. Moreover, this expression is not sufficient for causing T cells responsive to IL-18. However, Th1 cells contained higher levels of IL-18R
mRNA than control T cells (Fig. 8
), and most strongly produced IFN-
in response to anti-CD3 and IL-18 (Fig. 7
). Thus, we assumed that IL-12 stimulation is very critical for rendering T cells responsive to IL-18. Beside IL-18R up-regulation, IL-12 may synergize with IL-18 by activation of STAT4 or other transcription factors.
In this report, we showed IL-12-stimulated T cells or Th1 cells substantially produce IFN-
in response to IL-1ß (Figs 6 and 7![]()
). Although IL-1ß resembles IL-18, there are some definitive differences (Fig. 6
). First, low concentrations (~1 ng/ml) of IL-1ß can induce IFN-
production from IL-12-stimulated T cells (Fig. 6B
), whereas a relatively high concentration of IL-18 (~100 ng/ml) is a prerequisite stimulation condition (Fig. 4A
). Second, although the magnitude of IFN-
production induced by IL-1ß was low (Figs 6 and 7![]()
), IL-1ß can stimulate T cells to produce IFN-
independently from IL-18 (Fig. 6A
). Thus, IL-1ß may also be critically involved in IFN-
production in vivo and may compensate for the action of IL-18 in some circumstances.
| Abbreviations |
|---|
| AcPL IL-1R accessory protein like |
| IL-1RI IL-1R type 1 |
| IL-1R Acp IL-1R accessory protein |
| IL-18BP IL-18-binding protein |
| IL-1Rrp IL-1R-related protein |
| PBMC peripheral blood mononuclear cells |
| PE phycoerythrin |
| PHA phytohemagglutinin |
| PMA phorbol myristate acetate |
| Notes |
|---|
Transmitting editor: T. Watanabe
Received 4 August 1999, accepted 12 October 1999.
| References |
|---|
|
|
|---|
- Okamura, H., Tsutsui, H., Kashiwamura, S., Yoshimoto, T. and Nakanishi, K. 1998. Interleukin-18: a novel cytokine that augments both innate and acquired immunity. Adv. Immunol. 70:281.[Web of Science][Medline]
-
Okamura, H., Tsutsui, H., Komatsu, T., Yutsudo, M., Hakura, A., Tanimoto, T., Torigoe, K., Okura, T., Nukada, Y., Hattori, K., Akita, K., Namba, M., Tanabe, F., Konishi, K., Fukuda, S. and Kurimoto, M. 1995. Cloning of a new cytokine that induces IFN-
production by T cells. Nature 378:88.[Medline]
-
Gu, Y., Kuida, K., Tsutsui, H., Ku, G., Hsiao, K., Fleming, M. A., Hayashi, N., Higashino, K., Okamura, H., Nakanishi, K., Kurimoto, M., Tanimoto, T., Flavell, R. A., Sato, V., Harding, M. W., Livingston, D. J. and Su, M. S. 1997. Activation of interferon-
inducing factor mediated by interleukin- 1ß converting enzyme. Science 275:206.[Abstract/Free Full Text] -
Ushio, S., Namba, M., Okura, T., Hattori, K., Nukada, Y., Akita, K., Tanabe, F., Konishi, K., Micallef, M., Fujii, M., Torigoe, K., Tanimoto, T., Fukuda, S., Ikeda, M., Okamura, H. and Kurimoto, M. 1996. Cloning of the cDNA for human IFN-
-inducing factor, expression in Escherichia coli, and studies on the biologic activities of the protein. J. Immunol. 156:4274.[Abstract]
-
Micallef, M. J., Ohtsuki, T., Kohno, K., Tanabe, F., Ushio, S., Namba, M., Tanimoto, T., Torigoe, K., Fujii, M., Ikeda, M., Fukuda, S. and Kurimoto, M. 1996. Interferon-
-inducing factor enhances T helper 1 cytokine production by stimulated human T cells: synergism with interleukin-12 for interferon-
production. Eur. J. Immunol. 26:1647.[Web of Science][Medline]
-
Kohno, K., Kataoka, J., Ohtsuki, T., Suemoto, Y., Okamoto, I., Usui, M., Ikeda, M. and Kurimoto, M. 1997. IFN-
-inducing factor (IGIF) is a costimulatory factor on the activation of Th1 but not Th2 cells and exerts its effect independently of IL-12. J. Immunol. 158:1541.[Abstract]
-
Ahn, H. J., Maruo, S., Tomura, M., Mu, J., Hamaoka, T., Nakanishi, K., Clark, S., Kurimoto, M., Okamura, H. and Fujiwara, H. 1997. A mechanism underlying synergy between IL-12 and IFN-
-inducing factor in enhanced production of IFN-
. J. Immunol. 159:2125.[Abstract/Free Full Text] -
Robinson, D., Shibuya, K., Mui, A., Zonin, F., Murphy, E., Sana, T., Hartley, S. B., Menon, S., Kastelein, R., Bazan, F. and O'Garra, A. 1997. IGIF does not drive Th1 development but synergizes with IL-12 for interferon-
production and activates IRAK and NF
B. Immunity 7:571.[Web of Science][Medline]
-
Yoshimoto, T., Okamura, H., Tagawa, Y. I., Iwakura, Y. and Nakanishi, K. 1997. Interleukin 18 together with interleukin 12 inhibits IgE production by induction of interferon-gamma production from activated B cells. Proc. Natl Acad. Sci. USA 94:3948.
[Abstract/Free Full Text] -
Tsutsui, H., Nakanishi, K., Matsui, K., Higashino, K., Okamura, H., Miyazawa, Y. and Kaneda, K. 1996. IFN-
-inducing factor up-regulates Fas ligand-mediated cytotoxic activity of murine natural killer cell clones. J. Immunol. 157:3967.[Abstract]
-
Dao, T., Ohashi, K., Kayano, T., Kurimoto, M. and Okamura, H. 1996. Interferon-
-inducing factor, a novel cytokine, enhances Fas ligand-mediated cytotoxicity of murine T helper 1 cells. Cell. Immunol. 173:230.[Web of Science][Medline]
-
Tsutsui, H., Matsui, K., Kawada, N., Hyodo, Y., Hayashi, N., Okamura, H., Higashino, K. and Nakanishi, K. 1997. IL-18 accounts for both TNF-
- and Fas ligand-mediated hepatotoxic pathways in endotoxin-induced liver injury in mice. J. Immunol. 159:3961.[Abstract]
- Takeda, K., Tsutsui, H., Yoshimoto, T., Adachi, O., Yoshida, N., Kishimoto, T., Okamura, H., Nakanishi, K. and Akira, S. 1998. Defective NK cell activity and Th1 response in IL-18-deficient mice. Immunity 8:383.[Web of Science][Medline]
-
Hyodo, Y., Matsui, K., Hayashi, N., Tsutsui, H., Kashiwamura, S.-I., Yamauchi, H., Hiroishi, K., Takeda, K., Tagawa, Y., Iwakura, Y., Kayagaki, N., Kurimoto, M., Okamura, H., Hada, T., Yagita, H., Akira, S., Nakanishi, K. and Higashino, K. 1999. IL-18 up-regulates perforin-mediated NK activity without increasing perforin messenger RNA expression by binding to constitutively expressed IL-18 receptor. J. Immunol. 162:1662.
[Abstract/Free Full Text] -
Yoshimoto, T., Takeda, K., Tanaka, T., Ohkusu, K., Kashiwamura, S., Okamura, H., Akira, S. and Nakanishi, K. 1998. IL-12 up-regulates IL-18 receptor expression on T cells, Th1 cells, and B cells: synergism with IL-18 for IFN-
production. J. Immunol. 161:3400.[Abstract/Free Full Text] -
Xu, D., Chan, W. L., Leung, B. P., Hunter, D., Schulz, K., Carter, R. W., McInnes, I. B., Robinson, J. H. and Liew, F. Y. 1998. Selective expression and functions of interleukin 18 receptor on T helper (Th) type 1 but not Th2 cells. J. Exp. Med. 188:1485.
[Abstract/Free Full Text] - Kunikata, T., Torigoe, K., Ushio, S., Okura, T., Ushio, C., Yamauchi, H., Ikeda, M., Ikegami, H. and Kurimoto, M. 1998. Constitutive and induced IL-18 receptor expression by various peripheral blood cell subsets as determined by anti-hIL-18R monoclonal antibody. Cell. Immunol. 189:135.[Web of Science][Medline]
- Durum, S. K., Schmidt, J. A. and Oppenheim, J. J. 1985. Interleukin 1: an immunological perspective. Adv. Immunol. 3:261.
-
Dinarello, C. A. 1996. Biologic basis for interleukin-1 in disease. Blood 87:2095.
[Abstract/Free Full Text] - Dinarello, C. A. 1999. IL-18: a TH1-inducing, proinflammatory cytokine and new member of the IL-1 family. J. Allergy Clin. Immunol. 11:103.
-
Auron, P. E., Webb, A. C., Rosenwasser, L. J., Mucci, S. F., Rich, A., Wolff, S. M. and Dinarello, C. A. 1984. Nucleotide sequence of human monocyte interleukin 1 precursor cDNA. Proc. Natl Acad. Sci. USA 81:7907.
[Abstract/Free Full Text] - Matsushima, K., Taguchi, M., Kovacs, E. J., Young, H. A. and Oppenheim, J. J. 1986. Intracellular localization of human monocyte associated interleukin 1 (IL-1) activity and release of biologically active IL-1 from monocytes by trypsin and plasmin. J. Immunol. 136:2883.[Abstract]
- Wilson, K. P., Black, J. A., Thomson, J. A., Kim, E. E., Griffith, J. P., Navia, M. A., Murcko, M. A., Chambers, S. P., Aldape, R. A., Raybuck, S. A. and Livingston, D. J. 1994. Structure and mechanism of interleukin-1ß converting enzyme. Nature 370:270.[Medline]
- Bazan, J. F., Timans, J. C. and Kastelein, R. A. 1996. A newly defined interleukin-1? Nature 379:591.[Medline]
-
Ghayur, T., Banerjee, S., Hugunin, M., Butler, D., Herzog, L., Carter, A., Quintal, L., Sekut, L., Talanian, R., Paskind, M., Wong, W., Kamen, R., Tracey, D. and Allen, H. 1997. Caspase-1 processes IFN-
-inducing factor and regulates LPS-induced IFN-
production. Nature 386:619.[Medline]
-
Parnet, P., Garka, K. E., Bonnert, T. P., Dower, S. K. and Sims, J. E. 1996. IL-1Rrp is a novel receptor-like molecule similar to the type I interleukin-1 receptor and its homologues T1/ST2 and IL-1R AcP. J. Biol. Chem. 271:3967.
[Abstract/Free Full Text] -
Torigoe, K., Ushio, S., Okura, T., Kobayashi, S., Taniai, M., Kunikata, T., Murakami, T., Sanou, O., Kojima, H., Fujii, M., Ohta, T., Ikeda, M., Ikegami, H. and Kurimoto, M. 1997. Purification and characterization of the human interleukin-18 receptor. J. Biol. Chem. 272:25737.
[Abstract/Free Full Text] -
Born, T. L., Thomassen, E., Bird, T. A. and Sims, J. E. 1998. Cloning of a novel receptor subunit, AcPL, required for interleukin-18 signaling. J. Biol. Chem. 273:29445.
[Abstract/Free Full Text] -
Sims, J. E., March, C. J., Cosman, D., Widmer, M. B., MacDonald, H. R., McMahan, C. J., Grubin, C. E., Wignal, J. M., Jackson, J. L. and Call, S. M. 1988. cDNA expression cloning of the IL-1 receptor, a member of the immunoglobulin superfamily. Science 241:585.
[Abstract/Free Full Text] -
Greenfeder, S. A., Nunes, P., Kwee, L., Labow, M., Chizzonite, R. A. and Ju, G. 1995. Molecular cloning and characterization of a second subunit of the interleukin 1 receptor complex. J. Biol. Chem. 270:13757.
[Abstract/Free Full Text] -
Muzio, M., Ni, J., Feng, P. and Dixit, V. M. 1997. IRAK (Pelle) family member IRAK-2 and MyD88 as proximal mediators of IL- 1 signaling. Science 278:1612.
[Abstract/Free Full Text] - Adachi, O., Kawai, T., Takeda, K., Matsumoto, M., Tsutsui, H., Sakagami, M., Nakanishi, K. and Akira, S. 1998. Targeted disruption of the MyD88 gene results in loss of IL-1- and IL- 18-mediated function. Immunity 9:143.[Web of Science][Medline]
- Cao, Z., Henzel, W. J. and Gao, X. 1996. IRAK: a kinase associated with the interleukin-1 receptor. Science 271:1128.[Abstract]
- Cao, Z., Xiong, J., Takeuchi, M., Kurama, T. and Goeddel, D. V. 1996. TRAF6 is a signal transducer for interleukin-1. Nature 383:443.[Medline]
- Kojima, H., Takeuchi, M., Ohta, T., Nishida, Y., Arai, N., Ikeda, M., Ikegami, H. and Kurimoto, M. 1998. Interleukin-18 activates the IRAK-TRAF6 pathway in mouse EL-4 cells. Biochem. Biophys. Res. Commun. 244:183.[Web of Science][Medline]
-
Matsumoto, S., Tsuji, T. K., Aizawa, Y., Koide, K., Takeuchi, M., Ohta, T. and Kurimoto, M. 1997. Interleukin-18 activates NF-
B in murine T helper type 1 cells. Biochem. Biophys. Res. Commun. 234:454.[Web of Science][Medline]
-
Barbulescu, K., Becker, C., Schlaak, J. F., Schmitt, E., Meyer zum Büschenfelde, K. H. and Neurath, M. F. 1998. Cutting edge: IL-12 and IL-18 differentially regulate the transcriptional activity of the human IFN-
promoter in primary CD4+ T lymphocytes. J. Immunol. 160:3642.[Abstract/Free Full Text] -
Sica, A., Dorman, L., Viggiano, V., Cippitelli, M., Ghosh, P., Rice, N. and Young, H. A. 1997. Interaction of NF-
B and NFAT with the interferon-gamma promoter. J. Biol. Chem. 272:30412.[Abstract/Free Full Text] -
Hunter, C. A., Chizzonite, R. and Remington, J. S. 1995. IL-1ß is required for IL-12 to induce production of IFN-
by NK cells. A role for IL-1ß in the T cell-independent mechanism of resistance against intracellular pathogens. J. Immunol. 155:4347.[Abstract]
-
Hunter, C. A., Timans, J., Pisacane, P., Menon, S., Cai, G., Walker, W., Aste, A. M., Chizzonite, R., Bazan, J. F. and Kastelein, R. A. 1997. Comparison of the effects of interleukin-1
, interleukin-1ß and interferon-
-inducing factor on the production of interferon- gamma by natural killer. Eur. J. Immunol. 27:2787.[Web of Science][Medline]
-
Skeen, M. J. and Ziegler, H. K. 1995. Activation of gamma delta T cells for production of IFN-
is mediated by bacteria via macrophage-derived cytokines IL-1 and IL-12. J. Immunol. 154:5832.[Abstract]
- O'Garra, A. and Murphy, K. 1994. Role of cytokines in determining T-lymphocyte function. Curr. Opin. Immunol. 6:458.[Web of Science][Medline]
-
D'Andrea, A., Aste-Amezaga, M., Valiante, N. M., Ma, X., Kubin, M. and Trinchieri, G. 1993. Interleukin 10 (IL-10) inhibits human lymphocyte interferon
-production by suppressing natural killer cell stimulatory factor/IL-12 synthesis in accessory cells. J. Exp. Med. 178:1041.[Abstract/Free Full Text] -
Sornasse, T., Larenas, P. V., Davis, K. A., de Vries, J. E. and Yssel, H. 1996. Differentiation and stability of T helper 1 and 2 cells derived from naive human neonatal CD4+ T cells, analyzed at the single-cell level. J. Exp. Med. 184:473.
[Abstract/Free Full Text] -
Rogge, L., Barberis, M. L., Biffi, M., Passini, N., Presky, D. H., Gubler, U. and Sinigaglia, F. 1997. Selective expression of an interleukin-12 receptor component by human T helper 1 cells. J. Exp. Med. 185:825.
[Abstract/Free Full Text] - King, P. D. and Katz, D. R. 1989. Human tonsillar dendritic cell-induced T cell responses: analysis of molecular mechanisms using monoclonal antibodies. Eur. J. Immunol. 19:581.[Web of Science][Medline]
- Shau, H. and Golub, S. H. 1985. Depletion of NK cells with the lysosomotropic agent L-leucine methyl ester and the in vitro generation of NK activity from NK precursor cells. J. Immunol. 134:1136.[Abstract]
-
Vikingsson, A., Pederson, K. and Muller, D. 1994. Enumeration of IFN-
producing lymphocytes by flow cytometry and correlation with quantitative measurement of IFN-
. J. Immunol. Methods 173:219.[Web of Science][Medline]
-
Yoshimoto, T. and Paul, W. E. 1994. CD4pos, NK1.1pos T cells promptly produce interleukin 4 in response to in vivo challenge with anti-CD3. J. Exp. Med. 179:1285.
[Abstract/Free Full Text] -
Bonecchi, R., Bianchi, G., Bordignon, P. P., D'Ambrosio, D., Lang, R., Borsatti, A., Sozzani, S., Allavena, P., Gray, P. A., Mantovani, A. and Sinigaglia, F. 1998. Differential expression of chemokine receptors and chemotactic responsiveness of type 1 T helper cells (Th1s) and Th2s. J. Exp. Med. 187:129.
[Abstract/Free Full Text] -
Hoshino, K., Tsutsui, H., Kawai, T., Takeda, K., Nakanishi, K., Takeda, Y. and Akira, S. 1999. Cutting edge: generation of IL-18 receptor-deficient mice: evidence for IL-1 receptor-related protein as an essential IL-18 binding receptor. J. Immunol. 162:5041.
[Abstract/Free Full Text] - Novick, D., Kim, S. H., Fantuzzi, G., Reznikov, L. L., Dinarello, C. A. and Rubinstein, M. 1999. Interleukin-18 binding protein: a novel modulator of the Th1 cytokine response. Immunity. 10:127.[Web of Science][Medline]
This article has been cited by other articles:
![]() |
L. H. Ho, T. Ohno, K. Oboki, N. Kajiwara, H. Suto, M. Iikura, Y. Okayama, S. Akira, H. Saito, S. J. Galli, et al. IL-33 induces IL-13 production by mouse mast cells independently of IgE-Fc{epsilon}RI signals J. Leukoc. Biol., December 1, 2007; 82(6): 1481 - 1490. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Rao, K. J. Tracey, and J. S. Pober IL-1{alpha} and IL-1beta Are Endogenous Mediators Linking Cell Injury to the Adaptive Alloimmune Response J. Immunol., November 15, 2007; 179(10): 6536 - 6546. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Orozco, E. Gemmell, M. Bickel, and G.J. Seymour Interleukin 18 and Periodontal Disease Journal of Dental Research, July 1, 2007; 86(7): 586 - 593. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. R. de Arquer, R. Pena, C. Cabrera, G. Coma, R. Ruiz-Hernandez, R. Guerola, B. Clotet, L. Ruiz, J. A. Este, M. L. Calle, et al. Skewed expression and up-regulation of the IL-12 and IL-18 receptors in resting and activated CD4 T cells from HIV-1-infected patients J. Leukoc. Biol., July 1, 2007; 82(1): 72 - 78. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Chen, G. Sen, and C. M. Snapper Endogenous IL-1R1 Signaling Is Critical for Cognate CD4+ T Cell Help for Induction of In Vivo Type 1 and Type 2 Antipolysaccharide and Antiprotein Ig Isotype Responses to Intact Streptococcus pneumoniae, but Not to a Soluble Pneumococcal Conjugate Vaccine J. Immunol., November 1, 2006; 177(9): 6044 - 6051. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Li, W. Wojciechowski, C. Dell'Agnola, N. E. Lopez, and I. Espinoza-Delgado IFN-{gamma} and T-bet Expression in Human Dendritic Cells from Normal Donors and Cancer Patients Is Controlled through Mechanisms Involving ERK-1/2-Dependent and IL-12-Independent Pathways J. Immunol., September 15, 2006; 177(6): 3554 - 3563. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. N. MacGregor, Q. Li, A. E. Chang, T. M. Braun, D. P.M. Hughes, and K. T. McDonagh Ex vivo Culture with Interleukin (IL)-12 Improves CD8+ T-Cell Adoptive Immunotherapy for Murine Leukemia Independent of IL-18 or IFN-{gamma} but Requires Perforin. Cancer Res., May 1, 2006; 66(9): 4913 - 4921. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Rodriguez-Galan, J. H. Bream, A. Farr, and H. A. Young Synergistic Effect of IL-2, IL-12, and IL-18 on Thymocyte Apoptosis and Th1/Th2 Cytokine Expression J. Immunol., March 1, 2005; 174(5): 2796 - 2804. [Abstract] [Full Text] [PDF] |
||||
![]() |
J G Krueger and A Bowcock Psoriasis pathophysiology: current concepts of pathogenesis Ann Rheum Dis, March 1, 2005; 64(suppl_2): ii30 - ii36. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Salcedo, J. K. Stauffer, E. Lincoln, T. C. Back, J. A. Hixon, C. Hahn, K. Shafer-Weaver, A. Malyguine, R. Kastelein, and J. M. Wigginton IL-27 Mediates Complete Regression of Orthotopic Primary and Metastatic Murine Neuroblastoma Tumors: Role for CD8+ T Cells J. Immunol., December 15, 2004; 173(12): 7170 - 7182. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-P. Raue, J. D. Brien, E. Hammarlund, and M. K. Slifka Activation of Virus-Specific CD8+ T Cells by Lipopolysaccharide-Induced IL-12 and IL-18 J. Immunol., December 1, 2004; 173(11): 6873 - 6881. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hata, T. Yoshimoto, N. Hayashi, T. Hada, and K. Nakanishi IL-18 together with anti-CD3 antibody induces human Th1 cells to produce Th1- and Th2-cytokines and IL-8 Int. Immunol., December 1, 2004; 16(12): 1733 - 1739. [Abstract] [Full Text] [PDF] |
||||
![]() |
S-M Dai, K Nishioka, and K Yudoh Interleukin (IL) 18 stimulates osteoclast formation through synovial T cells in rheumatoid arthritis: comparison with IL1{beta} and tumour necrosis factor {alpha} Ann Rheum Dis, November 1, 2004; 63(11): 1379 - 1386. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Montero, J. Matilla, E. Gomez-Mampaso, and M. A. Lasuncion Geranylgeraniol Regulates Negatively Caspase-1 Autoprocessing: Implication in the Th1 Response against Mycobacterium tuberculosis J. Immunol., October 15, 2004; 173(8): 4936 - 4944. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Kolgen, M. van Meurs, M. Jongsma, H. van Weelden, C. A. F. M. Bruijnzeel-Koomen, E. F. Knol, W. A. van Vloten, J. Laman, and F. R. de Gruijl Differential Expression of Cytokines in UV-B-Exposed Skin of Patients With Polymorphous Light Eruption: Correlation With Langerhans Cell Migration and Immunosuppression Arch Dermatol, March 1, 2004; 140(3): 295 - 302. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sugimoto, Y. Ishikawa, T. Yoshimoto, N. Hayashi, J. Fujimoto, and K. Nakanishi Interleukin 18 Acts on Memory T Helper Cells Type 1 to Induce Airway Inflammation and Hyperresponsiveness in a Naive Host Mouse J. Exp. Med., February 17, 2004; 199(4): 535 - 545. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Gutzmer, K. Langer, S. Mommert, M. Wittmann, A. Kapp, and T. Werfel Human Dendritic Cells Express the IL-18R and Are Chemoattracted to IL-18 J. Immunol., December 15, 2003; 171(12): 6363 - 6371. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. von Stebut, J. M. Ehrchen, Y. Belkaid, S. L. Kostka, K. Molle, J. Knop, C. Sunderkotter, and M. C. Udey Interleukin 1{alpha} Promotes Th1 Differentiation and Inhibits Disease Progression in Leishmania major-susceptible BALB/c Mice J. Exp. Med., July 21, 2003; 198(2): 191 - 199. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Schroder, C. Meisel, K. Buhl, N. Profanter, N. Sievert, H.-D. Volk, and G. Grutz Different Modes of IL-10 and TGF-{beta} to Inhibit Cytokine-Dependent IFN-{gamma} Production: Consequences for Reversal of Lipopolysaccharide Desensitization J. Immunol., May 15, 2003; 170(10): 5260 - 5267. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Coutant, L. Perrin-Cocon, S. Agaugue, T. Delair, P. Andre, and V. Lotteau Mature Dendritic Cell Generation Promoted by Lysophosphatidylcholine J. Immunol., August 15, 2002; 169(4): 1688 - 1695. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ariel, D. Novick, M. Rubinstein, C. A. Dinarello, O. Lider, and R. Hershkoviz IL-12 and IL-18 induce MAP kinase-dependent adhesion of T cells to extracellular matrix components J. Leukoc. Biol., July 1, 2002; 72(1): 192 - 198. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. B. Smeltz, J. Chen, R. Ehrhardt, and E. M. Shevach Role of IFN-{gamma} in Th1 Differentiation: IFN-{gamma} Regulates IL-18R{alpha} Expression by Preventing the Negative Effects of IL-4 and by Inducing/Maintaining IL-12 Receptor {beta}2 Expression J. Immunol., June 15, 2002; 168(12): 6165 - 6172. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. K. Varma, T. E. Toliver-Kinsky, C. Y. Lin, A. P. Koutrouvelis, J. E. Nichols, and E. R. Sherwood Cellular Mechanisms That Cause Suppressed Gamma Interferon Secretion in Endotoxin-Tolerant Mice Infect. Immun., September 1, 2001; 69(9): 5249 - 5263. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Borges, A. Campos-Neto, P. Sleath, K. H. Grabstein, P. J. Morrissey, Y. A. W. Skeiky, and S. G. Reed Potent Stimulation of the Innate Immune System by a Leishmania brasiliensis Recombinant Protein Infect. Immun., September 1, 2001; 69(9): 5270 - 5277. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. B. Smeltz, J. Chen, J. Hu-Li, and E. M. Shevach Regulation of Interleukin (IL)-18 Receptor {alpha} Chain Expression on CD4+ T Cells during T Helper (Th)1/Th2 Differentiation: Critical Downregulatory Role of IL-4 J. Exp. Med., July 16, 2001; 194(2): 143 - 154. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Harandi, B. Svennerholm, J. Holmgren, and K. Eriksson Interleukin-12 (IL-12) and IL-18 Are Important in Innate Defense against Genital Herpes Simplex Virus Type 2 Infection in Mice but Are Not Required for the Development of Acquired Gamma Interferon-Mediated Protective Immunity J. Virol., July 15, 2001; 75(14): 6705 - 6709. [Abstract] [Full Text] |
||||
![]() |
N. J. Horwood, J. Elliott, T. J. Martin, and M. T. Gillespie IL-12 Alone and in Synergy with IL-18 Inhibits Osteoclast Formation In Vitro J. Immunol., April 15, 2001; 166(8): 4915 - 4921. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Goodbourn, L. Didcock, and R. E. Randall Interferons: cell signalling, immune modulation, antiviral response and virus countermeasures J. Gen. Virol., October 1, 2000; 81(10): 2341 - 2364. [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




) or IL-18 (200 ng/ml) (
) for 6 days. Then, cultured cells were collected, washed and re-cultured at 2x105/0.2 ml/well (A) or 5x104/0.2 ml/well (B) with various concentrations of IL-18 or IL-12 (0500 ng/ml) for 4 days. Results presented are the means ± SD of triplicate cultures. Data presented are representative of three independent experiments with similar results.

) or anti-IL-1RI mAb () for 4 days. After incubation, culture supernatants were assayed for IFN-











