Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Qian, S.-B.
Right arrow Articles by Chen, S.-S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Qian, S.-B.
Right arrow Articles by Chen, S.-S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 12, No. 10, 1409-1416, October 2000
© 2000 Japanese Society for Immunology

Blocked transport of soluble Kb molecules containing connecting peptide segment involved in calnexin association

Shu-Bing Qian and Shi-Shu Chen

Department of Biochemistry & Molecular Biology, Shanghai Second Medical University, 280 South Chongqing Road, Shanghai 200025, PRC

Correspondence to: S.-B. Qian


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The molecular event governing the assembly of the MHC class I heavy chain–ß2-microglobulin-peptide complex is still not fully understood. In order to characterize the transport properties of MHC class I molecules, several truncated H-2Kb genes were constructed and expressed in COS7 cells. Surprisingly, the expressed soluble molecule containing connecting peptide (CP) segment (sKbCP) did not secrete as efficiently as the one without CP (sKbCYT). When the sKbCP gene was transfected into a calnexin-deficient cell line CEM.NKR, the amount of soluble Kb molecules in the supernatant was comparable with sKbCYT-transfected CEM.NKR. To further demonstrate the different transport of sKbCP and sKbCYT within living cells, we attached green fluorescent protein (GFP) to the C-termini of both molecules and, as a comparison, to the full-length transmembrane counterpart (mKb–GFP). While the mKb–GFP-transfected cells showed the green fluorescence in the reticular network and the nuclear envelope, sKbCP–GFP showed obviously lump fluorescence of high intensity within cells. However, the distribution of sKbCYT–GFP was fairly uniform. Furthermore, GFP-tagged molecules allow us to analyze their interaction with other proteins in a direct, simple and quantitative method, designated immunofluorescence precipitation. The results showed that 60% of sKbCP–GFP molecules were associated with calnexin, while <10% with tapasin. Taken together with the results from sKbCYT–GFP and mKb–GFP, it is reasonable to deduce that the CP segment is involved in the association of class I molecules with calnexin and the transmembrane region might play a dynamic role in the dissociation from calnexin. The suggested kinetic association of class I molecules with calnexin is likely to contribute to the different maturation rate between several class I alleles.

Keywords: calnexin, connecting peptide segment, kinetic association, MHC, transmembrane segment


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The role of MHC class I molecules as indicators of intracellular protein transport is reflected in their molecular design which does not allow them to leave the endoplasmic reticulum (ER) unless they have completely assembled to form class I heavy chain–ß2 microglobulin- (ß2m) peptide complexes (1,2). While the critical elements of the class I presentation pathway have been defined, the molecular event governing the assembly of this complex is still not fully understood. There are a number of unresolved issues surrounding the interaction of assembling class I molecules with calnexin, an ER type I transmembrane chaperone. It was suggested that oligosaccharide residues might serve as substrates for calnexin binding. However, unglycosylated class I molecules can also bind calnexin (3). As a chaperone, calnexin facilitates folding of the nascent heavy chains and promotes assembly of heavy chains with ß2m. Surprisingly, the assembly and function of class I molecules appear to be normal in a calnexin-negative cell line (4). While the lumenal domain, transmembrane region and cytoplasmic tail (CYT) of calnexin have all been shown to play a role in its interaction with various targets (57), the identification of the class I domain which determines the interaction with calnexin remains controversial (8). Previous experiments showed that a glycophosphatidylinositol (GPI)-linked Q7b class I molecule was associated with calnexin, whereas a soluble Q7b isoform was not calnexin associated. These results implicated that the 9 amino acid fragment, connecting the {alpha}3 domain with the transmembrane region, might be the site of interaction with calnexin (3). However, direct evidence is still lacking. On the other hand, studies using soluble calnexin suggested that the transmembrane domain might be important in the interaction of these integral membrane proteins (6).

To investigate this problem, we generated two modified Kb cDNAs from which both the transmembrane region and the CYT were absent. One construct, sKbCP, contains the connecting peptide (CP) segment following the {alpha}3 domain of Kb and the other replaces the CP segment with terminal CYT sequences of the same length (sKbCYT). Both engineered soluble Kb molecules were expressed in COS7 cells and the calnexin-deficient cell line CEM.NKR. Unlike sKbCYT, the secretion of sKbCP was almost blocked in transfected COS7 cells, suggesting that the CP segment is directly involved in the association with calnexin. However, the behavior of membrane-anchored Kb molecules implies that the transmembrane domain of heavy chains may regulate the calnexin dissociation. The unexpected role of the transmembrane domain was further confirmed by the retarded transport of integral membrane Kb tagged with green fluorescent protein (GFP) at its C-terminus. The intracellular status of various GFP-tagged versions was analyzed quantitatively by immunofluorescence precipitation (IFP). The suggested kinetic association of class I molecules with calnexin is likely to contribute to the different maturation rate between several class I alleles.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Construction of truncated and fusion genes
Full-length H-2Kb cDNA was cloned from the splenocytes of C57BL/6 mouse using RT-PCR. The forward oligonucleotide primer (mKb5), 5'-TAGGATCCATGGTACCGTGCACGCTGCTCCTGCTGT-3', includes a BamHI site (underlined) upstream of the initiation ATG codon, and the reverse primer (mKb3), 5'-CGGTCGACTCAAAGCTTCGCTAGAGAATGAGGGTC-3', introduces both a HindIII site and SalI site in the flank of the termination TCA codon. The H-2Kb cDNA was cloned into unique BamHI and SalI sites in pBluescript II SK+ plasmid (Stratagene, La Jolla, CA), generating pBluescript/Kb followed by sequencing to confirm its identity. For the fused Kb–GFP construct, the GFP was first removed from phGFP-S65T (Clontech, Palo Alto, CA) with HindIII and XbaI, and then cloned into pBluescript/Kb digested with the same restriction enzymes. Thus the termination TCA codon of Kb was excised and the GFP was fused in-frame to the 3' end of Kb coding region. For transient expression studies, pcDNA3/Kb–GFP was generated by inserting the Kb–GFP fragment of 1.8 kb into BamHI–XhoI digested pcDNA3 (Invitrogen, Carlsbad, CA). One soluble form of Kb, sKbCP, was amplified by PCR using mKb5 and another 3' primer (sKb3), CGGTCGACTCAAAGCTTGTTGGAGACAGTGGATGG, which includes the same enzyme sites as mKb3. The PCR product, with a stop codon inserted at 1003, encodes a truncated Kb molecule from which both the transmembrane region and CYT were absent. The sKbCP–GFP fusion gene was constructed using the similar method as mKb–GFP. For another soluble form, sKbCYT–GFP, a pair of overhang primers was designed. The 5' primer (CG5), GTTCATGACCCTATTCTCTAGCGAAGCTTGCCGCCACC, encodes a portion of terminal CYT residues and the 5' end of GFP, and the 3' primer (SC3), CGCTAGAGAATGAGGGTCATGAACCATCCATCTCAGGGTGAGGG, contains the sequence for the 3' end of {alpha}3 domain of Kb and a portion of terminal CYT residues, an overlap to CG5. The PCR products of mKb5 + SC3 and CG5 + GFP3 were mixed and spliced by overlap extension. The GFP-untagged version, sKbCYT, was then directly amplified with primers of mKb5 and mKb3 using sKbCYT–GFP as template.

Cell culture and reagents
Transformed simian cell line COS7 and calnexin-deficient cell line CEM.NKR (generously provided by Dr Peter Cresswell, Yale University) were maintained in DMEM (Gibco, Gaithersburg, MD), supplemented with 10% (v/v) heat-inactivated newborn calf serum (Gibco). EL4, Jurkat, TAP-deficient cell line RMA-S and hybridoma cell line secreting anti-Kb mAb AF6-88.5.3 (Ig2a) were obtained from ATCC (Rockville, MD), and cultured in RPMI 1640 medium (Gibco) containing 10% (v/v) fetal bovine serum (Hyclone, Logan, UT). Media for all cultures routinely included 2 mmol/l glutamine, 1 mmol/l pyruvate, 100 U penicillin and 100 µg/ml of streptomycin. All cultures were maintained at 37°C in a 5% CO2 humidified atmosphere.

DNA transfection
COS7 cells grown to 60–80% confluence on coverslip in a six-well culture plate (Nunc, Rochester, NY) were transfected with 1 µg of recombinant pcDNA3 plasmid using 8 µl of Lipofectamine reagent (Gibco) per well, according to the manufacturer's instructions. Briefly, COS7 cells were incubated with a DNA/Lipofectamine mixture in serum-free media for 6 h, the media were replaced with complete media and the cells were analyzed 48 h after transfection. For suspension cells, like EL4, Jurkat, CEM.NKR and RMA-S cells, the transfection was performed by electroporation (250 V and 960 µF; GenePulser; BioRad, Hercules, CA) because of its resistance to liposome-mediated transfection.

ELISA
The concentration of recombinant proteins in supernatants was analyzed by ELISA. Primary antibodies used to coat PRO-BIND plates (Falcon, Franklin Lake, NJ) were mouse anti-human ß2m or rabbit anti-mouse ß2m (PharMingen). Supernatants (100 µl) from transfected cells were incubated for 1 h at room temperature. Plates were washed extensively and incubated with AF6-88.5 for 1 h. After extensive washing, plates were incubated with horseradish peroxidase-conjugated goat anti-mouse IgG (100 µl of a 1:1000 dilution; Sino-American, Shanghai, PRC) for 1 h, washed and developed with 3,3',5,5'-tetramethylbenzidine dihydrochloride substrate for 10 min. The reaction was stopped with the addition of H2SO4 (1 M) and absorbance was read at 450 nm.

Fluorescence microscopy
Cell samples were plated onto 35 mm dishes containing a centered glass coverslip. Microscopic evaluation of GFP expression was carried out by direct observation of living cells using a fluorescence microscope equipped with a FITC filter and a xenon power supply (Nikon). For laser scanning confocal microscopy, cell monolayers grown on glass coverslips were analyzed in a laser scanning confocal microscope (Zeiss LSM510) equipped with a 488 nm argon. To detect the expression of Kb on the cell surface, indirect immunofluorescence was performed with mAb AF6-88.5.3 (Ig2a). A phycoerythrin (PE)-conjugated anti-mouse Ig (Sigma) was used as secondary antibody. Antibody incubation was performed at 4°C for 30 min, and cells were washed 3 times between applications using PBS containing 0.02% sodium azide and 1% BSA. Dual-channel fluorescences (GFP and PE) were observed simultaneously. Digitized images of confocal optical sections (2 µm) were compiled into final figures using Adobe PhotoShop software (version 5.0, Adobe Systems).

IFP
Cells were washed twice with ice-cold PBS, and lysed with 1% 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfate (Pierce, Rockford, IL) in Tris-buffered saline, pH 7.4, containing 10 mM leupeptin, 1% aprotinin and 0.25 mM phenylmethylsulfonyl fluoride. After incubation for 30 min on ice, lysates were centrifuged. The postnuclear supernatant was cleared overnight at 4°C with normal rabbit serum and PANSORBIN Staphylococcus aureus (Calbiochem, San Diego, CA). One aliquot was directly analyzed the fluorescence intensity and the others were performed by immunoprecipitation. The following antibodies were used: R.gp48N, a rabbit anti-peptide antibody to the N-terminal region of tapasin (9); anti-calnexin mAb (kindly provided by Dr Peter Cresswell in Yale University) (10); 28-8-6s, a mouse mAb that binds assembled form of Kb and Kd (PharMingen) and AF6-88.5. Aliquots were then incubated for 1 h at 4°C with antibody, followed by 30 min at 4°C with Protein A–Sepharose (Pharmacia). The post-precipitated supernatant was analyzed by fluorometry or re-precipitated by different antibody for dual-IFP experiments.

Western blot analysis
For protein immunoblotting, the first round immunoprecipitates described above were subjected to SDS–PAGE and transferred to a nitrocellulose membrane. The membrane was incubated with antibody against GFP (Clonetech). After incubation with horseradish peroxidase-conjugated secondary antibody, the membrane was visualized by enhanced chemiluminescence (ECL; Amersham, Piscataway, NJ).

Pulse–chase analysis
For pulse–chase analysis, transfected cells were starved in methionine-free medium for 50 min, pulsed with [35S]methionine at 150 µCi/ml for 15 min and chased in medium containing excess of methionine (0.5 mM) for 180 min. Cells (5x106) were collected, washed and lysed as described above. GFP-tagged Kb molecules were recovered with anti-GFP antibody, while wild-type Kb with antiserum to the C-terminal peptide encoded by exon 8 of the Kb gene (anti-X8, kindly provided by Dr Nathenson, Albert Einstein College of Medicine) (11). The immunoprecipitates were washed and treated with Endo H (Boehringer Mannheim, Germany) or under control conditions before analysis by SDS–PAGE and autoradiography.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Secretion of soluble Kb molecules in COS7 and CEM.NKR cells
We generated two modified Kb cDNAs from which both the transmembrane region and the CYT were absent. One construct, sKbCP, contains the CP segment following the {alpha}3 domain of Kb and the other replaces the CP segment with terminal CYT sequences of the same length (sKbCYT). Both constructs were expressed in COS7 cells in a mammalian expression vector pcDNA3. Supernatants from the transfected cells were tested for the presence of the secreted form of Kb molecules by an enzyme-linked immunosorbent assay (ELISA). As shown in Fig. 1Go, while a certain amount of soluble Kb was produced by sKbCYT-transfected cells, only trace was detected in sKbCP-transfected cells. This result suggested that CP containing soluble Kb molecules could not be efficiently secreted from the cells. However, the fate of sKbCP molecules within cells is unclear, for Northern blot analysis showed both constructs were expressed at almost the same level (data not shown). In order to determine whether calnexin plays a role in blocking the secretion of sKbCP from COS7, a similar experiment was done in CEM.NKR, which does not express calnexin at the mRNA and protein level (12). Surprisingly, both sKbCP and sKbCYT were secreted from transfected CEM.NKR cells. Thus the results obtained from both COS7 and CEM.NKR indicate that the CP segment may participate in the association of class I molecules with calnexin.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 1. Secretion of CP-containing soluble Kb molecules was almost blocked in calnexin-positive cell lines but normal in calnexin-deficient CEM.NKR cells. Supernatants (100 µl) from transfected COS7, CEM.NKR, EL4, Jurkat and RMA-S cells were tested for reactivity with Kb-specific mAb (AF6-88.5).

 
We expanded the results in COS7 to other calnexin-positive cell lines, including mouse lymphoma EL4 and human leukemia Jurkat (Fig. 1Go). Both cell lines did not secrete sKbCP after transfection. Due to different transfection efficiency, the secreted amount of sKbCYT was relatively lower as compared with transfected COS7. There was no marked difference in the expression pattern of soluble Kb in both cells, although several studies have suggested that murine class I molecules behave differently in human and mouse cells (13). It was shown that human ß2m could much more readily associate with Kb to form a stable conformation (14). However, it still remains to be determined whether soluble HLA class I molecules have the same fate as Kb.

The results obtained from a TAP-deficient cell line, RMA-S, were interesting. There was no dramatic difference of expression between sKbCP and sKbCYT, especially the GFP-tagged versions. Thus, the secretion of soluble Kb molecules might be in a peptide-dependent manner. It was known that RMA-S could express some endogenous empty Kb molecules in its cell surface when cultured at 26°C (15). However, because our ELISA system detected only the conformational epitope, we could not exclude the possibility that some soluble Kb molecules were secreted from RMA-S cells.

Distribution of GFP-tagged soluble Kb molecules
To further characterize the features of both truncated Kb molecules within living cells, we attached GFP to the C-termini of both constructs, generating chimeric sKbCP–GFP and sKbCYT–GFP, and, as a comparison, to the full-length transmembrane counterpart (mKb–GFP). COS7 cells were transfected with all the three GFP-fused chimeric constructs respectively. The results from laser scanning confocal microscope showed markedly different fluorescence patterns (Fig. 2BGo). While the mKb–GFP transfected cells showed the green fluorescence in the reticular network and the nuclear envelope, which are characteristic of the ER, sKbCP–GFP showed obviously lump fluorescence of high density within cells, indicating strong accumulation within some organelles. However, the distribution of sKbCYT–GFP was fairly uniform. In addition, both ELISA and fluorometry were used to examine the secretion of GFP-tagged soluble Kb from transfected COS7 cells. Similar to GFP-untagged counterparts, only small amounts of sKbCP–GFP were produced in the supernatant, while much larger amounts of sKbCYT–GFP can be detected (Fig. 1Go). On the other hand, the secretion of sKbCP–GFP was normal in CEM.NKR, resulting in a similar fluorescence pattern to sKbCYT–GFP (Fig. 2Go). In contrast to CEM.NKR, GFP-tagged Kb molecules were obviously accumulated within RMA-S cells because of TAP deficiency, resulting in a similar fluorescence pattern as adherent COS7 cells transfected with sKbCP–GFP. It is noteworthy that mKb–GFP can be expressed on the cell surface as determined by Kb-specific antibody staining (Fig. 2AGo). However, it is surprising to find the different cell surface expression level between mKb–GFP and the GFP-untagged natural counterpart. The mRNA expression level of both Kb–GFP and Kb was almost similar as determined by Northern blot analysis (data not shown), thus excluding the possibility of different transfection efficiency.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 2. Immunofluorescence localization of various GFP-tagged Kb molecules in transfected cells. (A) GFP tagging retards the intracellular transport of Kb in COS7. COS7 cells were transfected with GFP, mKb and mKb–GFP. At 48 h after transfection, cells were washed and incubated with 28-8-6s (mouse anti-Kb and Kd), followed by staining with PE-conjugated anti-mouse IgG. Both green (GFP) and red (PE) channels were analyzed with excitation at 488 nm. (B) CP-containing soluble Kb molecules were accumulated within COS7 cells. COS7 cells were transfected with mKb–GFP, sKbCP–GFP and sKbCYT–GFP by Lipofectamine reagent, and transfection of CEM.NKR and RMA-S cells was performed by the electroporation method. Immunofluorescence was directly analyzed on living cells with confocal microscope (LSM 510). Bar, 5 µm.

 
IFP analysis and Western blot
Not only can the intracellular localization of the GFP-tagged protein be monitored within living cells non-invasively (16), its interaction with other proteins can also be analyzed quantitatively in a simple and rapid way. This approach, designated IFP, utilizes the fluorometry to detect the change of fluorescence intensity in the whole cell lysates before and after immunoprecipitation. Unlike standard immunoprecipitation using metabolic radiolabeling, in which only newly synthesized proteins can be labeled and analyzed, the method using biochemical tagging could put all of the tagged proteins into consideration. A similar quantitative method was the assay of ß-galactosidase activity in the immunoprecipitates by fusing the ß-galactosidase gene at the end of the cytoplasmic tail of the interested protein (17,18). More steps were needed in measuring ß-galactosidase activity in the immunoprecipitates than IFP that avoids extensive washing of the immunoprecipitates. The amount of co-precipitated GFP-tagged proteins can be easily determined by calculating the different fluorescence intensity between pre- and post-precipitated whole cell lysates, thus increasing the sensitivity of detecting any weak interaction between proteins. The association with calnexin and tapasin may represent two stages of class I assembly within the ER. Calnexin interacts with newly synthesized chain (19), while tapasin bridges the class I heavy chain–ß2m with TAP, awaiting the loading of the appropriate peptide (20). Generally, the amount of calnexin-associated, tapasin-associated and completely folded mature form represents almost the total class I molecules within cells. Thus, evaluation of the status of GFP-tagged class I molecules within cells could be performed by IFP using anti-calnexin, anti-tapasin and Kb conformation-specific antibody.

Among the total mKb–GFP molecules within transfected COS7 cells, the Kb conformation-specific antibody-reactive molecules were <10%, while nearly half of the mKb–GFP molecules were co-precipitated with calnexin (Fig. 3AGo). This feature implies that GFP tagging may impede the maturation of membrane-anchored Kb molecules. The retarded transport of mKb–GFP is consistent with the low cell surface expression detected by dual-cannel fluorescence analysis after PE-conjugated antibody staining as compared with wild-type Kb (Fig. 2AGo). To rule out the possibility that the association occurs after solubilization, cells transfected with GFP-untagged constructs and cells transfected with GFP-tagged counterparts were mixed before solubilization. No change in the proportion of co-precipitated fluorescence intensity was observed (data not shown). In contrast to COS7, the maturation of mKb–GFP was rapid in transfected CEM.NKR cells. IFP demonstrated that 65% of mKb–GFP were conformation-specific antibody-reactive in CEM.NKR cells.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 3. The intracellular status of mKb–GFP, sKbCP–GFP and sKbCYT–GFP in transfected COS7 and CEM.NKR (A). Transfected cells were lysed, and fluorescence intensity was determined in whole cell lysates before immunoprecipitation with various antibodies. The proportion of total fluorescence intensity co-precipitated with various molecules is expressed as a percentage in every experiment. (B) Dual-IFP in transfected COS7 cells. After the first round of IFP (white), the second round of precipitation (black) was performed using another antibody different from the one used in the first round.

 
An overlap can be seen from the results of IFP in the mKb–GFP-transfected CEM.NKR cells, in which the proportion of both tapasin-associated and mature form was >100%. It is still possible that the non-specific co-precipitation might exist in IFP experiments. We next performed dual-IFP analysis to examine possible non-specific co-precipitation. A slight overlap was observed in mKb–GFP-transfected COS7 cells between the association with calnexin and tapasin (Fig. 3BGo). It is unlikely that GFP-tagged transmembrane Kb can form intermediates consisting of both calnexin and tapasin. Thus non-specific co-precipitation indeed existed, but at <5%. It is interesting to find that some (~20%) sKbCP–GFP in transfected COS7 was neither associated with calnexin nor with tapasin. The fluorescence pattern of sKbCP–GFP in COS7 cells strongly suggests that the accumulation might occur in other organelles in addition to the ER. A possible explanation is that these molecules might under degradation within cytosol. Such possibility remains to be investigated. To further confirm the results obtained from IFP analysis, we next performed Western blot of the immunoprecipitates using anti-GFP antibody. Consistent results were obvious, although it is difficult for quantitative analysis (Fig. 4Go).



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 4. Western blot analysis of GFP-tagged Kb molecules in immunoprecipitates of COS7 cells transfected with mKb–GFP, sKbCP–GFP and sKbCYT–GFP. Immunoprecipitation was performed using anti-calnexin, anti-tapasin (R.gp48N) and anti-Kb (28-8-6s). Immunoisolated molecules were subjected to 10% SDS–PAGE and transferred to a nitrocellulose membrane. The membrane was blotted with antibody against GFP and visualized by enhanced chemiluminescence.

 
Pulse–chase analysis
As an additional approach to the above question, we performed a pulse–chase analysis and compared the maturation rate of GFP-tagged and wild-type Kb molecules in transfected COS7 and CEM.NKR cells. As shown in Fig. 5Go, processing of chimeric mKb–GFP proteins into Endo H-resistant species was reduced in COS7 as compared with wild-type. It is noteworthy that the maturation of mKb–GFP was also retarded in CEM.NKR, while the transport of sKbCYT–GFP was much more rapid in CEM.NKR than in COS7 cells. The nature of the slight slower maturation rate of sKbCYT–GFP molecules in COS7 than in CEM.NKR is unclear. One possibility is that the assembly machinery might not be identical between these two different cell lines. An alternative explanation is that the expression level of delivered genes in COS7 cells is much stronger than in CEM.NKR, resulting in more newly synthesized class I molecules per cell for COS7.



View larger version (69K):
[in this window]
[in a new window]
 
Fig. 5. Intracellular transport of various GFP-tagged Kb molecules in COS7 (A) and in CEM.NKR (B). COS7 cells were transfected with various constructs by Lipofectamine reagent (Gibco) and transfection of CEM.NKR cells was performed electroporation. At 48 h after transfection, cells were incubated with [35S]methionine for 15 min and then in the presence of excess unlabeled methionine for 180 min. Wild-type Kb molecules were immunoisolated with anti-X8 antibody and GFP-tagged Kb molecules were recovered with anti-GFP antibody. Immunoisolated molecules were digested (+) or mock-digested (–) with Endo H and subjected to 8% SDS–PAGE. The mobilities of the Endo H-resistant (R) and Endo H-sensitive (S) molecules are indicated. Molecular sizes are indicated on the left (in kDa).

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
We firstly found that the soluble Kb molecule containing CP segment (sKbCP) did not secrete efficiently as the one without CP (sKbCYT). It is unlikely that the sKbCP molecules misfolded within the ER of COS7, while sKbCYT folded properly and transported out of the ER. Both constructs were similar, only differing in their terminal nine residues. To further characterize the features of both soluble Kb molecules within living cells, we attached GFP to the C-termini of both truncated molecules. The resulting intensified fluorescence from sKbCP–GFP indicates that most of such molecules were accumulated within cells. Furthermore, we designed a novel method, named IFP, in order to evaluate the association of various GFP-tagged Kb molecules with other proteins. The results showed that 60% of sKbCP–GFP molecules were associated with calnexin, while <10% with tapasin. Taken together with the results from sKbCYT–GFP and mKb–GFP, it is reasonable to deduce that the CP segment is involved in the association of class I molecules with calnexin.

However, it is critical to define whether the additional GFP tag might interfere with the folding process of the target protein (21). Different consideration should be given to GFP-tagged transmembrane Kb and its soluble form. After the synthesis of GFP-tagged transmembrane Kb heavy chain, only proximal domains of Kb ({alpha}1, {alpha}2 and {alpha}3) entered into the lumen of the ER, while both the cytoplasmic domain and the following GFP-tag faced the cytosol. Thus, it is unlikely that the GFP-tag affects the lumenal domains across the membrane. As to the GFP-tagged soluble version, however, all the full-length chimeric chain entered into the lumen of the ER after its synthesis. The fact that the level of secreted GFP-tagged soluble molecules was comparable with that of GFP-untagged counterparts suggests that the interference of GFP tagging with the folding process of Kb molecules, if it exists, is minimal.

The fact that the association of calnexin with the CP-containing soluble Kb molecule almost blocks its transport raises an interesting question about how the wild-type Kb, which also contains the CP segment, dissociates from calnexin and then transports to the cell surface. As yet, there have been no direct demonstrations of the molecular events determining the release of class I molecules from calnexin. The most plausible explanation is that the conformational change during class I assembly may induce the dissociation of many chaperones (22). In human cells, class I binding to ß2m is thought to cause dissociation of calnexin (23). However, it is not the case for murine cells in which an increased association between calnexin and Db–ß2m complexes was observed in TAP-deficient RMA-S cells (24).

We speculate that the association of integral class I molecules with calnexin may involve a kinetic model in which the CP segment is necessary for the association with calnexin, while the transmembrane or cytoplasmic domain may regulate the release from calnexin. The fact that GPI-anchored class I molecules can be expressed normally on the cell surface suggests that the cytoplasmic tail may not play a major role in this process. Our results argue that the transmembrane domain or GPI might play an unexpected role in regulating the transport of class I molecules, although the difference between the transmembrane domain and GPI anchor cannot be defined at present. Generally the driving force could be generated from the potential movement of the transmembrane region along the plane of the membrane and can be perturbed by the addition of GFP at the end of the CYT (Fig. 2AGo). However, deletion of the transmembrane region might lose the driving force, resulting in the almost permanent association with calnexin, as confirmed by the blocked transport of sKbCP–GFP in COS7 cells.

During the class I assembly process, the conformational change of the lumenal domains of class I molecules could induce calnexin dissociation by binding to other chaperones, such as calreticulin and tapasin. Compelling evidence suggested that the absence of either ß2m or peptide could cause the increased association with calnexin (25,26). Thus the kinetic association of class I molecules with calnexin is a result of a balance involving several forces. The different role played by the CP and transmembrane domain is unexpected, and may provide evidence to explain the behavior of different MHC class I molecules. The analysis of the maturation rate of MHC class I molecules has shown marked differences between several class I alleles (2729). Interestingly, the fast and slow maturation alleles have different residues in the CP segment. The former, such as Kb and Kk, contain EPPPSTVSN in their CP segment, whereas the CP of the latter, such as Dk, Db and Ld, consists of EPPPSTDSY. Whether the two different residues (italic letter) determine the varied association forces with calnexin remains to be identified.

On the other hand, the forces provided by the transmembrane region might also play a role in preventing the degradation of class I molecules. Previous experiments suggested that the misfolded heavy chain could be removed from the ER to the cytosol and degraded by the proteasome (30). However, the machinery responsible for this event is unclear. Our results imply that the calnexin-associated sKbCP could be more easily translocated from the ER lumen to the cytosol, suggesting calnexin might play an important role in mediating the `retrotranslocation' by translocan (31). Up till now, it has been much more difficult to analyze the exclusive forces than the associate interaction between transmembrane domains. The results obtained from detergent solution may not reflect the situation in vivo where the components of the complex remain membrane bound. It is known that the assembly machinery of the ER consists of some integral membrane proteins and several lines of evidence have also suggested that the transmembrane regions play different roles in their function (32,33). The subtle nature of the transmembrane interaction raises the prospect that other integral proteins may be similarly engaged in the putative kinetic model in regulating their transport within cells.


    Acknowledgments
 
We thank P. Cresswell (Yale University) for providing anti-Tapasin, R.gp48N and cell line CEM.NKR, S. G. Nathenson (Albert Einstein College of Medicine) for providing antiserum of ant-X8, the Department of Histology & Embryology for the help with confocal microscope analysis, and Drs Yewdell and Bennink (National Institute of Health) for critical review. This work was supported by the National Natural Science Foundation in China (to S. B. Q.) and the Developing Foundation of Shanghai Education Committee (to S. B. Q.).


    Abbreviations
 
ß2m ß2-microglobulin
CP connecting peptide
CYT cytoplasmic tail
ER endoplasmic reticulum
GFP green fluorescent protein
GPI glycophosphatidylinositol
IFP immunofluorescence precipitation
PE phycoerythrin

    Notes
 
Transmitting editor: T. Sasazuki

Received 31 January 2000, accepted 21 June 2000.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Townsend, A., Ohlen, C., Bastin, J., Ljunggren, H. G., Foster, L. and Karre, K. 1989. Association of class I major histocompatibility heavy and light chains induced by viral peptides. Nature 340:443.[Medline]
  2. Yewdell, J. W. and Bennink J. R. 1992. Cell biology of antigen processing and presentation to MHC class I molecule-restricted T lymphocytes. Adv. Immunol. 52:1.[ISI][Medline]
  3. Carreno, B., Schreiber, K., McKean, D., Stroynowski, I. and Hansen, T. 1995. Aglycosylated and phosphatidylinositol-anchored MHC class I molecules are associated with calnexin. J. Immunol. 154:5173.[Abstract]
  4. Scott, J. and Dawson, J. 1995. MHC class I expression and transport in a calnexin deficient cell line. J. Immunol. 155:143[Abstract]
  5. Wada, I., Ou, W. J., Liu, M. C. and Scheele, G. 1994. Chaperone function of calnexin for the folding intermediate of gp80, the major secretory protein in MDCK cells. Regulation by redox state and ATP. J. Biol. Chem. 269:7464.[Abstract/Free Full Text]
  6. Ho, S. C., Rajagopalan, S., Chaudhuri, S., Shieh, C. C., Brenner, M. B. and Pillai, S. 1999. Membrane anchoring of calnexin facilitates its interaction with its targets. Mol. Immunol. 36:1.[ISI][Medline]
  7. Capps, G. G. and Zuniga, M. C. 1994. Class I histocompatibility molecule association with phosphorylated calnexin. Implications for rates of intracellular transport. J. Biol. Chem. 269:11634.[Abstract/Free Full Text]
  8. Cerundolo, V. and Veronique, B. 1996. Cell biology of MHC class I molecules. In Browning, M. J. and McMichael, A. J., eds, HLA and MHC: Genes, Molecules and Function, p. 193. BIOS, Oxford.
  9. Sadasivias, B., Lehner, P. J., Ortmann, B., Spies, T. and Cresswell, P. 1996. Roles for calreticalin and novel glycoprotein, tapasin, in the interaction of MHC class I molecules with TAP. Immunity 5:103.[ISI][Medline]
  10. Hochstenbach, F., David, V., Watkins, S. and Brenner, M. B. 1992. Endoplasmic reticulum resident protein of 90 kilodaltons associates with the T- and B-cell antigen receptors and major histocompatibility complex antigens during their assembly. Proc. Natl Acad. Sci. USA 89:4734.[Abstract/Free Full Text]
  11. Smith, M. H., Parker, J. M., Hodges, R. S. and Barber, B. H. 1986. The preparation and characterization of anti-peptide heteroantisera recognizing subregions of the intracytoplasmic domain of class I H-2 antigens. Mol. Immunol. 23:1077.[ISI][Medline]
  12. Prasad, S. A., Yewdell, J. W., Porgador, A., Sadasivian, B., Cresswell, P. and Bennink, J. R. 1998. Calnexin expression does not enhance the generation of MHC class I–peptide complexes. Eur. J. Immunol. 28:907.[ISI][Medline]
  13. Alexander, J., Payne, J. A., Murray, R., Frelinger, J. and Cresswell, P. 1989. Differential transport requirements of HLA and H-2 class I glycoproteins. Immunogenetics 29:380.[ISI][Medline]
  14. Fahnestock, M., Tamir, I., Narhi, L. and Bjorkman, P. 1992. Thermal stability comparison of purified empty and peptide-filled forms of a class I MHC molecule. Science 258:1658.[Abstract/Free Full Text]
  15. Ortiz, N. V. and Hammerling, G. J. 1991. Surface appearance and instability of empty H-2 class I molecules under physiological conditions. Proc. Natl Acad. Sci. USA 88:3594.[Abstract/Free Full Text]
  16. Misteli, T. and Spector, D. L. 1997. Applications of the green fluorescent protein in cell biology and biotechnology. Nat. Biotechnol. 14:610.
  17. Cosson, P. and Bonifacino, J. S. 1991. Membrane protein association by potential intramembrane charge pairs. Nature 351:414[Medline]
  18. Cosson, P. and Bonifacino, J. S. 1992. Role of transmembrane domain interactions in the assembly of class II MHC molecules. Science 258:659.[Abstract/Free Full Text]
  19. Jackson, M. R., Cohen-Doyle, M. F., Peterson, P. A. and Williams, D. B. 1994. Regulation of MHC class I transport by the molecular chaperone, calnexin (p88, IP90). Science 263:384.[Abstract/Free Full Text]
  20. Ortmann, B., Androlewicz, M. J. and Cresswell, P. 1994. MHC class I/ß2-microglobulin complexes associate with TAP transporters before peptide binding. Nature 368:864.[Medline]
  21. Cubitt, A B., Heim, R., Adams, S. R., Boyd, A. E., Gross, L. A. and Tsien, R. Y. 1995. Understanding, improving and using green fluorescent proteins. Trends Biol. Sci. 20:448.
  22. Koopmann, J.-O., Hammerling, G. J. and Momtury, F. 1997. Generation, intracellular transport and loading of peptides associated with MHC class I molecules. Curr. Opin. Immunol. 9:80.[ISI][Medline]
  23. Sugita, M. and Brenner, M. B. 1994. An unstable beta-2-microglobulin: major histocompatibility class I heavy chain dissociates from calnexin and then is stabilized by binding peptide. J. Exp. Med. 180:2163.[Abstract/Free Full Text]
  24. Degen, E., Cohen-Doyle, M. F. and Williams, D. B. 1992. Efficient dissociation of the p88 chaperone from major histocompatibility class I molecules requires both ß2 microglobulin and peptide. J. Exp. Med. 175:1653.[Abstract/Free Full Text]
  25. Ou, W.-J., Cameron, P. H., Thomas, D. Y. and Bergeron, J. J. M. 1993. Association of folding intermediates of glycoproteins with calnexin during protein maturation. Nature 364:771.[Medline]
  26. Rajagopalan, S. and Brenner, M. B. 1994. Retention of unassembled components of integral membrane proteins by calnexin. Science 263:387.[Abstract/Free Full Text]
  27. Williams, D., Sweiedler, S. and Hart, G. 1985. Intracellular transport of membrane glycoproteins: two closely related histocompatibility antigens differ in their rates of transmit to the cell surface. J. Cell. Biol. 101:725.[Abstract/Free Full Text]
  28. Weis, J. and Murre, C. 1985. Differential expression of H-2Dd and H-2Ld histocompatibility antigens. J. Exp. Med. 161:356.[Abstract/Free Full Text]
  29. Beck, J., Hansen, T., Cullen, S. and Lee, D. 1986. Slower processing, weaker ß2-m association, and lower surface expression of H-2Ld are influenced by its amino terminus. J. Immunol. 13:916.
  30. Hughes, E. A., Hammond, C. and Cresswell, P. 1997. Misfolded major histocompatibility complex class I heavy chains are translocated into the cytoplasm and degraded by the proteasome. Proc. Natl Acad. Sci. USA 94:1896.[Abstract/Free Full Text]
  31. Walter, P. and Johnson, A. E. 1994. Signal sequence recognition and protein targeting to the endoplasmic reticulum membrane. Annu. Rev. Cell Biol. 10:87.[ISI]
  32. Lee, N., Malacko, A. R., Ishitani, A., Chen, M. C., Bajorath, J., Marquardt, H. and Geraghty, D. E. 1995. The membrane-bound and soluble forms of HLA-G bind identical sets of endogenous peptides but differ with respect to TAP association. Immunity 3:591.[ISI][Medline]
  33. Lehner, P. J., Surman, M. J. and Cresswell, P. 1998. Soluble tapasin restores MHC class I expression and function in the tapasin-negative cell line 220. Immunity 8:221.[ISI][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Qian, S.-B.
Right arrow Articles by Chen, S.-S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Qian, S.-B.
Right arrow Articles by Chen, S.-S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?