International Immunology, Vol. 12, No. 11, 1613-1622,
November 2000
© 2000 Japanese Society for Immunology
NKT lymphocyte ontogeny and function are impaired in low antibody-producer Biozzi mice: gene mapping in the interval-specific congenic strains raised for immunomodulatory genes
INSERM U255, Institut Curie, 75248 Paris Cedex 05, France
1 INSERM U25 and Centre Claude Bernard, Hôpital Necker, 161 rue de Sèvres 75743 Paris Cedex 15, France
2 Pharmaceutical Research Laboratory, Kirin Brewery Co, Takasaki-shi, 370-1295 Gunma, Japan
Correspondence to: A. Herbelin
| Abstract |
|---|
|
|
|---|
NKT cells are CD4+ or CD4CD8 CD1d-restricted lymphocytes, characterized by the property to rapidly produce IL-4 and IFN-
in response to TCR ligation. This IL-4 burst is lacking in autoimmunity-prone SJL and NOD strains of mice, which suggests an immunoregulatory role for NKT cells. The NKT cell status was thus investigated in the genetically selected high (H) and low (L) antibody-producer mice. The results show that (i) the frequency of cells expressing the NKT cell markers is 3- to 4-fold lower in thymus and spleen from L than H mice, (ii) L mice spleen cells did not produce IL-4 following injection of anti-TCR
ß antibody, and (iii) L mice thymus and spleen cells failed to produce IL-4 after in vitro stimulation by anti-TCR
ß antibody or
-galactosylceramide, a newly described NKT cell ligand. These parameters were investigated in six interval-specific congenic strains raised for the quantitative trait loci which contain the immunomodulatory genes responsible for the high/low antibody production phenotypes. IL-4 production recovery occurred only in the congenic strain in which the H origin chromosome 4 segment was introgressed on the L background. This finding was not due to increased NKT cell frequency but appeared dependent of antigen-presenting cells in co-culture experiments. This result strongly suggests the presence of gene(s) modulating NKT function on chromosome 4, close to several genes predisposing to autoimmunity.
Keywords: antigen-presenting cell, Biozzi mice, gene mapping, IL-4, NKT cell
| Introduction |
|---|
|
|
|---|
NKT cells are a lymphoid lineage distinct from mainstream T, B and NK cells on the basis of unique phenotype and functional properties (for review, see 1). These cells express the NK1.1 polymorphic marker originally assumed to be specific for NK cells and most of them express a unique TCR
chain derived from the V
14J
281 gene rearrangement paired with a Vß8 TCR ß chain in mice (16) or the homologous V
24J
Q/Vß11 in humans (79). NKT cells are positively selected by the non-polymorphic MHC class I-like molecule CD1d (1012) and exhibit a high frequency of autoreactivity to CD1d (13). Functionally they are able to explosively release key cytokines such as IL-4 and IFN-
upon TCR engagement (1418) which may explain their putative role in infectious diseases (19), tumor rejection (2023) and autoimmune conditions (2427). Although the early IL-4 response observed in the spleen of mice following i.v. injection of anti-CD3 antibody can be ascribed to NKT cells (18), little is known about the corresponding physiological stimulus. Recently,
-galactosylceramide (
-GalCer), originally isolated from marine sponge, was found to specifically stimulate most V
14J
281/Vß8 T cells in a CD1d-restricted fashion (2830), suggesting that these cells might recognize a single family of self-glycolipids. Low NKT cell numbers associated with defective early IL-4 response to anti-CD3 challenge were observed in two mouse strains: NOD (2633) and SJL. In the later the phenotype was claimed to be under a two-locus regulation (32). As expected this IL-4 response is lacking in CD1d-deficient as well as in ß2-microglobulin-deficient (ß2m/) mice (1012, 26,3335), both deprived of NKT cells. Yet, this defect does not prevent Th2/IL-4 responsiveness to some strong challenges. A new opportunity to study the genetic control of NKT cell function was provided by our finding that the L strain of Biozzi mice (selected for low antibody production) did not produce IL-4 after anti-CD3 administration, whereas their high antibody-producer counterparts (H line) did. The H and L responder lines have been developed over the last two decades by Biozzi et al. (36,37) by bi-directional selective breeding. This model has a strong biologic significance inasmuch as the large phenotypic difference between H and L mice is multispecific (i.e. not restricted to the antigen and immunization route used for the selection phenotype) (38), which focused our attention to non-specific regulatory mechanisms of antibody productioncytokine production in particular.
Variance analysis indicated that the H/L difference was contributed by the additive effect of genes at several independently segregating loci (39). These genes, called immunomodulatory (Im) genes, have been localized by a genome-wide screening in several quantitative trait loci (QTL) on distinct chromosomes (40,41) and recently an interval-specific congenic strain (ISCS) was obtained for each QTL as recommended for dissection of complex gene interactions (42). The ISCS bear individual Im-containing chromosomal segments of H origin on a similar genetic background very close to that of L mice. The comparative study in these ISCS lines of discrete phenotypes, either suspected or known to contribute to the H/L status, can directly identify the QTL(s) containing the relevant gene(s).
The finding of a totally defective IL-4 response to anti-CD3 challenge in L mice prompted us to investigate this response in ISCS. In fact, among six ISCS lines tested, only the one bearing the chromosome 4 Im gene-containing segment issued from the H line (LcH4) had an improved IL-4 response to anti-CD3 challenge. Both phenotype and functional parameters of the NKT cell compartment were analyzed in the thymus and the spleen of H, L and LcH4 lines; the NKT cell function was directly evaluated by studying in vitro IL-4 response to TCR ligation and to
-GalCer.
| Methods |
|---|
|
|
|---|
Mice
Sex- and age (5- to 9-week-old)-matched groups of H and L antibody responder mice congenic for H-2s haplotype, and ISCS strains were used. All mice were bred under specific pathogen-free conditions in the animal facilities of the Curie Institute.
Breeding of ISCS
ISCS for each Im gene-containing QTL were obtained through three or four consecutive marker-assisted backcrosses towards the L line. This strategy speeds up obtaining nearly congenic mice (speed congenic strains) (43). Briefly, all the progenitors were genotyped for the polymorphism markers (microsatellites) identifying the H or L origin of the Im-containing QTL (40). At each consecutive backcross, the choice of the parents was carried out not only to maintain the H line allele (h) at the QTL to be fixed, as usually, but also to progressively exclude h alleles at the other QTL. In that way, a single h-Im-QTL could be transmitted to the progeny after only three or four backcrosses. The ISCS founding pairs (h/h homozygotes) were then selected from an intercross progeny. These mice have a genetic background constituted of 94 or 97% of the L line genome (97% in the case of LcH4 bred after four backcrosses).
The ISCS were established, on the basis of a previous QTL localization for the presence or absence of h alleles at D4Mit31 and D4Mit40 (located at 51 and 59 cM respectively) on chromosome 4; the microsatellites defining the other ISCS are located at 25, 30 and 35 cM on chromosome 6; 6, 33 and 41 cM and 59 and 71 cM on chromosome 8; 65 cM on chromosome 10, and 2 and 17 cM on chromosome 18, as reported (41). The ISCS were named LcH (low congenic to high) followed by the chromosome number (and the QTL distance from the centromere for the two QTL on chromosome 8): LcH4, LcH6, LcH8-20, LcH8-60, LcH10 and LcH18. ISCS for the chromosome 12 Igh locus could not be obtained. In fact, the L line background is constantly associated with a low fertility rate.
-GalCer
-GalCer (KRN 7000) (44) used for this study was synthesized by the Pharmaceutical Research Laboratories (Kirin Brewery, Gunma, Japan). The preparation had a single dominant peak of the expected mol. wt by electrospray mass spectrometry, ruling out the presence of significant amounts of degradation products. The stock solution (10 µg/ml in 10% DMSO) was diluted into culture medium to a 100 ng/ml final concentration. A control 0.1% DMSO vehicle solution was tested in parallel with the glycolipid.
Immunization and measurement of antibody titers
Groups of 10 mice received one i.v. injection of 5x108 sheep erythrocytes per mouse and a booster given on day 28. Individual blood samples were collected on days 14 of primary and 10 of secondary responses. Antibody titers were measured by an agglutinin assay and expressed as log2.
In vivo induction of IL-4 burst
Mice were injected by i.v. route with 24 µg/mouse of anti-CD3 mAb (clone 145-2C11) in a final volume of 200 µl. Control mice were injected with the same amount of irrelevant hamster IgG. At 90 min following injection, mice were sacrificed and spleens removed for mRNA expression analysis or culture settings.
Antibody and FACS analysis
Anti-CD8 (clone 53.6.7), anti-TCR
ß (clone H57-597), anti-Vß8 (clone F23.1), anti-CD24 (anti-mouse HSA, clone J11d) and anti-CD3 (clone 145-2C11) mAb were purified and fluoresceinated and/or biotinylated in our laboratory. Biotinylated anti-CD62L (clone MEL-14) was kindly provided by F. Lepault (CNRS URA 1461, Institut Necker, Paris, France). Allophycocyaninanti-CD4 (clone RM4.5), phycoerythrinanti-CD24 (anti-HSA, clone M1/69), FITC and biotinanti-CD44 (clone 1M7.8), and phycoerythrinanti-CD122 (anti-IL-2Rß, clone Tmß-1) mAb were obtained from PharMingen (San Diego, CA). Four-color staining was performed as described previously (26,34,45). Control staining with irrelevant antibody was always performed in parallel. A FACSCalibur cytometer (Becton Dickinson, Mountain View, CA) was used. A minimum of 5x104 events gated on viable cells were acquired with CellQuest software. Results were analyzed using Mac CellQuest software. Each analytical gate was at least 1x103 events.
Cell preparation
Thymuses and spleens were carefully removed from exsanguinated mice. Thymuses from two to four mice of each group were pooled. Double-negative and CD4+ mature thymocytes were enriched by treating freshly isolated thymocytes with the IgM antibody 3-155 (rat anti-mouse CD8) and J11d (rat anti-mouse HSA, anti-HSA) plus C killing (Low-Tox rabbit C; Cedarlane, Hornby, Ontario, Canada) at 37°C for 40 min (26). Purity of the HSACD8 thymocyte preparation was checked by staining the cells with phycoerythrinanti-HSA (clone M.1/69) and FITCanti-CD8 (clone 53.6.7). The preparation in either case contained >95% of HSACD8 cells as assessed by flow cytometry re-analysis. Enrichment of splenocytes for CD4+ T cells was performed as reported (45). Briefly, spleen cell suspensions were prepared using a homogenizer and red blood cells were lysed in an hemolyse buffer. Spleen cell suspensions were incubated for 45 min with anti-CD4-coated magnetic beads (Miltenyi Biotech, Bergisch- Gladbach, Germany) and positively sorted on a MACS positive selection column as described (45). Purity of enriched CD4+ cell fractions was always >92%.
In vitro cultures and IL-4 production
RPMI 1640 Glutamax culture medium (Gibco/BRL, Life Technologies, Cergy Pontoise, France) supplemented with 10% FCS (Techgen, Les Ulis, France), 0.05 mM ß2-mercaptoethanol, 100 IU/ml penicillin and 100 µg/ml streptomycin was used for all cell cultures. Enriched HSACD8 thymic cells or CD4+ splenocytes were plated in triplicate (2x105/well; 200 µl final volume) in 96-well round-bottomed microplates (Nunc, Roskilde, Denmark) and incubated with immobilized anti-TCR
ß (clone H57-597) or soluble
-GalCer (100 ng/ml) for 60 h in the presence or absence of APC [autologous or heterologous
-irradiated (2500 rad) unseparated spleen cells at 5x105/well]. For control, APC cultures were set either without responding T cells or in the absence of T cell stimulation (anti-TCR
ß mAb coating or
-GalCer omitted).
Neither significant proliferation nor cytokine production was detected in control wells. The supernatants were harvested 60 h later and stored at 70°C until IL-4 assay, and wells were further completed with medium and pulsed for 78 h with 1 mCi of [3H]thymidine (5 Ci/mM; Amersham, Little Chalfont, UK). Cells were then harvested and thymidine uptake was assessed (26,34). Spleen cells (1x107/well) obtained from anti-CD3 or control IgG-treated mice were cultured in 24-well plates (Falcon; Becton Dickinson) without additional stimuli for 4 h or with immobilized anti-CD3 antibody (5 µg/ml) for 24 h.
Analysis of IL-4 mRNA expression
Total RNA was isolated from spleen and prepared with RNA Plus (Quantum-Bioprobe, Montreal, Canada), following the manufacturer's instructions. The semi-quantitative RT-PCR technique was used to compare the levels of mRNA encoding for IL-4, relative to the ubiquitary reporter gene ß2m using standard methods. Reverse transcription was performed using 1 µg of total RNA in 20 µl reaction mixture containing 1xRT buffer, dNTP mix (1 mM) (Pharmacia, Uppsala, Sweden), 2.5 mM MgCl2, oligo-p(dT) (1.6 µg), 50 U ribonuclease inhibitor and 20 U AMV-RT (Boehringer, Mannheim, Germany). The samples were incubated for 15 min at 25°C and then 60 min at 42°C, and the reaction was stopped by heating at 95°C for 5 min. Samples were then stored at 20°C until use. PCR reactions were run for 25 or 30 cycles using a solid block thermal-PTC-100 (MJ Research, Watertown, MA) in a final volume of 25 µl containing 1xPCR buffer (Quantum-Bioprobe), dNTP (10 µM) (Pharmacia), 0.2 µM of each primer and 0.5 U Taq DNA polymerase (Quantum-Bioprobe). PCR conditions were: initial denaturation at 94°C for 3 min, denaturation at 94°C for 0.5 min, annealing at 57 °C for 1 min followed by a final extension step of 10 min at 72°C. The PCR products were separated on a 1.2% agarose gel, visualized with ethidium bromide and quantified using NIH Image 1.62 fat software. Oligonucleotide primers for ß2m and IL-4 were obtained from Pharmacia. The primer sequences were: ß2m sense primer: TGACCGGCTTGTATGCTATC; ß2m anti-sense primer: CAGTGTGAGCCAGGATATATAG; IL-4 sense primer: TCGGCATTTTGAACGAGGTC; IL-4 anti-sense primer: GAAAAGCCCGAAAGAGTCTC.
IL-4 detection
The IL-4 levels in cell cultures were measured using a standard sandwich ELISA with a coated capture mAb (clone 11B11) and with a biotinylated detection mAb (clone BVD6) according to the manufacturer's protocol (PharMingen). Conjugation of streptavidinphosphatase (Jackson ImmunoResearch, West Grove, PE) was revealed using phosphatase substrate (Sigma 104; Sigma, St Louis, MO). The cytokine concentrations were expressed as pg/ml, based on a regression curve established in each assay for recombinant murine IL-4 (R & D Systems, Abingdon, UK). The sensitivity of IL-4 assay was 30 pg/ml.
Statistical test
P values were calculated by Student's t-test. The MannWhitney non-parametric test was used for the significance of mRNA ratios.
| Results |
|---|
|
|
|---|
In vivo induction of IL-4 burst in H and L Biozzi mice
As shown in Table 1
|
The interline difference in early IL-4 gene transcription was confirmed at the protein level, since IL-4 was only detected in supernatants of H mice splenocytes either in 4 h cultures or after in vitro re-stimulation on anti-CD3 mAb-coated plates (Table 1
Screening of ISCS for IL-4 mRNA levels in vivo after anti-CD3 challenge
Among the six congenic (LcH) lines, only LcH4 mice had an IL-4 response which appeared significantly improved compared to L mice but still lower than that of H mice (Fig. 1
). That the LcH4 phenotype may result from polymorphism outside the QTL because of the residual (3%) H origin background genes could be excluded; indeed, within several backcross litters (of the third and the fourth backcross) IL-4 responsiveness was constantly observed in mice heterozygous at chromosome 4 microsatellites and never in homozygous littermates (data not shown).
|
These results demonstrate that the L line defect is mainly due to allele(s) co-localizing with the Im gene on chromosome 4, and support the hypothesis of genetic differences in NKT cell development and/or function.
The LcH4 line was established on the basis of h allele homozygosity at two microsatellites at a distance of ~10 cM (Fig. 2A
). However, the confidence interval of the Im gene location is >10 cM (41). As shown in Fig. 2
(B), this QTL improved significantly antibody responsiveness: antibody titers to sheep erythrocytes were higher in LcH4 than in L mice, 14 days after an optimal primary immunization (the phenotype used for the H and L selection and for Im gene mapping) and also 10 days after boosting.
|
Phenotypic validation of the NKT subset in Biozzi mice
NKT cells comprise both NK1.1 and NK1.1+ T cells (4547). NK1.1+ NKT cells could not be directly identified in L and LcH4 mice because their NK1.1 allele is not recognized by the available mAb (data not shown), as happens in numerous strains of mice (26). However, both NK1.1+ and NK1.1 NKT cells may be defined by their common particular phenotype, i.e. the absence of the CD62L (L-selectin) marker, the presence of the CD44 marker and a low surface density of TCR
ß (CD62LCD44high TCR
ßint) (1). The use of these criteria excludes the chance of underestimating the NKT subset.
Starting from purified HSA- and CD8-depleted thymocytes, we first verified in H, L and LcH4 mice that the population thus defined (HSACD8CD62L or HSACD8CD44high) showed the Vß8 bias typical of NKT cells (see legend of Fig. 3
). In the three tested strains, these cells were also characterized by the expression of CD122 (IL-2Rß chain), a monomorphic marker currently used as an NK1.1 surrogate (48). It was verified that CD122+ cells defined a TCR
ßint Vß8-biased subset (Fig. 3
and Table 2
).
|
|
Altogether, these results identify in H, L and LcH4 mice a discrete T cell subset, similar to NKT cells regarding their phenotype and TCR usage.
Defect in the number of NKT cells in L and LcH4 Biozzi mice
Using the phenotypic markers just described, a pronounced deficit of NKT cells was evidenced in the thymus of L and LcH4 mice in which total numbers of NKT cells were considerably reduced. Indeed, the proportion of CD62LCD122+ TCR
ßint cells (whose Vß8 bias was verified) among HSACD8 thymocytes was ~4-fold lower in L mice compared to H mice (Fig. 3
and Table 2
) while no marked difference was found between L and LcH4 mice. In the two latter strains of mice, the reduction in NKT cells was similar whatever the CD4+ or the double-negative T subset of HSACD8 thymocytes considered (Table 2
).
As shown in Table 2
, the proportion of CD122+ TCR
ßint cells among CD4+ splenocytes was also 3-fold lower in L and LcH4 (0.6 and 0.55% respectively) compared to H mice (1.9%). The CD4+ NKT percentage among the CD122+ Vß8 subset was also significantly reduced in L and LcH4 mice. This finding, confirmed by the estimates of total CD122+ TCR
ßint cell numbers in both thymus and spleen (Table 2
), supports the conclusion of a numeric defect of NKT cells in L and LcH4 mice.
It appears thus that the reversion of IL-4 in vivo response to anti-CD3 challenge occurred in the congenic LcH4 line in spite of an unchanged NKT cell frequency (compared to that of L mice line).
NKT cell-dependent in vitro IL-4 production of H, L and LcH4 Biozzi mice
IL-4 production was measured in 60 h supernatants of HSACD8 thymocyte or CD4+ splenocyte cultures stimulated by immobilized anti-TCR
ß mAb (Fig. 4
) or
-GalCer (Fig. 5
) in the presence or not of autologous irradiated APC. IL-4 amounts in the culture supernatants were found to be higher in H than in L mice and higher in LcH4 than in L mice when cells were stimulated by anti-TCR
ß mAb or
-GalCer in the presence of autologous APC.
|
|
In the absence of autologous APC, IL-4 was only detected in H thymocyte or splenocyte cultures stimulated either with anti-TCR
ß or
-GalCer.
To investigate the possible involvement of APC in the LcH4/L difference, IL-4 production was measured in mixed cell cultures. As shown in Fig. 6
, L mouse APC did not improve IL-4 production by LcH4 cells, whereas addition of LcH4 APC did so for splenocytes and thymocytes from both L and LcH4 mice.
|
| Discussion |
|---|
|
|
|---|
The selective breeding based on responsiveness to primary immunization resulted in the accumulation in H and L Biozzi mice of polymorphic alleles with an opposite modulatory effect on antibody responses.
Importantly, the H and L responder phenotypes apply to antibodies produced against a large variety of antigens as well as to basal serum Ig (which comprise natural antibodies and antibodies directed to environmental antigens) and to all antibody isotypes, especially those known to depend on Th2 profile commitment (IgG1 and IgE) (49 and unpublished observation). H and L mice showed a different IL-4 response to a strong polyclonal anti-TCR stimulation: L mice being quasi-unresponsive to in vivo and in vitro anti-CD3 challenge. The opposite IL-4 response pattern of H and L mice is concordant with their antibody production status assuming that Th2 differentiation positively modulates antibody production.
A regulatory function has recently been attributed to the discrete CD1d-restricted NKT subset, the main IL-4 producers following anti-TCR
ß mAb stimulation in both the thymus (1,16,17,26) and the periphery (18,35,45). Several arguments suggest that deficient IL-4 production in L mice can be attributed to a NKT cell defect: (i) a similar deficiency was observed when
-GalCer, known as a selective NKT cell inducer (2830), was used instead of polyclonal anti-TCR
ß mAb stimulation; (ii) the L strain also shows a diminished IFN-
response following
-GalCer stimulation (data not shown); (iii) the IL-4 defect in L mice is similar to that observed in CD1d- and ß2m-deficient mice which lack NKT cells (1012,26,3335,45 and data not shown); and (iv) in both H and L cell cultures, the IL-4 response was modulated by IL-7 (data not shown), a cytokine known to enhance IL-4 production by NKT cells (33,34,45).
Polyclonal stimulation of IL-4 production by a defined lymphocyte subset was a phenotype worth being tested in the ISCS that we recently produced from H and L mice. A sensible improvement of antibody production was expected in these ISCS since the interaction effects between Im genes were shown to be relatively limited (41). This was indeed observed in LcH4 mice (Fig. 2
) and in all other ISCS except LcH8-60 (data not shown). Contrasting with the overall regulation of antibody response, the IL-4 phenotype may only involve a single or a few Im genes and show a clear-cut discriminating pattern in Im QTL congenic ISCS lines. Actually, an IL-4 responder phenotype was associated only to the Im QTL on chromosome 4.
In SJL and NOD mice the defect of NKT cell-dependent IL-4 production was ascribed to the absence or reduced number and function of NKT cells (26,3133). The same interpretation might be given for the L mice defect, as NKT cells are found at a 2- to 4-fold lower frequency among thymic and splenic T cell populations and produce lower amounts of IL-4. However, the finding of an improved IL-4 response in LcH4 mice, without increased NKT cell frequency, suggests that L mice have an intrinsic functional defect, in addition to an impaired NKT cell development. The persistence of low NKT cell numbers in LcH4 mice may explain the partial recovery of IL-4 production. In addition, it is very likely that the gene(s) controlling the NKT-dependent IL-4 response is more efficiently expressed in H mice which bear the complete set of `favorable' Im alleles than on the L-like background of LcH4. Indeed only the comparison of LcH mice with L mice offers a valid analysis of the QTL-restricted effect.
The mapping of a gene involved in NKT cell-dependent IL-4 responsiveness within the Im-containing chromosome 4 QTL is a new finding. Genetic analysis of an F2 cross has indicated that at least two loci contribute to the SJL defect in IL-4 production and excluded several chromosomal segments containing candidate genes: IL-4 (chromosome 11), the Vß8 and NK locus (chromosome 6), and the CD1d (chromosome 3) (32). In our model, no Im QTL was found on chromosomes 1 and 11, and LcH6 mice did not respond to anti-CD3 challenge even if the Im QTL was close to the Vß8 and NK loci. Chromosome 4 QTL does not contain any obvious candidate gene, even when considering a relatively large confidence interval on both sides of the introduced markers (Fig. 2A
). Nevertheless, it is remarkable that multiple genes associated with autoimmunity have been located close to this segment (5052).
Compared to the SJL, L mice share the same H-2s haplotype but not the TCR
ß haplotype with its large repertoire deletion (53,54).The two strains display a poor ability for IgE responses, especially after anti-IgD injection (31 and unpublished observation). This trait, however, is likely to be controlled in L mice by the interaction of all the Im alleles endowed with low additive effect. This very peculiar genetic background of L mice also explains why, in contrast to SJL and NOD strains, these mice are relatively resistant to autoimmunity (55,56). It will be of particular interest to compare extensively L and LcH4 lines for other phenotypes to determine the consequences of impaired NKT cell functions on global associated traits in more physiologic conditions than those generated through gene invalidation. Importantly, the clear-cut IL-4 response patterns observed in L and LcH4 mice will help to identify the relevant gene by subtractive molecular approaches or by positional mapping in successive backcrosses. This will definitely establish whether or not the Im gene itself or a closely located gene is responsible for the NKT phenotype.
Further in vitro assays provided some insights into the mechanisms of IL-4 response recovery in LcH4 mice: co-culture experiments demonstrated that APC from LcH4, but not from L mice, play a determinant role in the NKT-dependent IL-4 production response. In this respect, LcH4 APC behave just as H mice APC (data not shown). Preliminary results indicated that dendritic (N418+) cells thought to be responsible for the CD1d-dependent presentation of
-GalCer ligand to NKT cells (30) are at a similar frequency and express the same level of CD1d molecules in the L and LcH4 total spleen cells used as APC in co-culture experiments.
The effect mediated by LcH4 APC might be related to the differential expression of a co-stimulatory molecule as suggested by the reported role of CD28/CTLA-4 in the in vivo triggering of IL-4 burst (18). Our observation that the `LcH4-APC effect' is not mandatory in the favorable genetic background of H mice fits with the hypothesis of a co-stimulatory signal.
Whether such an effect would be limited to NKT cell function or may affect other T cell subsets is worth studying to explain the role and the mechanism of the Im-containing chromosome 4 QTL in quantitative antibody responsiveness.
| Acknowledgments |
|---|
We are grateful to M. Dy, H. J. Garchon, J. M. Gombert and M. Throsby for critically reading the manuscript. This work was supported by Institute funds from the INSERM and the Ligue Nationale contre le Cancer (Axe Immunologie, 19981999). L. M. A. was supported by personal grants from Conselho Nacional de desenvolvimento Cientifico e Tecnologico (CNPq) and Association pour la Recherche sur le Cancer. A. H. was supported by a personal grant from La Fondation pour la Recherche Médicale.
| Abbreviations |
|---|
GalCer -galactosylceramide |
| APC antigen-presenting cell |
| ß2m ß2-microglobulin |
| H high antibody producer |
| Im immunomodulatory gene |
| L low antibody producer |
| LcH L congenic to H |
| QTL quantitative trait locus |
| Notes |
|---|
Transmitting editor: M. Taniguchi
Received 16 May 2000, accepted 2 August 2000.
| References |
|---|
|
|
|---|
- Bendelac, A., Rivera, M. N., Park, S. H. and Roark, J. H. 1997. Mouse CD1-specific NK1 T cells: development, specificity, and function. Annu. Rev. Immunol. 15:535.[Web of Science][Medline]
-
Arase, H., Arase, N., Ogasawara, K., Good, R. A. and Onoe, K. 1992. An NK1.1+ CD4+8 single-positive thymocyte subpopulation that expresses a highly skewed T-cell antigen receptor V beta family. Proc. Natl Acad. Sci. USA 89:6506.
[Abstract/Free Full Text] -
Budd, R. C., Miescher, G. C., Howe, R. C., Lees, R. K., Bron, C. and MacDonald, H. R. 1987. Developmentally regulated expression of T cell receptor beta chain variable domains in immature thymocytes. J. Exp. Med. 166:577.
[Abstract/Free Full Text] - Fowlkes, B. J., Kruisbeek, A. M., Ton-That, H., Weston, M. A., Coligan, J. E., Schwartz, R. H. and Pardoll, D. M. 1987. A novel population of T-cell receptor alpha beta-bearing thymocytes which predominantly expresses a single V beta gene family. Nature 329:251.[Medline]
-
Koseki, H., Asano, H., Inaba, T., Miyashita, N., Moriwaki, K., Lindahl, K. F., Mizutani, Y., Imai, K. and Taniguchi, M. 1991. Dominant expression of a distinctive V14+ T-cell antigen receptor alpha chain in mice. Proc. Natl Acad. Sci. USA 88:7518.
[Abstract/Free Full Text] - Takahama, Y., Sharrow, S. O. and Singer, A. 1991. Expression of an unusual T cell receptor (TCR)-V beta repertoire by Ly-6C+ subpopulations of CD4+ and/or CD8+ thymocytes. Evidence for a developmental relationship between Ly-6C+ thymocytes and CD4CD8TCR-alpha beta+ thymocytes. J. Immunol. 147:2883.[Abstract]
-
Dellabona, P., Casorati, G., Friedli, B., Angman. L., Sallusto, F., Tunnacliffe, A., Roosneek, E. and Lanzavecchia, A. 1993. In vivo persistence of expanded clones specific for bacterial antigens within the human T cell receptor alpha/beta CD48 subset. J. Exp. Med. 177:1763.
[Abstract/Free Full Text] -
Lantz, O. and Bendelac, A. 1994. An invariant T cell receptor alpha chain is used by a unique subset of major histocompatibility complex class I-specific CD4+ and CD48 T cells in mice and humans. J. Exp. Med. 180:1097.
[Abstract/Free Full Text] -
Porcelli, S., Yockey, C. E., Brenner, M. B. and Balk, S. P. 1993. Analysis of T cell antigen receptor (TCR) expression by human peripheral blood CD48 alpha/beta T cells demonstrates preferential use of several V beta genes and an invariant TCR alpha chain. J. Exp. Med. 178:1.
[Abstract/Free Full Text] - Mendiratta, S. K., Martin, W. D., Hong, S., Boesteanu, A., Joyce, S. and S. Van Kaer, S. 1997. CD1d1 mutant mice are deficient in natural T cells that promptly produce IL-4. Immunity 6:469.[Web of Science][Medline]
-
Smiley, S. T., Kaplan, M. H. and Grusby, M. J. 1997. Immunoglobulin E production in the absence of interleukin-4-secreting CD1-dependent cells. Science 275:977.
[Abstract/Free Full Text] - Chen, Y. H., Chiu, N. M., Mandal, M., Wang, N. and Wang, C. R. 1997. Impaired NK1+ T cell development and early IL-4 production in CD1-deficient mice. Immunity 6:459.[Web of Science][Medline]
-
Bendelac, A., Lantz, O., Quimby, M. E., Yewdell, J. W., Bennink, J. R. and Brutkiewicz, R. R. 1995. CD1 recognition by mouse NK1+ T lymphocytes. Science 268:863.
[Abstract/Free Full Text] - Bendelac, A. and Schwartz, R. H. 1991. CD4+ and CD8+ T cells acquire specific lymphokine secretion potentials during thymic maturation. Nature 353:68.[Medline]
-
Bendelac, A., Matzinger, P., Seder, R. A., Paul, W. E. and Schwartz, R. H. 1992. Activation events during thymic selection. J. Exp. Med. 175:731.
[Abstract/Free Full Text] -
Hayakawa, K., Lin, B. T. and Hardy, R. R. 1992. Murine thymic CD4+ T cell subsets: a subset (Thy0) that secretes diverse cytokines and overexpresses the V beta 8 T cell receptor gene family. J. Exp. Med. 176:269.
[Abstract/Free Full Text] - Arase, H., Arase, N., Nakagawa, K., Good, R. A. and Onoe, K. 1993. NK1.1+ CD4+ CD8 thymocytes with specific lymphokine secretion. Eur. J. Immunol. 23:307.[Web of Science][Medline]
-
Yoshimoto, T. and Paul, W. E. 1994. CD4pos, NK1.1pos T cells promptly produce interleukin 4 in response to in vivo challenge with anti-CD3. J. Exp. Med. 179:1285.
[Abstract/Free Full Text] -
Denkers, E. Y., Scharton-Kersten, T., Barbieri, S., Caspar, P. and Sher, A. 1996. A role for CD4+ NK1.1+ T lymphocytes as major histocompatibility complex class II independent helper cells in the generation of CD8+ effector function against intracellular infection. J. Exp. Med. 184:131.
[Abstract/Free Full Text] -
Cui, J., Shin, T., Kawano, T., Sato, H., Kondo, E., Toura, I., Kaneko, Y., Koseki, H., Kanno, M. and Taniguchi, M. 1997. Requirement for Valpha14 NKT cells in IL-12-mediated rejection of tumors. Science 278:1623.
[Abstract/Free Full Text] -
Kaneko, B. Y., Harada, M., Kawano, T., Yamashita, M., Shibata, Y., Gejyo, F., Nakayama, T. and Taniguchi, M. 2000. Augmentation of Valpha14 NKT cell-mediated cytotoxicity by interleukin 4 in an autocrine mechanism resulting in the development of concanavalin A-induced hepatitis. J. Exp. Med. 191:105.
[Abstract/Free Full Text] -
Smyth, M. J., Thia, Y. T., Street, S. E. A., Cretney, E., Trapani, J. A., Taniguchi, M., Kawano, T., Pelikan, S. B., Crowe, N. Y. and Godfrey, D. I. 2000. Differential tumor surveillance by natural killer (NK) and NKT cells. J. Exp. Med. 191:661
[Abstract/Free Full Text] - Takeda, K., Seki, S., Ogasawara, K., Anzai, R., Hashimoto, W., Sugiura, K., Takahashi, M. Satoh, M. and Kumagai, K. 1996. Liver NK1.1+ CD4+ alpha beta T cells activated by IL-12 as a major effector in inhibition of experimental tumor metastasis. J. Immunol. 156:3366[Abstract]
- Mieza, M. A., Itoh, T., Cui, J. Q., Makino, Y., Kawano, T., Tsuchida, K., Koike, T., Shirai, T., Yagita, H., Matsuzawa, A., Koseki, H. and Taniguchi, M. 1996. Selective reduction of V alpha 14+ NKT cells associated with disease development in autoimmune-prone mice. J. Immunol. 156:4035.[Abstract]
-
Lehuen, A., Lantz, O., Beaudoin, L., Laloux, V., Carnaud, C., Bendelac, A., Bach, J. F. and Monteiro, R. C. 1998. Overexpression of natural killer T cells protects Valpha14Jalpha281 transgenic nonobese diabetic mice against diabetes. J. Exp. Med. 188:1831.
[Abstract/Free Full Text] - Gombert, J. M., Herbelin, A., Tancrede-Bohin, E., Dy, M., Carnaud, C. and Bach, J. F. 1996. Early quantitative and functional deficiency of NK T-like thymocytes in the NOD mouse. Eur. J. Immunol. 26:2989.[Web of Science][Medline]
-
Hammond, K. J. L., Poulton, L. D., Palmisano, L. J., Silveira, P. A., Godfrey, D. I. and Baxter, A. G. 1998. alpha/beta-T cell receptor (TCR)+CD4CD8 (NKT) thymocytes prevent insulin-dependent diabetes mellitus in nonobese diabetic (NOD)/Lt mice by the influence of interleukin (IL)-4 and/or IL-10. J. Exp. Med. 187:1047.
[Abstract/Free Full Text] -
Brossay, L., Chioda, M., Burdin, N., Koezuka, Y., Casorati, G., Dellabona, P. and Kronenberg, M. 1998. CD1d-mediated recognition of an alpha-galactosylceramide by natural killer T cells is highly conserved through mammalian evolution. J. Exp. Med. 188:1521.
[Abstract/Free Full Text] -
Burdin, N., Brossay, L., Koezuka, Y., Smiley, S. T., Grusby, M. J., Gui, M., Taniguchi, M., Hayakawa, K. and Kronenberg, M. 1998. Selective ability of mouse CD1 to present glycolipids: alpha-galactosylceramide specifically stimulates V alpha 14+ NKT lymphocytes. J. Immunol. 161:3271.
[Abstract/Free Full Text] -
Kawano, T., Cui, J., Koezuka, Y., Toura, I., Kaneko, Y., Motoki, K., Ueno, H., Nakagawa, R., Sato, H., Kondo, E., Koseki, H. and Taniguchi, M. 1997. CD1d-restricted and TCR-mediated activation of V alpha 14 NKT cells by glycosylceramides. Science 278:1626.
[Abstract/Free Full Text] -
Yoshimoto, T., Bendelac, A., Hu-Lie, J. and Paul, W. E. 1995. Defective IgE production by SJL mice is linked to the absence of CD4+, NK1.1+ T cells that promptly produce interleukin 4. Proc. Natl Acad. Sci. USA 92:11931.
[Abstract/Free Full Text] - Beutner, U., Launois, P., Ohteki, T., Louis, J. and MacDonald, H. R. 1997. Natural killer-like T cells develop in SJL mice despite genetically distinct defects in NK1.1 expression and in inducible interleukin-4 production. Eur. J. Immunol. 27:928.[Web of Science][Medline]
-
Gombert, J. M., Tancrede-Bohin, E., Hameg, A., Leite-de-Moraes, M. C., Vicari A., Bach, J. F. and Herbelin, A. 1996. IL-7 reverses NK1+ T cell-defective IL-4 production in the non-obese diabetic mouse. Int. Immunol. 8:1751.
[Abstract/Free Full Text] -
Vicari, A., de Moraes, M. d. C., Gombert, J. M., Dy, M., Penit C., Papiernik, M. and Herbelin, A. 1994. Interleukin 7 induces preferential expansion of V beta 8.2+CD48 and V beta 8.2+CD4+8 murine thymocytes positively selected by class I molecules. J. Exp. Med. 180:653.
[Abstract/Free Full Text] -
Yoshimoto, T., Bendelac, A., Watson, C., Hu-Li, J. and Paul, W. E. 1995. Role of NK1.1+ T cells in a TH2 response and in immunoglobulin E production. Science 270:1845.
[Abstract/Free Full Text] - Biozzi, G., Stiffel, C., Mouton, D., Bouthillier, Y. and Decreusefond, C. 1972. Cytodynamics of the immune response in two lines of mice genetically selected for `high' and `low' Ab synthesis. J. Exp. Med. 135:1071.[Abstract]
- Puel, A. and Mouton, D. 1996. Genes responsible for quantitative regulation of antobody production. Crit. Rev. Immunol. 16:223.[Web of Science][Medline]
- Biozzi, G., Mouton, D., Stiffel, C. and Bouthillier, Y. 1984. A major role of macrophage in quantitative genetic regulation of immuno responsiveness and antiinfectious immunity. Adv. Immunol. 36:189.[Web of Science][Medline]
- Feingold, N., Feingold, J., Mouton, D., Bouthillier, Y., Stiffel, C. and Biozzi, G. 1976. Polygenic regulation of Ab synthesis to sheep erythrocytes in the mouse: a genetic analysis. Eur. J. Immunol. 6:43.[Web of Science][Medline]
- Puel, A., Groot, P. C., Lathrop, M. G., Demant, P. and Mouton, D. 1976. Mapping of genes controlling quantitative Ab production in Biozzi mice. J. Immunol. 154:5799.[Abstract]
-
Puel, A., Mevel, J. C., Bouthillier, Y., Feingold, N., Fridman, W. H. and Mouton. D. 1996. Towards genetic dissection of high and low Ab responsiveness in Biozzi mice. Proc. Natl Acad. Sci. USA 93:14742.
[Abstract/Free Full Text] -
Lander, E. S. and N. J. Schork. 1994. Genetic dissection of complex traits. Science 265:2037.
[Abstract/Free Full Text] - Wakeland, E., Morel, L., Achey, K., Yui, M. and Longmate, J. 1997. Speed congenics: a classic technique in the fast lane (relatively speaking). Immunol. Today 18:472.[Web of Science][Medline]
- Morita, M., Motoki, K., Akimoto, K., Natori, T., Sakai, T., Sawa, E., Yamaji, K., Koezuka, Y., Kobayashi, E. and Fukushima, H. 1995. Structure-activity relationship of alpha-galactosylceramides against B16-bearing mice. J. Med. Chem. 38:2176.[Web of Science][Medline]
-
Hameg, A., Gouarin, C., Gombert, J. M., Hong, S., Van Kaer, L., Bach, J. F. and Herbelin, A. 1999. Interleukin 7 upregulates IL-4 production by splenic NK1.1+ and NK1.1- MHC class I-like/CD1-dependent CD4+ T cells. J. Immunol. 162:7067.
[Abstract/Free Full Text] - Cheng, H. and Paul W. E. 1998. A population of CD62Llow NK1.1 CD4+ T cells that resembles NK1.1 CD4+ T cells. Eur. J. Immunol. 28:3172[Web of Science][Medline]
-
Benlagha, K., Weiss, A., Beavis, A. Teyton, L. and Bendelac, A. 2000. In vivo identification of glycolipid antigen-specific T cells using fluorescent CD1d tetramers. J. Exp. Med. 191:1895.
[Abstract/Free Full Text] -
Hanke, T., Mitnacht, R., Boyd, R. and Hunig, T. 1994. Induction of interleukin 2 receptor beta chain expression by self-recognition in the thymus. J. Exp. Med. 180:1629.
[Abstract/Free Full Text] - Prouvost-Danon, A., Mouton, D., Abadie, A., Mevel, J. C. and Biozzi, G. 1977. Genetic regulation of IgE and agglutinating antibody synthesis in lines of mice selected for high and low immune responsiveness. Eur. J. Immunol. 7:342.[Web of Science][Medline]
- Vyse, J. T. and Todd, A. J. 1996. Genetic analysis of autoimmune disease. Cell 85:311.[Web of Science][Medline]
- Mohan, C., Morel, L., Yang, P., Watanabe, H., Croker, B., Gilkelson, G. and Wakeland, E. K. 1999. Genetic dissection of systemic lupus pathogenesis: a recipe for nephrophilic autoantibodies. J. Clin. Invest. 103:1685.[Web of Science][Medline]
-
Silveira, P. A., Baxter, A. G., Cain, W. E., and van Driel, I. R. 1999. A major linkage region on distal chromosome 4 confers susceptibility to mouse autoimmune gastritis. J. Immunol. 162:5106.
[Abstract/Free Full Text] -
Behlke, M., Chou, H., Huppi, K., and Loh, D. Y. 1986. Murine T-cell receptor mutants with deletion of ß chain variable region genes. Proc. Natl Acad. Sci. USA 83:767.
[Abstract/Free Full Text] - Roger, T., Pepin, F. L., Couderc, J., De Franco, M. and Seman, M. 1993. Co-selection of the rare T cell receptor-g B haplotype in mouse lines selected for low responsiveness to red blood cell antigens. Eur. J. Immunol. 23:287.[Web of Science][Medline]
- Bouvet, J. P., Couderc, J., Bouthillier, Y., Franc, B., Decreusefond, C. and Mouton, D. 1989. Collagen-induced arthritis in Biozzi mice. Joint involvement is not correlated with collagen II IgG2a autoAb nor restricted to only H-2q and H-2r. J. Immunol. 143:1537.[Abstract]
- Baker, D., O'Neill, J. K., Gchmeissner, S. E., Wilcox, C. E., Buher, C. and Turk, J. L. 1990. Induction chronic relapsing experimental allergic encephalomyelitis in Biozzi mice. J. Neuroimmunol. 28:261.[Web of Science][Medline]
This article has been cited by other articles:
![]() |
D. Vallois, M.-C. Gagnerault, P. Avner, U. C. Rogner, C. Boitard, K. Benlagha, A. Herbelin, and F. Lepault Influence of a Non-NK Complex Region of Chromosome 6 on CD4+ Invariant NK T Cell Homeostasis J. Immunol., August 1, 2008; 181(3): 1753 - 1759. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-C. Rocha-Campos, R. Melki, R. Zhu, N. Deruytter, D. Damotte, M. Dy, A. Herbelin, and H.-J. Garchon Genetic and Functional Analysis of the Nkt1 Locus Using Congenic NOD Mice: Improved V{alpha}14-NKT Cell Performance but Failure to Protect Against Type 1 Diabetes. Diabetes, April 1, 2006; 55(4): 1163 - 1170. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Duthie, M. Wleklinski-Lee, S. Smith, T. Nakayama, M. Taniguchi, and S. J. Kahn During Trypanosoma cruzi Infection CD1d-Restricted NK T Cells Limit Parasitemia and Augment the Antibody Response to a Glycophosphoinositol-Modified Surface Protein Infect. Immun., January 1, 2002; 70(1): 36 - 48. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








