International Immunology, Vol. 12, No. 12, 1705-1713,
December 2000
© 2000 Japanese Society for Immunology
A DNase I hypersensitive site near the murine
1 switch region contributes to insertion site independence of transgenes and modulates the amount of transcripts induced by CD40 ligation
Department of Microbiology and Immunology, University of Michigan Medical School, Room 6746, Medical Science Building II, 1301 East Catherine, Ann Arbor, MI 48109-0620, USA
Correspondence to: W. Dunnick
| Abstract |
|---|
|
|
|---|
Several cis-acting elements regulate the expression of germline transcripts of heavy chain constant region genes and their subsequent switch recombination. To study such elements in the murine
1 gene, we have utilized a transgenic approach. In this study we focused on a DNase I hypersensitive site (termed `Site II') that lies about 2 kb 3' of the
1 promoter region and I exon, just 5' to the
1 switch region. We have reported that
1 transgenes with Site II display the characteristics of a locus control region (LCR) in that they are insertion site independent and copy number dependent. For the present study we prepared six lines of transgenic mice that have the promoter region and I exon, but lack Site II. Expression of RNA from
1 transgenes that lack Site II is not correlated with transgene copy number; expression is insertion site dependent. This result indicates that DNase hypersensitive Site II is an important part of the LCR-like elements in the murine
1 gene. RNA expression from the
1 transgenes that lack Site II is inducible by IL-4 and by CD40 ligation. However, the induction of transgenic RNA expression by CD40 ligation is greater than expected, suggesting that elements within Site II participate in negative regulation of the amount of germline transcripts after CD40 ligation.
Keywords: CD40 ligand, gene rearrangement, IL-4, isotype switching
| Introduction |
|---|
|
|
|---|
Switch recombination is part of antigen-driven differentiation of B cells. It is preceded by transcription of a heavy chain gene in its germline configuration and the same cytokines that induce switch recombination to a given gene first induce germline transcription (14). For example, both germline transcription and switch recombination of the murine
1 gene are induced by IL-4 (510). To understand, and perhaps manipulate, the expression of various heavy chain isotypes, it would be important to understand the DNA elements that regulate both germline transcription and switch recombination. A locus control region (LCR) at the 3' end of the locus (11,12) is thought to play an important role in switch recombination and germline transcription. The heavy chain LCR includes, at a minimum, five DNase I hypersensitive sites (11,1315), which are active as enhancers of transcription (11,1422). Because a combination of four of these DNase I hypersensitive sites conferred upon reporter genes insertion site independence and copy number dependence in stable transfections, they have been called an `LCR' (11). Support for a function of these enhancers in vivo has come from replacement of some of the elements by a phosphoglycerate kinase promoter:neo resistance cassette in the germline (12,23,24). These replacements reduced expression of IgG3, IgG2b, IgG2a and IgE, and of their corresponding germline transcripts (12,23,24).
Germline transcription and switch recombination to the
1 heavy chain gene were not altered by germline replacements of various 3' DNase I hypersensitive sites, even though activity of the flanking genes,
3 and
2b, was severely diminished (12,23,24). We have found that the transcriptional activity of
1 transgenes is insertion site independentvirtually all founder lines express
1 transgenes (25,26). Moreover, transcriptional activity is approximately dependent on copy number. Hence, the
1 heavy chain gene includes it own LCR-like elements. Candidate DNA sequences that might be included in the
1 LCR-like elements are two DNase I hypersensitive sites, a dramatic site in the promoter region for germline transcripts (Site I) (27,28) and a more modest pair of sites (Site II) just 5' of the switch recombination region (S
1) (2628). Both sets of DNase I hypersensitive sites are induced by IL-4 (27,28), include STAT6 binding sites (26,29,30), include NF-
B binding sites (31,32) and include other binding sites for transcription factors (26,33,34).
Several studies have implicated the promoter region for
1 germline transcripts in the regulation of these transcripts and switch recombination (3538). We found that the S
1 region has an important quantitative effect on germline transcripts, but does not alter their IL-4 inducibility (26). The analysis of several properly regulated
1 transgenes demonstrated that all shared two additional regions: DNase hypersensitive Site II and a 600 bp region including the CH3 coding exon as well as the 5' flanking intron (39). Transgenes that lack the entire C coding region, including the CH3 exon, exhibit correct transcriptional regulation, insertion site independence and copy number dependence, suggesting that the CH3 exon is not essential for these functions (26). In this study, we investigated transgenes that lack Site II. We tested the insertion site and copy number dependence, IL-4 inducibility, CD40 ligand inducibility, and the tissue specificity of transcription of these transgenes.
| Methods |
|---|
|
|
|---|
DNA constructs and transgenic mice
p
1CAT was constructed by cutting the plasmid p
1/EH10-Bgl (25) with HindIII (2100 bp relative to the 5'-most start site of germline transcription) (40) and BglII (+200). A 2300 bp fragment containing the
1 promoter was removed. This fragment was inserted into pCAT (Stratagene, La Jolla, CA) that had been digested with HindIII and SalI by blunt-end ligation at the BglIISalI site. The vector was then partially digested with EcoRI and the ends were blunted. Blunted SmaISacI (+1450 to +2414) fragment from p
1/HSc4.4/SVL, containing Site II (26), was ligated into the vector. This construct was transformed into chemically competent cells, and a clone was selected for insertion of Site II 3' to the CAT coding sequences in the same transcriptional orientation as both the
1 promoter region and the CAT coding sequences.
p
1/HS3.5/CH3 was constructed by inserting a 600 bp fragment (25) containing the CH3 exon of C
1, 200 bp of 5' sequence (including the splice acceptor) and 50 bp of 3' sequence (including the poly(A) addition site) into the SmaI site of p
1/HS3.5/luc (39). A clone containing the promoter and the CH3 element in the same transcriptional orientation were selected, and designated p
1/HS3.5/CH3. In this publication, we shall refer to the insert in p
1/HS3.5/CH3 as the `4.1 kb transgene without Site II'. The insert could be extracted by digestion with HindIII and SalI, and included 2100 bp of promoter region, I
1, 1000 bp of 3' flanking sequences, the CH3 cassette, but not Site II. Transgenic mice were prepared using this 4.1 kb insert by injection of SJLxC57BL/6 F2 eggs (41). Transgenic lines were established by breeding founders with SJLxC57BL/6 F1 mice and maintained by back-crossing to the same F1 mice. The construct p
1/HSc4.4/SVL differs from p
1/HS3.5/CH3 in that it replaces CH3 with an adenovirus splice acceptor/SV40 poly(A) addition site cassette (termed `SVL') and it retains Site II (26). Throughout this publication we will refer to the 4.4 kb insert in p
1/HSc4.4/SVL as `the 4.4 kb transgene with Site II'.
Cell culture
Splenocytes from mice were treated with 0.14 M ammonium chloride and 0.017 M Tris (pH 7.3) to lyse the red blood cells. T cells were depleted using anti-Thy 1 and complement (42). Cells were then cultured for 3 days at 3x106 cells/ml in RPMI 1640/10% FBS with either lipopolysaccharide (LPS) (20 µg/ml), LPS + IL-4 (35 ng/ml) or CD40 ligand (CD40L). Recombinant CD40L was expressed on Sf9 cells (38), which were added to the B cells at a ratio of 1:5 Sf9:B cells. Thymocytes were cultured with concanavalin A at 5 µg/ml with or without 35 ng/ml recombinant murine IL-4. To harvest total cellular RNA, cells were washed twice with PBS and then resuspended in 2 ml of 4 M guanidine isothiocyanate, 25 mM sodium citrate, 0.5% sarkosyl and 0.1 M 2-mercaptoethanol. Then 0.2 ml sodium acetate, pH 4, 2 ml phenol and 0.4 ml chloroform:IAA (24:1) were added sequentially, and the mixture was left on ice for 15 min (43). After centrifugation for 20 min at 4°C, RNA in the aqueous layer was precipitated in 95% ethanol at 20°C.
Transfection
Twenty million M12.4.1 cells were transfected with 10 µg of the test plasmid plus 10 µg of pRSVßgal complexed to 150 µg DEAEdextran, followed by 10% DMSO shock for 23 min at room temperature (44). M12.4.1 in a B cell lymphoma (BALB/c origin) that is surface Ig (45). Stat6 is strongly activated by IL-4 treatment of M12.4.1 (46). The transfected cells were cultured for 2 days with or without 35 ng/ml murine recombinant IL-4. Cell lysates were prepared and assayed for both ß-galactosidase and CAT activity. CAT activity (from the test plasmid) was normalized for transfection efficiency by dividing by the ß-galactosidase activity of the same lysate.
PCR of transcripts
cDNA was made from total RNA using Superscript II and random hexamer primers. All PCR reactions were done in 50 mM KCl, 10 mM Tris, pH 8.4, 0.1 mg/ml gelatin, 5 mM MgCl2 and 0.2 mM dNTPs. PCR of endogenous germline transcripts was done using the primers GACGGCTGCTTTCAGAGGTT (I
1-1, M12389 residues 15901609) and TAGTTTGCGAATC (C
1, L35252 residues 458475). Transgene transcripts were amplified using the same 5' primer (M12389 15901609) and TCGGTCTGCC/GCAGGCTCAG (I/CH3), which crosses the I/CH3 boundary found only in spliced transgenic transcripts (boundary noted in the oligonucleotide sequence). The samples were first heated at 95°C for 3 min. PCR of endogenous transcripts was performed with 30 cycles (1 min at 95°C, 1 min at 50°C and 1 min at 72°C), while transgenic transcripts were amplified by 30 cycles (1 min at 95°C, 1 min at 66°C and 1 min at 72°C). Following an additional 10 min at 72°C, all samples were stored at 4°C. Products were fractionated on 1.5% agarose gels and were then blotted onto nylon filters. Hybridization was performed using the probe TCTTTAACACAGAGGCTTCC (I
1-2, M12389 17501769). To control for variable cDNA content among the samples, HPRT transcripts were also amplified by PCR (26). This product was fractionated on a 3% NuSieve gel and visualized by ethidium bromide staining.
S1 nuclease protection assay
Approximately 10 µg total RNA was hybridized with continuously labeled probe in 20 µl 50% formamide, 0.4 M NaCl, 40 mM PIPES, pH 6.4 and 1 mM EDTA at 42°C for 16 h (25). Samples were digested with S1 nuclease in 0.5 ml for 60 min at 37°C and were fractionated on a 6% acrylamide/7 M urea gel. The probe WD361 includes a TaqISau3A fragment with 36 bp of the CH2 exon and 325 bp of the CH3 exon (L35252 residues 10341394) cloned into phage M13.
| Results |
|---|
|
|
|---|
Site II as an enhancer
Site II was originally identified as a pair of DNase I hypersensitive sites. Since DNase hypersensitive sites are strongly correlated with regulatory regions, we wanted to see if they could act as enhancers of transcription. We prepared a construct (p
1CAT-HSII) in which CAT was inserted between the
1 promoter and Site II, essentially taking the place of the I exon. As a control, we used the same construct without Site II (p
1CAT). Expression of p
1CAT transfected into M12.4.1 cells was tested in both the presence and absence of IL-4. Consistent with other results (37,38), p
1CAT showed ~4-fold induction with IL-4 (Fig. 1
1CAT-HSII had no higher basal activity than p
1CAT and p
1CAT-HSII yielded the same induction by IL-4 as did p
1CAT. Thus, we conclude that Site II has no enhancer activity for the
1 promoter, as measured in the typical transient transfection assay.
|
Insertion site dependence of transgenes without Site II
Some elements which fail to work as enhancers in transfection/reporter systems demonstrate an effect on transgene expression in vivo. Therefore, we prepared six independent lines of mice with the 4.1 kb transgene lacking Site II (p
1/HS3.5/CH3; Fig. 2A
|
|
Previous work with other
1 transgenes has shown that the
1 gene possesses both insertion site independence and copy number dependence, suggesting that it may contain its own LCR (25). To confirm the role of Site II in the LCR, we analyzed RNA from mice with the previously described (26) 4.4 kb transgene with Site II. RNA expression from this transgene correlated with copy number (Fig. 3B
1 transgenes, expression from the 4.4 kb transgenes with Site II was independent of insertion site.
IL-4, CD40L and cell-type regulation of the transgenes without Site II
The endogenous
1 gene shows little or no expression when cells are treated with LPS. Transcription is greatly induced when cells are treated with LPS + IL-4 and, to a lesser extent, when CD40L is added to the media (38). We wanted to determine if RNA from the 4.1 kb transgene without Site II could be induced by IL-4 or by CD40L. To compare various samples in a semi-quantitative manner, we amplified a series of 5-fold dilutions for each cDNA sample (Fig. 4
). For our PCR, the signal is a function of the log of the cDNA substrate. For example, each 5-fold dilution of 3444b LPS + IL-4 cDNA results in an ~50% reduction in PCR signal for both the endogenous and transgene (Fig. 4A
). Hence, the difference in stable RNA expression between lines 4503 and 4507 is much greater than the signals in Fig. 3
(A) would suggest. Using the various dilution series in Fig. 4
as a guide, we estimate that T-depleted, LPS + IL-4-treated splenocytes from line 4503 express at least 125-fold more transgenic RNA than similar cells from line 4507. This is in spite of the fact that line 4507 has more copies of the transgene.
|
We confirmed that RNAs from both the endogenous gene and from the 4.4 kb transgene with Site II (line 3444b) are dramatically induced in cells treated with LPS + IL-4 compared to those treated with LPS alone (Fig. 4A
|
|
In T-depleted splenocytes treated with CD40L, we often observed greater than expected transgene expression, using RNA expression from the endogenous gene as a standard. For example, in line 4503 T-depleted splenocytes, we observed more RNA expression from the endogenous gene in cells treated with LPS + IL-4 than in cells treated with CD40L. The signal for amplified endogenous RNA was less from CD40L-treated cells at equal cDNA dilutions and the signal was lost at a lower dilution than the signal for LPS + IL-4 treated cells (Fig. 4C
1 transgene expression.
In normal cells, the
1 gene is expressed only in B cells, with no other tissue producing detectable amounts of the transcript (25,39). Tissue specificity was also observed in mice containing other
1 transgenes (25,26). We tested tissues from mice of each of the transgenic lines and found that the 4.1 kb transgene without Site II was expressed only in B cells. As examples, we show that the transgene in lines 4503 and 3383 is not expressed in other tissues (Fig. 5
).
We have reported that the quantity of stable transcripts from the 4.4 kb transgene with Site II has been too small to detect by S1 nuclease protection (26). Our RT-PCR results suggested that the transgenes in lines 4503 and 3383 were expressed at higher levels than the 4.4 kb transgene with Site II. We performed S1 protection assays on 4503 and 3383 RNA samples to determine if they are detectable by this method. For the digest, we used a probe that includes much of the CH3 exon and part of the CH2 exon. Transcripts from the 4.1 kb transgenes without Site II lack CH2 and are only able to protect the CH3 portion of the probe (Fig. 6
, bottom). RNA from 3383 transgenic B cells treated with LPS alone protected a very small amount of 361 bp fragment (Fig. 6
, lane 8). However, the quantity of 361 bp protection is increased by treatment of B cells with LPS + IL-4 (Fig. 6
, lane 9). This indicates the induction of germline transcripts from the endogenous gene (57). In addition, transgenic transcripts, indicated by protection of a 325 bp fragment, are induced by LPS + IL-4 relative to LPS alone (Fig. 6
, lanes 8 and 9). Transgenic transcripts are expressed in very small quantities, or not at all, in thymocytes treated with concanavalin A alone (lane 11) or concanavalin A + IL-4 (Fig. 6
, lane 12). The faint bands of protection we sometimes observe, for both the endogenous and transgenes, may be the result of interaction of contaminating B cells with activated thymocytes.
In line 3383 transgenic B cells treated with CD40L-expressing Sf9 cells, the 361 bp protection corresponding to endogenous
1 is less than that from LPS + IL-4-treated cells, even though the amount of total RNA tested, as estimated by actin protection, is slightly more in the CD40L-treated sample (Fig. 6
, lanes 9 and 10). However, the amount of 325 bp fragment protection corresponding to transgenic transcripts from line 3383 cells is similar to that of cells treated with LPS + IL-4 (Fig. 6
, lanes 9 and 10). Thus, the level of transgenic RNA expression is greater than that of the endogenous gene in cells treated with CD40L. The RNA expression of other
1 transgenes that retain Site II parallels the endogenous gene more closely. Transgenic RNA expression in cells treated with CD40L is less than that in cells treated with LPS + IL-4 (25).
Expression of another line (4503) with the 4.1 kb transgene lacking Site II yielded virtually identical results. Transgenic RNA expression is induced by LPS + IL-4 (Fig. 6
, lanes 3 and 4). Taking into account the significant difference in actin protection, the expression from the endogenous gene is less in CD40L-treated cells compared to LPS + IL-4-treated cells. However, expression from the transgene is about the same in the two treatments (Fig. 6
, lanes 4 and 5). Neither the transgene nor the endogenous genes are expressed to a significant level in activated thymocytes (Fig. 6
, lanes 6 and 7). Likewise, using an I
1 probe that detects both endogenous and transgenic transcripts, expression of
1 germline transcripts is not detected in activated thymocytes (Fig. 6
, bottom, lanes 6 and 7).
| Discussion |
|---|
|
|
|---|
Importance of the
1 promoter/I region (Site I)Deletional studies of the endogenous gene (35,49) and transfection:reporter gene studies (37,38) have demonstrated the importance of the promoter region/I
1 exon in production of germline transcripts and switch recombination. Our results are consistent with a central role of the promoter region in the regulation of
1 gene expression. The 4.1 kb transgenes that lack Site II include only the promoter region, I exon, and a set of 49 bp repeats that resemble the S
1 region. These transgenes retain many of the regulatory characteristics of the endogenous locus: they are induced by IL-4 (Figs 4 and 6
1 gene. The location of these protein complexes in the promoter region correlates with DNase hypersensitive Site I (27,28). On the other hand, switch recombination of loci that lack the promoter region and part of the I exon is still induced to some extent by IL-4 (36,49). This may reflect a role for the Stat6 site in Site II (26) in IL-4 induction of the endogenous gene. This role may be revealed by the insertion site in line 4472. Preliminary results indicate that transgenic RNA expression in line 4472 cells is not induced by IL-4.
Modulation of the amount of CD40L-induced RNA by Site II
Relative to the endogenous gene, we observed increased induction of transgenic RNA expression in CD40L-treated cells (Figs 4 and 6![]()
). This is, to a large extent, independent of insertion site. Four of five lines tested demonstrate greater than expected expression after treatment of cells with CD40L and line 4507 is difficult to evaluate, given its overall low level of expression. The CD40L-induced expression of other
1 transgenes with Site II parallels the endogenous gene more closely (Fig. 4A
) (39). Hence, elements in Site II apparently participate in negative regulation of the quantity of transcripts after induction by CD40 ligation. When these elements are not present in the 4.1 kb transgene lacking Site II, the amount of stable transcripts after CD40 ligation is greater than predicted by the induction of the endogenous gene.
Site II and the
1 LCR-like function
The 4.1 kb transgene without Site II is influenced strongly by insertion site. All transgenes that include both DNase I hypersensitive Site I and Site II, in addition to other promoter region elements and the I exon, are insertion site independent and copy number dependent. This includes three founder lines with the wild-type, 17 kb
1 gene (25), two founder lines with the 17 kb
1 gene attached to a VDJµ
gene segment (50), three founder lines with a deletion of most of the C region (25 and unpublished), three founder lines with deletion of the S
1 region (26), and four founder lines with deletion of both the S
1 region and the C region (26). These cumulative results are exemplified by the data in Fig. 3
(B). In contrast, transgenic transcription of the transgenes in the founder lines lacking Site II are dependent on insertion site and show no correlation with copy number (Fig. 3A
). These results demonstrate an important function for DNase hypersensitive Site II in the LCR-like activities of the murine
1 gene. Transgenes that lack Site II lack LCR activity.
In addition to Site II, the 4.1 and 4.4 kb transgenes differ in splice acceptor/poly(A) addition site. The 4.1 kb transgene lacking Site II utilizes the CH3 exon for splicing to the I exon and for poly(A) addition. The 4.4 kb transgene utilizes a 200 bp cassette with an adenovirus splice acceptor site attached to an SV40 poly(A) addition site (51). It is formally possible that the excess expression in lines 3383 and 4503 could be explained by more efficient splicing and/or poly(A) addition by the CH3 exon. A priori, this should not be the case. We have previously used the CH3 exon, with no evidence for extraordinary RNA expression (25 and unpublished). The adenovirus splice acceptor site/SV40 poly(A) addition site combination obeys all consensus sequence requirements and is known to act efficiently in studies of RNA splicing/poly(A) addition (51). Finally, one would expect post-transcriptional effects to be independent of insertion site. If the CH3 cassette were spliced and polyadenylated very efficiently, all founder lines with the 4.1 kb transgene lacking Site II (but with the CH3 cassette) should express stable transcripts in large quantity.
Taking together deletional analyses presented here and elsewhere, we would propose that production of
1 germline transcripts results from interactions of elements in four different regions: the S region, the I exon splicing signals, the promoter region (Site I) and Site II. Deletion of the S
1 region from transgenes does not change the IL-4 inducibility of RNA production, but does alter its level (26). Deletion of the I
1 exon splice site apparently has an effect on switch recombination, but also changes RNA expression levels dramatically (36). The promoter region probably has a dominant functional role, but deletional analysis in vivo has not separated enhancement of RNA production from loss of transcription start sites (35). In this study we showed that loss of Site II does not alter IL-4 inducibility (at least in an obvious way), but does eliminate the insertion site independence of
1 transgenes (Fig. 3A
). The LCR activity within the
1 gene, detected by transgenic analysis, is likely to have a role in the endogenous gene. First, Site II may be a part of the
1 LCR-like activity that gives it independence from the 3' heavy chain LCR (12,2325). RNA expression from the two genes,
3 and
2b, that flank
1 is down-regulated by IL-4 (5254), and RNA expression from
3 is up-regulated by IFN-
(55). LCR-like functions, provided in part by Site II, might allow
1 gene expression independent of the influence of its `insertion site' in the endogenous gene. It is interesting to suggest that the protein interactions that bring together the promoter region, splice site, Site II and switch region to result in optimal RNA production also optimize switch recombination in the switch region.
| Acknowledgments |
|---|
We thank Scott Cole, Joby Morrow and Xi Xi Wang for assistance in these studies, and the Transgenic Animal Core of the University of Michigan Biomedical Research Core Facilities for assistance in preparing transgenic mice. Drs Lathe Claflin and Malini Raghavan made several helpful comments on the manuscript. This work was supported by a grant from the National Cancer Institute, CA39068. Transgenic Core support was provided by The University of Michigan Cancer Center, NIH grant CA46592.
| Abbreviations |
|---|
| CD40L CD40 ligand |
| I exon 5'-most exon of heavy chain germline transcripts |
| LCR locus control region |
| LPS lipopolysaccharide |
S 1 switch region associated with the 1 gene |
| Notes |
|---|
The first two authors contributed equally to this work
Transmitting editor: K. Knight
Received 18 August 2000, accepted 6 September 2000.
| References |
|---|
|
|
|---|
- Stavnezer-Nordgren, J. and Sirlin, S. 1986. Specificity of immunoglobulin heavy chain switch correlates with activity of germline heavy chain genes prior to switching. EMBO J. 5:95.[Web of Science][Medline]
- Yancoupoulos, G. D., DePinho, R. A., Zimmerman, K. A., Lutzker, S. G., Rosenberg, N. and Alt, F. W. 1986. Secondary rearrangement events in pre-B cells: VHDJH replacement by a LINE-1 sequence and directed class switching. EMBO J. 5:3259.[Web of Science][Medline]
- Coffman, R. L., Lebman, D. A. and Rothman, P. 1993. The mechanism and regulation of immunoglobulin isotype switching. Adv. Immunol. 54:229.[Web of Science][Medline]
- Stavnezer, J. 1996. Antibody class switching. Adv. Immunol. 161:79.
-
Stavnezer, J., Radcliffe, G., Lin, Y.-C., Nietupski, J., Berggren, L., Sitia, R. and Severinson, E. 1988. Immunoglobulin heavy-chain switching may be directed by prior induction of transcripts from constant-region genes. Proc. Natl Acad. Sci. USA 85:7704.
[Abstract/Free Full Text] -
Esser, C. and Radbruch, A. 1989. Rapid induction of transcription of unrearranged S
1 switch regions in activated murine B cells by interleukin 4. EMBO J. 8:483.[Web of Science][Medline]
-
Berton, M. T., Uhr, J. W. and Vitetta, E. S. 1989. Synthesis of germ-line
1 immunoglobulin heavy-chain transcripts in resting B cells: Induction by interleukin 4 and inhibition by interferon
. Proc. Natl Acad. Sci. USA 86:2829.[Abstract/Free Full Text] -
Layton, J. E., Vitetta, E. S., Uhr, J. W. and Krammer, P. H. 1984. Clonal analysis of B cells induced to secrete IgG by T-cell derived lymphokines. J. Exp. Med. 160:1850.
[Abstract/Free Full Text] - Iwasota, T., Shimizu, A., Honjo, T. and Yamagishi, H. 1990. Circular DNA is excised by immunoglobulin class switch recombination. Cell 62:143.[Web of Science][Medline]
- Matsuoka, M., Yoshida, K., Maeda, T., Usuda, S. and Sakano, H. 1990. Formation of switch circular DNA in cytokine treated mouse splenocytes: Evidence for intramolecular DNA deletion in immunoglobulin class switch. Cell 62:135.[Web of Science][Medline]
-
Madisen, L. and Groudine, M. 1994. Identification of a locus control region (LCR) in the immunoglobulin heavy chain locus that deregulates c-myc expression in plasmacytoma and Burkitt's lymphoma cells. Genes Dev. 8:2212.
[Abstract/Free Full Text] - Cogne, M., Lansford, R., Bottaro, A., Zhang, J., Gorman, J., Young, F., Cheng, H.-L. and Alt, F. W. 1994. A class switch control region at the 3'end of the immunoglobulin heavy chain locus. Cell 77:737.[Web of Science][Medline]
-
Giannini, S. L., Singh, M., Calvo, C.-F., Ding, G. and Birshtein, B. K. 1993. DNA regions flanking the mouse Ig 3'
enhancer are differentially methylated and DNase I hypersensitive during B cell differentiation. J. Immunol. 150:1772.[Abstract]
-
Michaelson, J. S., Giannini, S. L. and Birshtein, B. K. 1995. Identification of 3'
-HS4, a novel Ig heavy chain enhancer element regulated at multiple stages of B cell differentiation. Nucleic Acids Res. 23:975.[Abstract/Free Full Text] -
Saleque, S., Singh, M., Little, R. D., Giannini, S. L., Michaelson, J. S. and Birshtein, B. K. 1997. Dyad symmetry within the mouse 3' Igh regulatory region includes two virtually identical enhancers (C
3'E and hs3). J. Immunol. 158:4780.[Abstract]
- Pettersson, S., Cook, G. P., Bruggemann, M., Williams, G. and Neuberger, M. S. 1990. A second B cell specific enhancer 3' of the immunoglobulin heavy-chain locus. Nature 344:165.[Medline]
- Dariavach, P., Williams, G. T., Campbell, K., Pettersson, S. and Neuberger, M. S. 1991. The mouse IgH 3' enhancer. Eur. J. Immunol. 21:1499.[Web of Science][Medline]
-
Lieberson, R., Giannini, S. L., Birshtein, B. K. and Eckhardt, L. A. 1991. An enhancer at the 3' end of the mouse immunoglobulin heavy chain locus. Nucleic Acids Res. 19:933.
[Abstract/Free Full Text] -
Mattias, P. and Baltimore, D. 1993. The immunoglobulin heavy chain locus contains another B-cell specific 3' enhancer close to the
constant region. Mol. Cell. Biol. 13:1547.[Abstract/Free Full Text] -
Ong, J., Stevens, S., Roeder, R. G. and Eckhardt, L. A. 1998. 3'IgH enhancer elements shift synergystic interactions during B-cell development. J. Immunol. 160:4896.
[Abstract/Free Full Text] - Chauveau, C., Pinaud, E. and Cogne, M. 1998. Synergies between regulatory elements of the immunoglobulin heavy chain locus and its palindromic 3' locus control region. Eur. J. Immunol. 28:3048.[Web of Science][Medline]
- Arulampalam, V., Grant, P. A., Samuelsson, A., Lenhahl, U. and Pettersson, S. 1994. Lipopolysaccharide-dependent transactivation of the temporally regulated immunoglobulin heavy chain 3' enhancer. Eur. J. Immunol. 24:1671.[Web of Science][Medline]
-
Manis, J. P., van der Stoep, N., Tian, M., Ferrini, R., Davidson, L., Bottaro, A. and Alt, F. W. 1998. Class switching in B cells lacking 3' immunoglobulin heavy chain enhancers. J. Exp. Med. 188:1421.
[Abstract/Free Full Text] -
Seidl, K. J., Manis, J. P., Bottaro, A., Zhang, J., Davidson, L., Kisselgof, A., Oettgen, H. and Alt, F. W. 1999. Position-dependent inhibition of class-switch recombination by PGK-neor cassettes inserted into the immunoglobulin heavy chain constant region locus. Proc. Natl Acad. Sci. USA 96:3000.
[Abstract/Free Full Text] -
Elenich, L. A., Ford, C. S. and Dunnick, W. A. 1996. The
1 heavy chain gene includes all the cis-acting elements necessary for expression of properly regulated germline transcripts. J. Immunol. 157:176.[Abstract]
-
Cunningham, K., Ackerly, H., Alt, F. and Dunnick, W. 1998. Potential regulatory elements for germline transcription in or near murine S
1. Int. Immunol. 10:527.[Abstract/Free Full Text] -
Schmitz, J. and Radbruch, A. 1989. An interleukin 4-induced DNase I hypersensitive site indicates opening of the
1 switch region prior to switch recombination. Int. Immunol. 1:570.[Abstract/Free Full Text] -
Berton, M. T. and Vitetta, E. S. 1990. Interleukin 4 induces changes in the chromatin structure of the
1 switch region in resting B cells before switch recombination. J. Exp. Med. 172:375.[Abstract/Free Full Text] -
Kotanides, H. and Reich, N. C. 1993. Requirement of tyrosine phosphorylation for rapid activation of a DNA binding factor by IL-4. Science 262:1265.
[Abstract/Free Full Text] -
Berton, M. T. and Linehan, L. A. 1995. IL-4 activates a latent DNA-binding factor that binds a shared IFN-
and IL-4 response element present in the germ-line
1 Ig promoter. J. Immunol. 154:4513.[Abstract]
-
Lin, S. and Stavnezer, J. 1996. Activation of NF-
B/Rel by CD40 engagement induces the mouse germline immunoglobulin C
1 promoter. Mol. Cell. Biol. 16:4591.[Abstract/Free Full Text] -
Warren, W. D., Roberts, K. L., Linehan, L. A. and Berton, M. T. 1999. Regulation of the germline immunoglobulin C
1 promoter by CD40 ligand and IL-4: dual role for tandem NF-
B binding sites. Mol. Immunol. 36:31.[Web of Science][Medline]
-
Williams, M. and Maizels, N. 1991. LR1, a lipopolysaccharide-responsive factor with binding sites in the immunoglobulin switch regions and heavy-chain enhancer. Genes Dev. 5:2353.
[Abstract/Free Full Text] -
Lundgren, M., Larsson, C., Femino, A., Xu, M., Stavnezer, J. and Severinson, E. 1994. Activation of the Ig germ-line
1 promoter. Involvement of C/enhancer-binding protein transcription factors and their possible interaction with an NF-IL-4 site. J. Immunol. 153:2983.[Abstract]
- Jung, S., Rajewsky, K. and Radbruch, A. 1993. Shutdown of class switch recombination by deletion of a switch region control element. Science 259:984.[Abstract]
-
Lorenz, M., Jung, S. and Radbruch, A. 1995. Switch transcripts in immunoglobulin class switching. Science 267:1825.
[Abstract/Free Full Text] -
Xu, M. and Stavnezer, J. 1992. Regulation of transcription of immunoglobulin germ-line
1 RNA: analysis of the promoter/enhancer. EMBO J. 11:145.[Web of Science][Medline]
-
Warren, W. and Berton, M. T. 1995. Induction of germ-line
1 and
Ig gene expression in murine B cells: interleukin 4 and the CD40 ligandCD40 interaction provide distinct but synergistic signals. J. Immunol. 155:5637.[Abstract]
-
Elenich, L. A., Ford, C. S., Collins, J. T. and Dunnick, W. A. 1997.
1 heavy chain transgenes are responsive to IFN-
repression and CD40 ligation. J. Immunol. 158:4564.[Abstract]
-
Xu, M. and Stavnezer, J. 1990. Structure of germline immunoglobulin heavy-chain
1 transcripts in interleukin 4 treated mouse spleen cells. Dev. Immunol. 1:11.[Medline]
- Hogan, B., Constantini, F. and Lacy, E. 1986. Manipulating the Mouse Embryo: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
-
Coffman, R. L. and Carty, J. 1986. A T cell activity that enhances polyclonal IgE production and its inhibition by interferon-
. J. Immunol. 136:949.[Abstract]
- Chomczynski, P. and Sacchi, N. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanatephenolchloroform extraction. Anal. Biochem. 162:156.[Web of Science][Medline]
-
Lopata, M. A., Cleveland, D. W. and Sollner-Webb, B. 1984. High-level expression of a chloramphenicol acetyltransferase gene by DEAEdextran-mediated DNA transfection coupled with a dimethylsulfoxide or glycerol shock treatment. Nucleic Acids Res. 12:5707.
[Abstract/Free Full Text] - Glimcher, L. H., Hamano, T., Asofsky, R., Heber-Katz, E., Schwartz, R. H. and Paul, W. E. 1982. I region-restricted antigen presentation by B cellB cell lymphoma hybridomas. Nature 298:283.[Medline]
- Schindler, C., Kashleva, H., Pernis, A., Pine, R. and Rothman, P. 1994. STF-IL4: a novel IL-4 induced signal transducing factor. EMBO J. 13:1350.[Web of Science][Medline]
-
Aronow, B. J., Silbiger, R. N., Dusing, M. R., Stock, J. L., Yager, K. L., Potter, S. S., Hutton, J. J. and Wiginton, D. A. 1992. Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression. Mol. Cell. Biol. 12:4170.
[Abstract/Free Full Text] - Ganss, R., Montoliu, L., Monaghan, A. P. and Schutz, G. 1994. A cell-specific enhancer far upstream of the mouse tyrosinase gene confers high level and copy number-related expression in transgenic mice. EMBO J. 13:3083.[Web of Science][Medline]
-
Hein, K., Lorenz, M. G. O., Siebenkotten, G., Petry, K., Christine, R. and Radbruch, A. 1998. Processing of switch transcripts is required for targeting of antibody class switch recombination. J. Exp. Med. 188:2369.
[Abstract/Free Full Text] -
Cunningham, K., Ackerly, H., Claflin, L., Collins, J., Wu, P., Ford, C., Lansford, R., Alt, F. and Dunnick, W. A. 1998. Germline transcription and recombination of a murine VDJµd
1 transgene. Int. Immunol. 10:1027.[Abstract/Free Full Text] - Niwa, M., Rose, S. D. and Berget, S. M. 1990. In vitro polyadenylation is stimulated by the presence of an upstream intron. Genes Dev. 4:1152.
-
Lutzker, S., Rothman, P., Pollock, R., Coffman, R. and Alt, F. W. 1988. Mitogen- and IL-4-regulated expression of germ-line Ig
2b transcripts: evidence for directed heavy chain class switching. Cell 53:177.[Web of Science][Medline]
-
Rothman, P., Lutzker, S., Gorham, B., Stewart, V., Coffman, R. and Alt, F. W. 1990. Structure and expression of germline immunoglobulin
3 heavy chain gene transcripts: Implications for mitogen and lymphokine directed class-switching. Int. Immunol. 2:623.
- Severinson, E., Fernandez, C. and Stavnezer, J. 1990. Induction of germ-line immunoglobulin heavy chain transcripts by mitogens and interleukins prior to switch recombination. Eur. J. Immunol. 20:1079.[Web of Science][Medline]
-
Snapper, C. M., McIntyre, T. M., Mandler, R., Pecanha, L. M., Finkelman, F. D., Lees, A. and Mond, J. J. 1992. Induction of IgG3 secretion by interferon
: a model for T cell-independent class switching in response to T cell-independent Type 2 antigens. J. Exp. Med. 175:1367.[Abstract/Free Full Text] -
Mowatt, M. R. and Dunnick, W. A. 1986. DNA sequence of the murine
1 switch segments reveals novel structural elements. J. Immunol. 136:2674.[Abstract]
-
Tyler, B. M., Cowman, A. F., Gerondakis, S. D., Adams, J. M. and Bernard, O. 1982. mRNA for surface immunoglobulin
chains encodes a highly conserved transmembrane sequence and a 28-residue intracellular domain. Proc. Natl Acad. Sci. USA 79:2008.[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
M. Samara, Z. Oruc, H.-L. Dougier, T. Essawi, M. Cogne, and A. A. Khamlichi Germ line transcription in mice bearing neor gene downstream of I{gamma}3 exon in the Ig heavy chain locus Int. Immunol., April 1, 2006; 18(4): 581 - 589. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Li, K. R. Peterson, X. Fang, and G. Stamatoyannopoulos Locus control regions Blood, October 16, 2002; 100(9): 3077 - 3086. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







