International Immunology, Vol. 12, No. 12, 1723-1731,
December 2000
© 2000 Japanese Society for Immunology
Antigen contacts by Ni-reactive TCR: typical
ß chain cooperation versus
chain-dominated specificity
1 Max-Planck-Institut für Immunbiologie, Stübeweg 51, 79108 Freiburg, Germany
2 Fakultät für Biologie, Universität Freiburg, Schänzlstr. 1, D-79104 Freiburg, Germany
Correspondence to: H. U. Weltzien
| Abstract |
|---|
|
|
|---|
VB17+ TCR dominate in Ni-driven T cell cultures from highly Ni-sensitized patients. Using transfection of TCR from three CD4+, VB17+, Ni-specific human T cell clones, we studied their NiMHC contacts by site-directed TCR mutation and combination of
and ß chains between different TCR. All three TCR exhibited N-nucleotide-determined ArgAsp motifs in their CDR3-ß sequences. Two of them were specifically restricted to HLA-DR13, while the third one accepted a variety of HLA-DR alleles. The highly similar
or ß chains of the DR13-restricted TCR were interchangable without loss of specificity, but
or ß chains of other TCR were not tolerated. Mutations of their ArgAsp motif revealed loss of reactivity upon exchanging Asp for Glu or Ala and of Arg for Ala but not of Arg for Lys or the Ni binding His. Reactivity was also destroyed by mutation of
chain position 51, proposed as a general contact site for MHC. Hence, in these two TCR the ArgAsp motif is clearly involved in contacting NiMHC complexes, and close cooperation between
and ß chain is required. In contrast, the third TCR retained Ni reactivity upon mutation of
chain position 51 or of its ß chain ArgAsp motif, which rather affected the pattern of DR cross-restriction. Moreover, its
chain paired with various ß chains from other, even mouse TCR, irrespective of their specificity, retaining Ni reactivity as well as promiscuous HLA-DR restriction. This preponderance of an
chain in defining specificity indicates fundamental differences in Ni interactions of individual TCR and implies that ß chain similarities may not necessarily result from antigen selection.
Keywords: allergy, antigen binding, human, metal, TCR
| Introduction |
|---|
|
|
|---|
Nickel as an inducer of human contact dermatitis (1) is often compared to model hapten allergens such as trinitrochlorobenzene (2,3). Also for Ni allergy, CD4+ and CD8+
ß T cells have been identified as crucial players in the induction and elicitation of hyper-reactivity (47). However, since Ni2+ ions form reversible coordination complexes with proteins (8,9) rather than covalent bonds, it is not clear whether allergenic Ni determinants detected by T cells on Ni-treated antigen-presenting cells (APC) compare at all to the MHC-associated, hapten-conjugated peptides identified as allergenic epitopes, e.g. p-azobenzarsonate (ABA), trinitrophenyl (TNP), urushiol or penicillin (1014). A superantigen-like T cell activation by Ni has been dismissed for some clones (15), but the exact mode of TCR activation by Ni remains to be elucidated (3,16,17). An interesting model to study TCRNi interactions derives from our previous observation that for some but not all Ni-allergic individuals, in vitro stimulation of peripheral blood lymphocytes with NiSO4 resulted in preferential expansion of T cells carrying VB17+ TCR (18). This skewing of the TCR repertoire was restricted to the CD4+ subset as well as to those patients exhibiting particularly strong sensitization (3+ in the standard prick test), indicating a correlation of TCRBV17 selection and the severity of the disease.
Among VB17+ T cell clones from one patient (IF) >50% of the ß chains contained the amino acid Arg in position 95 of their CDR3B loops, often accompanied by an Asp in the following position (18). Both of these residues were shown by Ala substitutions and transfection to be essential for antigen recognition in Ni-specific T cell responses (15). However, it was not clear whether they were involved in contacts to MHC structures or to MHC-associated peptides or directly engaged in the complexation of Ni2+ ions.
The present study compares TCRBV17+, Ni-reactive T cell clones from two different donors. It focuses on the role of the VB17 element and more precisely on the ArgAsp motif in the CDR3B sequence. In addition, the impact of TCR
and ß chains in general on Ni and HLA specificity is studied by comparing allele-specific versus promiscuous HLA-DR restriction in two individual clones.
| Methods |
|---|
|
|
|---|
Antigens, reagents and media
If not specified otherwise, reagents were used at the following concentrations: NiSO4.6H2O, 0.1 mM; phytohemagglutinin (PHA-P), 1 µg/ml (Murex, Dartford, UK); staphylococcal enterotoxin B (SEB), 20 ng/ml (Serva, Heidelberg, Germany); rat spleen concanavalin A supernatant (10%) served as source of IL-2 to maintain CTLL cells. Growth medium for T cell hybridomas (RPMI/FCS) was RPMI 1640 supplemented with 2 mM L-glutamine, 100 µg/ml kanamycin (all from Gibco/BRL, Eggenstein, Germany), 5x105 M 2-mercaptoethanol (Roth, Karlsruhe, Germany) and 10% heat-inactivated FCS. Culture conditions for human T cell clones were described previously (19).
Cell lines and T cell clones
The Ni-specific T cell clones ANi2.3, 4.13 and ANi1.3 from donor IF (HLA-DRB1*0401, DRB1*1302, DR52, DR53) have been described before (18). Clone SE9 was obtained from donor SE (HLA-DRB1*0101 and DRB1*1501) according to published procedures (19). The murine T cell hybridoma 54
17 (20) was a kind gift of O. Acuto (Institut Pasteur, Paris, France). For APC we used either autologuous EpsteinBarr virus-transformed B cells of donors IF and SE or HLA-DR homozygous B cell lines, originating from the International Histocompatibility Workshop (IHW), WT47 (IHW no. 9063, DRB1*1302, DRB3*0301), JESTHOM (IHW no. 9004, DRB1*0101), HOM-2 (IHW no. 9005, DRB1*0101), BSM (IHW no. 9032, DRB1*0401, DR53), EK (IHW no. 9054, DRB1*1401, DR52) and LWAGS (IHW No. 9079, DRB1*0102). Mouse fibroblasts transfected with human HLA-DRB1*0101, DRB1*0401 or DRB1*1302, designated as L-DR1 (L544.H8), L-DR4 (L243.6) and L-DR13 (L650.2), were obtained from F. Sinigaglia (Roche Ricerce, Milano, Italy).
IL-2 secretion and proliferation assays
TCR transfectants (5x104 cells) were co-cultured in duplicate or in triplicate in 200 µl RPMI/FCS with 5x104 X-irradiated (6000 rad) B cells or DR-transfected L-cells in the presence or absence of antigen. After 20 h at 37°C, 100 µl of the supernatant was used for a CTLL assay as described (21). IL-2-dependent proliferation of CTLL cells was measured by [3H]thymidine incorporation (2 µCi/well, 2 Ci/mmol; Amersham, Braunschweig, Germany) in an automatic ß-counter (Inotech, Asbach, Germany). Stimulation with immobilized CD3
mAb (145-2C11) (PharMingen, San Diego, CA) or Vß17 mAb (E17.5F3.15.13; Immunotech, Marseille, France) was described previously (15). To assess class specificity of HLA restriction, T cells were cultured with B cells, 104 M NiSO4 and either anti-DR (L243; ATCC, Rockville, MD), anti-DP (B7.21; ATCC) or anti-DQ (SVPL3; ATCC) mAb (1:10 diluted culture supernatant). IL-2 secretion was determined as above.
Antibodies and flow cytometry
Hamster anti-mouse CD3
mAb (145-2C11) (22) was used with FITC-conjugated rabbit anti-hamster Ig (Dianova, Hamburg, Germany). Mouse anti-human mAb used included: FITC-conjugated and non-conjugated Vß17 (E17.5F3.15.13) and FITC-conjugated CD4 (13B8.2) (all from Immunotech). FITC-conjugated mouse IgG1 (MOPC-21) (Sigma, St Louis, MO) was used as isotype control. For flow cytometric analysis, 2x105 cells were stained at 4°C either directly with FITC-labeled or with unlabeled mAb, followed by staining with the secondary mAb. Fluorescence was determined in a FACScan instrument (Becton Dickinson, San Jose, CA).
Construction of TCR expression vectors
RNA extraction, transcription into cDNA and analysis of TCR A and B genes was done as described (18). Nomenclature for TCR gene segments is according to Arden et al. (23) and CDR3 regions are defined according to Moss and Bell (24). Rearranged TCR
and ß chain genes were used for construction of mousehuman hybrid TCR expression vectors (consisting of mouse constant and human rearranged variable regions) as described (25). Briefly, full-length TCR variable regions of the
and ß chains of SE9 were amplified with the primers listed in Table 1
. Standard PCR procedures included 5 cycles of 30 s at 95°C, 40 s at 60°C and 40 s at 72°C followed by 30 cycles of 30 s at 94°C, 40 s at 57°C and 40 s at 72°C. The final PCR products were cloned into the pCR-Script vector (Stratagene, Heidelberg, Germany) and sequenced using the Big Dye sequencing kit (Applied Biosystems, Foster City, CA). Sequences were read on a 310 Genetic Analyzer (Applied Biosystems). Primers used for sequencing were humanLVß17 (ATGAGCAACCAGGTGCTCTGC), humanVß17 (TTTCAGAAAGGAGATATAGCT), humanV
1 (TTGCCCTGAGAGATGCCAGAG), humanV
22 (CCTCCTGAAAGCCACGAAGGCTGA), and Universal and Reverse primers (Pharmacia, Freiburg, Germany). The human TCR V(D)J regions were then cloned adjacent to germline mouse constant regions into the TCR expression vectors pV2-15ß (mycophenolic acid resistance) or pV2-15
(G418 resistance) (26). Construction of TCR expression vectors for clones ANi2.3, 4.13 and ANi1.3 was described previously (15). TCR
and ß vectors were linearized with ClaI or EcoRI respectively before transfection.
|
Mutations of amino acids in the TCR
and ß chainsThe TCRBV17 chain genes of clones 4.13 or SE9 and the
chains of clones ANi2.3 or SE9 (cloned into the pCR-Script vector) were used as templates for site-directed mutagenesis. Point mutations were introduced using the QuickChange site-directed mutagenesis kit (Stratagene, Heidelberg, Germany). Primers used are listed in Table 1
Transfection of TCR expression vectors into mouse hybridoma cells
The murine TCR, hCD4+ hybridoma 54
17 was co-transfected with TCR
and ß chain expression vectors by electroporation as described (25). G418-resistant cultures were analysed by FACS for TCR, CD3
and CD4. Expression of the correct TCR
or ß chains was confirmed by DNA sequencing using the primers humanLVß17, humanV
1 and humanV
22 together with mouseC
int (TGTCCTGAGACCGAGGATCT) or mouseCßint (TGATGGCTCAAACAAGGAGAC). Hybridomas homogeneously expressing TCR and human CD4 were tested for responsiveness to Ni, superantigen and mAb as described above. Transfectants with poor or non-homogenous TCR expression were cloned by limiting dilution. Representative lines or clones were used for all further experiments.
| Results |
|---|
|
|
|---|
Similar CDR3B sequences in BV17+, Ni-reactive TCR from different donors
VB17-expressing TCR are over-represented in NiSO4-activated CD4+ T cells of donors with strong Ni allergy (18). For donor IF, numerous VB17+ ß chains of Ni-reactive T cell clones were sequenced revealing the repeated occurrence of the amino acid motif ArgAsp in positions 9596 of their CDR3B loops (18). The correlation of these amino acids with Ni-reactivity was underlined by the absence of Arg95 in 10 individual VB17+ TCR of tetanus toxoid-specific T cell clones from the same donor (data not shown). In addition, alanine mutations of either Arg95 or Asp96 completely abrogated Ni reactivity (15).
More recently, we extended our analyses to VB17+ Ni-reactive clones of other patients. Clone SE9 (donor SE) was analyzed in detail and compared to the previously studied (15) clones 4.13 and ANi2.3 from donor IF. Amino acid sequences of CDR13 regions of their
and ß chains are compared in Table 2
. Except for identical lengths of the CDR3 loops, the
chain of SE9 exhibits only 52% similarity to the (almost identical)
chains of the other two clones, differing from them in V as well as in J usage.
|
In contrast, the similarity between the three ß chains is ~95%. This is due mainly to identical V usage: the VB17 allele of SE9 differs from the others only by one amino acid in the leader region (23). All three ß chains differ in their rearranged J segments and the one of SE9 from the other two by an extended length of the CDR3 loop (Table 2
As described before for clones 4.13 and ANi2.3 (18), the TCR variable genes of SE9 were cloned into the pV2-15
and pV2-15ß expression vectors (26) containing the respective mouse constant genes in genomic arrangement. Both vectors were transfected into the mouse hybridoma 54
17 which lacks TCR
and ß genes but expresses human CD4 (20). The resulting transfectant corresponding to clone SE9 was termed T913, whereas clones 4.13 and ANi2.3 relate to transfectants T413 and T23 respectively (see Table 2
). Surface densities of TCR and CD4 were comparable for all transfectants described in this paper (FACS data not shown). Hence, the marked differences in antigen reactivity described below cannot be related to variations in CD4 or TCR expression.
Role of the N-nucleotide-defined ArgAsp motif in T913 versus T413
The observation that VB17+ ß chains in Ni-reactive TCR from unrelated individuals selected an N-region-determined ArgAsp motif in their CDR3B lead us to re-investigate this matter. A first set of experiments addressed the relevance of these two amino acids for antigen specificity of the transfectant T913. Arg96 and Asp97 were independently exchanged by Ala and the mutated ß chains expressed together with the T913
chain in 54
17 cells, resulting in the transfectants T913/CDR3RA and T913/CDR3DA. TCR signaling of both mutants was confirmed by stimulation with TCR-specific mAb (not shown) or the VB17-reactive superantigen SEB (Fig. 1A
). Concerning Ni reactivity, the data in Fig. 1
(B) reveal a reduction but certainly no elimination for the RA mutant of T913 and even an enhancement for the DA mutant. This is in clear contrast to analogous mutations of the T413 ß chain where we previously reported a total loss of Ni specificity for Ala replacements of either Arg95 or Asp96 (15). In fact, for the T413 ß chain, Ni reactivity (but not the SEB response) was destroyed even by the conservative exchange of Asp96 for Glu (T413/CDR3DE), while the same TCR tolerated mutations of Arg95 to Lys (T413/CDR3RK) or His (T413/CDR3RH) (see Fig. 2
). It thus appears that the ß chain CDR3 of T413 contains a Ni-binding motif, including a positive charge in position 95 and an absolute requirement for Asp in position 96. However, the similar ArgAsp motif in the TCR of T913 is not critical for Ni activation.
|
|
TCR
chain determines promiscuous HLA-DR restriction of T913In analogy to previously reported data for T413 and T23 (15), the activation of T913 by Ni was inhibited by mAb to HLA-DR but not to -DP or -DQ (not shown). However, when using as APC a panel of HLA-DR homozygous B cell lines, T913 revealed an apparent promiscuity of HLA-DR restriction (Fig. 3A
|
We then produced hybrid TCR transfectants containing either the
chain of T913 and ß of T23 (T913A/23B) or vice versa (T23A/913B). All hybridomas were activated comparably well by SEB on different APC (Fig. 3D and E
Concerning the hybrid receptors, combination of the T23
with the T913 ß chain (T23A/913B) completely failed to react to NiSO4 on both APC (Fig. 3F and G
), indicating that the T23
chain does not tolerate the imposed variation in length and sequence of the CDR3B region. In contrast, the hybrid TCR of T913
with the T23ß (T913A/23B) not only responded to NiSO4, but also exhibited promiscuous DR restriction (Fig. 3C
). This clearly implies that the DR promiscuity of T913 is controlled by its TCR
chain. However, more detailed analysis of the responses in Fig. 3
(F and G) revealed an inverse sensitivity of the hybrid transfectant to Ni presentation by WT47 versus JESTHOM as compared to T913, which indicates a certain role also of the TCR ß chain in co-defining HLA restriction specificity. The narrow doseresponse windows seen in Fig. 3
(F and G) relate to toxic effects of NiSO4 at concentrations >0.3 mM as defined by inhibition of PHA responses (19 and unpublished data). SEB responses are not affected by Ni concentrations at 0.3 mM or below.
TCR
chain determines Ni specificity of T913
To better define the
and ß chain contribution to antigen and restriction specificity of T913 we combined the T913
chain with a series of more or less related ß chains. Transfectants expressing the chimeric TCR were then assayed for IL-2 release in the presence or absence of NiSO4 on murine L-cells transfected either with HLA-DRB1*0101 (L-DR1) or DRB1*0401 (L-DR4). The data summarized in the upper part of Table 3
reveal very similar effects of ArgAla or AspAla mutations in the CDR3 ß sequences of either the original T913 or the T413 ß chains: in both cases the DA exchange had little effect on Ni reactivity in the context of DR1 while the DR4-restricted recognition was strongly enhanced. In contrast, RA mutation in both cases reduced, but not abolished, the DR1-restricted reaction without greatly affecting DR4 restriction. This shows that compared to the receptors of T413 or T23 (15), the ß chain of the T913 TCR contributes much less to antigen specificity than its
chain.
|
We therefore combined T913
with two additional VB17+ human ß chains. One was derived from the Ni-specific clone ANi1.3 (corresponding to hybridoma T13), the other from clone CL13, specific for tetanus toxoid. Both clones were obtained from donor IF, expressed VB17 and were restricted for HLA-DR13. None of the two ß chains contained the typical ArgAsp motif, although ANi1.3ß exhibited Arg in position 93 and Asp in 95 and 97, and CL13ß possessed two Arg in 93 and 94 (see Table 2
chain of clone 4.13 (15) (and unpublished results), both of them combined with the T913
chain to yield TCR of reasonable Ni reactivity (Table 3
chain defines this clone's specificity. This assumption was corroborated by the discovery that Ni reactivity was retained even in a chimeric TCR combining the T913
chain with the completely unrelated ß chain (see Table 2
TCR
chain mutations
The above data clearly indicate that in contrast to T413 or T23, the contribution of the VB17 element and the ArgAsp motif in determining Ni specificity of hybridoma T913 is extremely limited. Instead, for this TCR the dominance of the
chain appears overwhelming. TCR
chains have frequently been related to the specificity of MHC restriction. One study (27) described that promiscuous HLA-DR restriction but not peptide specificity of a human T cell clone was substantially reduced by mutation of Ser51 and Ala52 in the CDR2 sequence of its
chain. In mouse TCR, the amino acid
51 has also been associated with MHC restriction (2830). However, recent reports showed also other positions in CDR1 and 2, and even in the CDR3 of TCR
chains to control MHC restriction (31,32).
Position
51 is occupied by Ser in the DR13-restricted TCR of T23 and T413, but by Lys in the DR-promiscuous receptor of T913 (Table 2
). We exchanged Lys51 in the T913
chain by Ser and Ser51 in T23
by Lys. The KS and SK mutated
chains, when co-expressed with the respective ß chains of T913 and T23, were functional in terms of SEB activation (data not shown). However, while antigen specificity was completely lost for the Ser51Lys mutant of T23 (Fig. 4
), the Lys51Ser mutation in T913 did not affect the DR13- nor the DR1-restricted activation by NiSO4 (Fig. 4
). Thus, while the TCR of T23 apparently obeys the rules for MHC contacts via its CDR2A loop as established by others (2730), this does not apply to the TCR of T913.
|
| Discussion |
|---|
|
|
|---|
Our study correlates TCR structure with antigen reactivity and HLA-DR restriction for a set of Ni-reactive human, VB17+, CD4+ T cells from Ni-allergic donors. Expressing TCR fusion genes of human variable and mouse constant regions in mouse hybridoma cells (25), we here compare three published VB17+ transfectants derived from donor IF [T13, T23 and T413 (15)] with a newly established hybridoma of donor SE (T913). The starting point for this investigation was our previous observation that 1030% of in vitro Ni-activated CD4+ T cells from strongly Ni-allergic individuals expressed VB17+ TCR and that for one donor (IF), the CDR3B sequences of such TCR frequently contained an Arg95Asp96 motif (18). The significance of this motif was stressed by Ala mutations of either Arg95 or Asp96 in hybridoma T413, each one resulting in total loss of antigen specificity (15). Moreover, TCR ß chains of T413 and T23, both containing the same VB17 element and the Arg95Asp96 motif, but different Jß segments, are functionally fully exchangable between the two receptors. In contrast, the T13 ß chain lacks the ArgAsp motif and fails to produce Ni reactivity with the
chain of T413 (15). Here, we describe that the T413 ß chain tolerates replacements of Arg95 by Lys or His, but that even the conservative mutation of Glu for Asp96 extinguishes the reactivity to Ni (Fig. 2For donor IF these data clearly imply that for Ni interaction the TCR of T23 and T413 crucially depend on the ArgAsp motif in their CDR3B sequences. Within this motif the sterical requirements for the negative charge in position 96 appear significantly more restrictive than for the positive charge in 95, where Arg could be changed to Lys or His without loss of specificity. While functional replacements of Arg by Lys or vice versa appear rather common in peptide-specific TCR (3335), a change of Arg for His without loss of specificity has, to our knowledge, not yet been reported. In light of the fact that His constitutes an optimal chelator for Ni2+ ions, and that also Arg and Lys were reported to participate in metal complexation (9,3640), we tend to see this as indication for a direct interaction of position 95 in the T413 and T23 ß chains with Ni.
When we found the VB17+ receptor of clone SE9 (hybridoma T913) from donor SE to contain the very same ArgAsp motif (though shifted from position 9596 to 9697), we therefore assumed to have identified a stretch of amino acids of general importance for Ni interaction in TCR of different individuals. The functional homology of the VB17+ ß chains of the two donors appeared to be underlined by the finding that the ß chain of T23 (donor IF) yielded a Ni-specific TCR also in complex with the
chain of T913 from donor SE (Fig. 3
).
These experiments also demonstrated that the DR-promiscuous versus DR13-specific HLA restriction of T913 and T23 respectively was imposed by the T913
chain (Fig. 3
). Promiscuous class II restriction of peptide- or hapten-specific TCR has repeatedly been reported (27,4145), and in one case was related to amino acids in positions 51 and 52 of the TCR
chain (27). In fact, amino acid
51 has been proposed as a major point of MHC contact (28,30,46,47). However, while changing position
51 in T23 from Ser to Lys abolished antigen specificity, a Lys to Ser mutation in
51 of T913 was without effect (Fig. 4
). These apparently different HLA-DR contacts by the two TCR are reflected in the dominant role of the T913
chain in defining antigen as well as restriction specificity. This dominance was most impressively demonstrated by functional combination of T913
with a variety of unrelated ß chains, including one of a class I MHC-restricted mouse TCR with specificity for TNP (Table 3
). To our knowledge this is the only case of an antigen-specific TCR composed of
and ß chains originating from TCR of different species, and of different antigen and restriction specificities.
Thus, in contrast to our assumption and unlike for T23 or T413, the TCR ß chain of T913 does not appear to play a major part in Ni recognition. Nonetheless, ß chain alterations in T913 are not totally without effect on Ni activation (Fig. 1
and Table 3
) and may also interfere with restriction specificity (Table 3
). However, it is obvious that neither the ArgAsp motif nor the VB17 element are essential for Ni reactivity in TCR containing the T913
chain (Fig. 1
and Table 3
).
The TCR of T913, therefore, differs fundamentally from those of T23 or T413. The majority of its contacts to the `Ni-epitope' as well as to non-polymorphic sites of HLA-DR molecules are defined by its VA22+
chain. This is reminiscent of a superantigen-like reactivity of the hapten ABA with VA3-expressing mouse T cells (48). Whereas for mice this resulted in overexpression of VA3 in ABA-specific T cells, so far we did not observe a selection for VA22 in human Ni-reactive T cells (18). However, due to lack of VA22-specific antibodies, careful analyses of VA22 expression in Ni-reactive T cell lines have not yet been performed. Also the J
44 segment, rearranged in T913, has not been detected so far in other Ni-reactive clones. Thus, the center of specificity of this TCR appears to locate in the CDR3 sequence of its
chain. Future studies are needed to more precisely define the complex formed between this TCR
chain, non-polymorphic HLA-DR regions and Ni ions, and to evaluate the significance of this interaction for the phenomenon of Ni allergy.
| Acknowledgments |
|---|
We thank U. Pflugfelder and D. Wild for expert technical assistance, and Dr I. Haidl for critically revising the manuscript. We also are grateful to Drs O. Acuto (Paris) and F. Sinigaglia (Milano) for kindly supplying 54
17 cells and HLA-DR-transfected L-cells respectively. These studies were supported by the clinical research group `Pathomechanismen der allergischen Entzündung', BMBF FKZ 01GC9701/7 and grant BMH4-CT98-3713 of the European Union BIOMED 2 program. | Abbreviations |
|---|
| ABA p-azobenzarsonate |
| APC antigen-presenting cell |
| CDR complementary-determining region |
| CTLL cytotoxic T cell line |
| IHW International Histocompatibility Workshop |
| SEB staphylococcal enterotoxin B |
| PHA phytohemagglutinin |
| TNP trinitrophenyl |
| Notes |
|---|
3 Present address: CpG Immuno Pharmaceuticals GmbH, Max-Volmer-Strasse 4, 40724 Hilden, Germany
4 Present address: Pfizer Laboratories, 39 Rue de la Loge, BP100, 94265 Fresnes Cedex, France ![]()
Received 31 May 2000, accepted 6 September 2000.
| References |
|---|
|
|
|---|
- Basketter, D. A., Briatico-Vangosa, G., Kaestner, W., Lally, C. and Bontinck, W. J. 1993. Nickel, cobalt and chromium in consumer products: a role in allergic contact dermatitis? Contact Dermatitis 28:15.[Web of Science][Medline]
- Lepoittevin, J.-P. and Leblond, I. 1997. HaptenpeptideT cell receptor interactions: molecular basis for the recognition of haptens by T lymphocytes. Eur. J. Dermatol. 7:151.
- Griem, P., Wulferink, M., Sachs, B., González, J. and Gleichmann, E. 1998. Allergic and autoimmune reactions to xenobiotics: how do they arise? Immunol. Today 19:133.[Web of Science][Medline]
- Kapsenberg, M. L., Bos, J. D. and Wierenga, E. A. 1992. T cells in allergic responses to haptens and proteins. Semin. Immunopathol. 13:303.[Web of Science][Medline]
- Werfel, T., Hentschel, M., Kapp, A. and Renz, H. 1997. Dichotomy of blood- and skin-derived IL4-producing allergen-specific T cells and restricted V beta repertoire in nickel-mediated contact dermatitis. J. Immunol. 158:2500.[Abstract]
- Moulon, C., Wild, D., Dormoy, A. and Weltzien, H. U. 1998. MHC-dependent and MHC-independent activation of human nickel-specific CD8+ cytotoxic T-cells from allergic donors. J. Invest. Dermatol. 111:360.[Web of Science][Medline]
- Cavani, A., Mei, D., Guerra, E., Corinti, S., Giani, M., Pirrotta, L., Puddu, P. and Girolomoni, G. 1998. Patients with allergic contact-dermatitis to nickel and nonallergic individuals display different nickel-specific T-cell responsesevidence for the presence of effector CD8+ and regulatory CD4+ T-cells. J. Invest. Dermatol. 111:621.[Web of Science][Medline]
- Basketter, D., Dooms-Goossens, A., Karlberg, A.-T. and Lepoittevin, J.-P. 1995. The chemistry of contact allergy: why is a molecule allergenic? Contact Dermatitis 32:65.[Web of Science][Medline]
- Pettit, L. D., Gregor, J. E. and Kozlowski, H. 1991. Complex formation between metal ions and peptides. Perspect. Bioinorg. Chem. 1:1.
- Nalefski, E. A. and Rao, A. 1993. Nature of the ligand recognized by a hapten- and carrier-specific, MHC-restricted T cell receptor. J. Immunol. 150:3806.[Abstract]
- Ortmann, B., Martin, S., von Bonin, A., Schiltz, E., Hoschützky, H. and Weltzien, H. U. 1992. Synthetic peptides anchor T cell-specific TNP-epitopes to major histocompatibility complex antigens. J. Immunol. 148:1445.[Abstract]
- Kohler, J., Martin, S., Pflugfelder, U., Ruh, H., Vollmer, J. and Weltzien, H. U. 1995. Cross-reactive trinitrophylated peptides as antigens for class II major histocompatibility complex-restricted T cells and inducers of contact sensitivity in mice. Limited T cell receptor repertoire. Eur. J. Immunol. 25:92.[Web of Science][Medline]
- Gelber, C., Gemmell, L., McAteer, D., Homola, M., Swain, P., Liu, A., Wilson, J. and Gefter, M. 1997. Down-regulation of poison ivy/oak-induced contact sensitivity by treatment with a class II MHC binding peptide: hapten conjugate. J. Immunol. 158:2425.[Abstract]
- Padovan, E., Bauer, T., Tongio, M. M., Kalbacher, H. and Weltzien, H. U. 1997. Penicilloyl peptides are recognized as T cell antigenic determinants in penicillin allergy. Eur. J. Immunol. 27:1303.[Web of Science][Medline]
-
Vollmer, J., Weltzien, H. U. and Moulon, C. 1999. TCR reactivity in human nickel allergy indicates contacts with complementarity-determining region 3 but excludes superantigen-like recognition. J. Immunol. 163:2723.
[Abstract/Free Full Text] - Sinigaglia, F. 1994. The molecular basis of metal recognition by T cells. J. Invest. Dermatol. 102:398.[Web of Science][Medline]
- Weltzien, H. U., Moulon, C., Martin, S., Padovan, E., Hartmann, U. and Kohler, J. 1996. T-cell immune-responses to haptensstructural models for allergic and autoimmune reactions. Toxicology 107:141.[Web of Science][Medline]
- Vollmer, J., Fritz, M., Dormoy, A., Weltzien, H. U. and Moulon, C. 1997. Dominance of the BV17 element in nickel-specific human T cell receptors relates to severity of contact sensitivity. Eur. J. Immunol. 27:1865.[Web of Science][Medline]
- Moulon, C., Vollmer, J. and Weltzien, H. U. 1995. Characterization of processing requirements and metal cross-reactivities in T-cell clones from patients with allergic contact-dermatitis to nickel. Eur. J. Immunol. 25:3308.[Web of Science][Medline]
- Blank, U., Boitel, B., Mège, D., Ermonval, M. and Acuto, O. 1993. Analysis of tetanus toxin peptide/DR recognition by human T cell receptors reconstituted into a murine T cell hybridoma. Eur. J. Immunol. 23:3057.[Web of Science][Medline]
-
Grabstein, K., Eisenmann, J., Modizuki, D., Schanebeck, P., Cordon, P., Hopp, T., March, C. and Gilles, S. J. 1986. Purification to homogeneity of B cell stimulating factor. A molecule that stimulates proliferation of multiple lymphokine-dependent cell lines. J. Exp. Med. 163:1405.
[Abstract/Free Full Text] - Leo, O., Foo, M., Sachs, D. H., Samelson, L. E. and Bluestone, J. A. 1987. Identification of a monoclonal antibody specific for a murine T3 polypeptide. Proc. Natl Acad. Sci. USA 85:1374.
- Arden, B., Clark, S. P., Kabelitz, D. and Mak, T. W. 1995. Human T-cell receptor variable gene segment families. Immunogenetics 42:455.[Medline]
-
Moss, P. A. H. and Bell, J. I. 1996. Sequence analysis of the human
ß T-cell receptor CDR3 region. Immunogenetics 42:10.
- Vollmer, J., Weltzien, H. U., Dormoy, A., Pistoor, F. and Moulon, C. 1999. Functional expression and analysis of a human HLA-DQ restricted, nickel-reactive T cell receptor in mouse hybridoma cells. J. Invest. Dermatol. 113:175.[Web of Science][Medline]
-
Casorati, G., Traunecker, A. and Karjalainen, K. 1993. The T cell receptor
ß VJ shuffling shows lack of autonomy between the combining site and the constant domain of the receptor chains. Eur. J. Immunol. 23:586.[Web of Science][Medline]
- Brawley, J. V. and Concannon, P. 1996. Modulation of promiscuous T cell receptor recognition by mutagenesis of CDR2 residues. J. Exp. Med. 183:1043.
-
Garcia, K. C., Degano, M., Pease, L. R., Huang, M., Peterson, P. A., Teyton, L. and Wilson, I. A. 1998. Structural basis of plasticity in T cell receptor recognition of a self peptideMHC antigen. Science 279:1166.
[Abstract/Free Full Text] -
Housset, D., Mazza, G., Grégoire, C., Piras, C., Malissen, B. and Fontecilla-Camps, J. C. 1997. The three-dimensional structure of a T-cell antigen receptor V
Vß heterodimer reveals a novel arrangement of the Vß domain. EMBO J. 16:4205.[Web of Science][Medline]
-
Sim, B.-C., Lo, D. and Gascoigne, N. R. J. 1998. Preferential expression of TCR V
regions in CD4/CD8 subsets: class discrimination or co-receptor recognition. Immunol. Today 6:276.
-
Brawley, J. V. and Concannon, P. 1999. Systematic mutagenesis of TCR complementarity-determining region 3 residues: a single conservative substitution dramatically improves response to both multiple HLA-DR alleles and peptide variants. J. Immunol. 163:4946.
[Abstract/Free Full Text] -
Correia-Neves, M., Waltzinger, C., Wurtz, J.-M., Benoist, C. and Mathis, D. 1999. Amino acids specifying MHC class preference in TCR V
2 regions. J. Immunol. 163:5471.[Abstract/Free Full Text] -
Wucherpfennig, K. W., Sette, A., Southwood, S., Oseroff, C., Matsui, M., Strominger, J. L. and Hafler, D. A. 1994. Structural requirements for binding of an immunodominant myelin basic protein peptide to DR2 isotypes and for its recognition by human T cell clones. J. Exp. Med. 179:279.
[Abstract/Free Full Text] - Sun, R., Shepherd, S. E., Geier, S. S., Thomson, C. T., Sheil, J. M. and Nathenson, S. G. 1995. Evidence that the antigen receptors of cytotoxic T lymphocytes interact with a common recognition pattern on the H-2Kb molecule. Immunity 3:573.[Web of Science][Medline]
- Wedderburn, L. R., Searle, S. J., Rees, A. R., Lamb, J. R. and Owen, M. J. 1995. Mapping T cell recognition: the identification of a T cell receptor residue critical to the specific interaction with an influenza hemagglutinin peptide. Eur. J. Immunol. 25:1654.[Web of Science][Medline]
- Glennon, J. D. and Sarkar, B. 1982. Nickel(II) transport in human blood serum. Biochem. J. 203:15.[Web of Science][Medline]
- Kramer, A., Schuster, A., Reineke, U., Malin, R., Volkmer-Engert, R., Landgraf, C. and Schneider-Mergener, J. 1994. Combinatorial cellulose-bound peptide libraries: screening tools for the identification of peptides that bind with predefined specificity. Methods Enzymol. 6:388.
- Sadler, P. J., Tucker, A. and Viles, J. H. 1994. Involvement of a lysine residue in the N-terminal Ni2+ and Cu2+ binding site of serum albumins. Eur. J. Biochem. 220:193.[Web of Science][Medline]
- Lippard, S. J. 1995. At lastthe crystal structure of urease. Science 268:997.
- Kanyo, Z. F., Scolnick, L. R., Ash, D. E. and Christianson, D. W. 1996. Structure of a unique binuclear manganese cluster in arginase. Nature 383:554.[Medline]
- Bhardwaj, V., Kumar, V., Geysen, H. M. and Sercarz, E. E. 1993. Degenerate recognition of a dissimilar antigenic peptide by myelin basic protein-reactive T cells. J. Immunol. 151:5000.[Abstract]
- Vordermeier, H. M., Harris, D. P., Moreno, C. and Ivany, J. 1994. Promiscuous T cell recognition of an H-2IA-presented mycobacterial epitope. Eur. J. Immunol. 24:2061.[Web of Science][Medline]
- Katoh, M., Itoh, Y., Ogasawara, K., Kajino, K., Nishihori, H., Takahashi, A., Matsuki, N., Iwabuchi, N., Yoshida, T. O., Good, R. A. and Onoé, K. 1996. A promiscuous T cell hybridoma restricted to various I-A molecules. Eur. J. Immunol. 26:976.[Web of Science][Medline]
- Kohler, J., Hartmann, U., Grimm, R., Pflugfelder, U. and Weltzien, H. U. 1997. Carrier-independent hapten recognition and promiscuous MHC restriction by CD4 T cells induced by trinitrophenylated peptides. J. Immunol. 158:591.[Abstract]
- Threlkeld, S. C., Wentworth, P. A., Kalams, S. A., Wilkes, B. M., Ruhl, D. J., Keogh, E., Sidney, J., Southwood, S., Walker, B. D. and Sette, A. 1997. Degenerate and promiscuous recognition by CTL of peptides presented by the MHC class I A3-like superfamily. J. Immunol. 159:1648.[Abstract]
-
Sim, B.-C., Zerva, L., Greene, M. I. and Gascoigne, N. R. J. 1996. Control of MHC restriction by TCR V
CDR1 and CDR2. Science 273:963.[Abstract]
-
Sim, B.-C., Wung, J. L. and Gascoigne, N. R. J. 1998. Polymorphism within a TCRAV family influences the repertoire through class I/II restriction. J. Immunol. 160:1204.
[Abstract/Free Full Text] -
Tan, K.-N., Datlof, B. M., Gilmore, J. A., Kronman, A. C., Lee, J. H., Maxam, A. M. and Rao, A. 1988. The T cell receptor V
3 gene segment is associated with reactivity to p-azobenzenearsonate. Cell 54:247.[Web of Science][Medline]
This article has been cited by other articles:
![]() |
D. A. Schmid, J. P. H. Depta, M. Luthi, and W. J. Pichler Transfection of Drug-Specific T-Cell Receptors into Hybridoma Cells: Tools to Monitor Drug Interaction with T-Cell Receptors and Evaluate Cross-Reactivity to Related Compounds Mol. Pharmacol., July 1, 2006; 70(1): 356 - 365. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-J. Thierse, C. Moulon, Y. Allespach, B. Zimmermann, A. Doetze, S. Kuppig, D. Wild, F. Herberg, and H. U. Weltzien Metal-Protein Complex-Mediated Transport and Delivery of Ni2+ to TCR/MHC Contact Sites in Nickel-Specific Human T Cell Activation J. Immunol., February 1, 2004; 172(3): 1926 - 1934. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Gamerdinger, C. Moulon, D. R. Karp, J. van Bergen, F. Koning, D. Wild, U. Pflugfelder, and H. U. Weltzien A New Type of Metal Recognition by Human T Cells: Contact Residues for Peptide-independent Bridging of T Cell Receptor and Major Histocompatibility Complex by Nickel J. Exp. Med., May 19, 2003; 197(10): 1345 - 1353. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Lu, J. Vollmer, C. Moulon, H. U. Weltzien, P. Marrack, and J. Kappler Components of the Ligand for a Ni++ Reactive Human T Cell Clone J. Exp. Med., March 3, 2003; 197(5): 567 - 574. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hashizume, M. Takigawa, and Y. Tokura Characterization of Drug-Specific T Cells in Phenobarbital- Induced Eruption J. Immunol., May 15, 2002; 168(10): 5359 - 5368. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Artik, K. Haarhuis, X. Wu, J. Begerow, and E. Gleichmann Tolerance to Nickel: Oral Nickel Administration Induces a High Frequency of Anergic T Cells with Persistent Suppressor Activity J. Immunol., December 15, 2001; 167(12): 6794 - 6803. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Budinger, N. Neuser, U. Totzke, H. F. Merk, and M. Hertl Preferential Usage of TCR-V{beta}17 by Peripheral and Cutaneous T Cells in Nickel-Induced Contact Dermatitis J. Immunol., November 15, 2001; 167(10): 6038 - 6044. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

) or Asp97 (T913/CDR3DA) (
) were co-expressed with the T913
) served as control. Transfectants were stimulated with SEB (A) or NiSO4 (B), using as APC mouse L-cells transfected with HLA-DRB1*0101. IL-2 in 20 h culture supernatants was determined by [3H]thymidine incorporation into CTLL cells. Results are means of triplicates (c.p.m.) and dotted lines in B represent a second, independent experiment.
12%.
) to SEB (D and E) or NiSO4 (F and G) was assessed in the presence of WT47 (D and F) or JESTHOM (E and G) as APC. IL-2 production was determined by CTLL proliferation as above. Data are given as c.p.m. of [3H]thymidine incorporation ± SD of triplicates.


