Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (12)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Kikuchi, Y.
Right arrow Articles by Takatsu, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kikuchi, Y.
Right arrow Articles by Takatsu, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 12, No. 10, 1397-1408, October 2000
© 2000 Japanese Society for Immunology

Identification and characterization of a molecule, BAM11, that associates with the pleckstrin homology domain of mouse Btk

Yuji Kikuchi1,2, Masayuki Hirano1, Masao Seto3 and Kiyoshi Takatsu1

1 Department of Immunology, Institute of Medical Science, University of Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108-8639, Japan
2 Laboratory of Molecular Immunology, Center for Basic Research, Kitasato Institute, 5-9-1 Shirokane, Minato-ku, Tokyo 108-8642, Japan
3 Department of Pathology, Aichi Cancer Center, Chikusa-ku, Nagoya 464-8681, Japan

Correspondence to: K. Takatsu,


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Note added in proof
 References
 
Bruton's tyrosine kinase (Btk) is required for normal B cell development and signal transduction through cell surface molecules, and its defects lead to X-linked immune deficiency in mice and X-linked agammaglobulinemia in humans. In this report, we will describe the identification and characterization of a molecule, BAM11, which binds to the pleckstrin homology domain of Btk. A sequence homology search revealed that BAM11 has 89% homology, at the amino acid level, to human LTG19/ENL, that was originally identified as one of the fusion partners involved in chromosomal translocations of 11q23, MLL/ALL-1/HRX, in leukemia cells. Deletion mutants demonstrated that the region of BAM11 required for binding to Btk was localized between amino acid residues 240 and 256. Forced expression of a truncated form of BAM11 (amino acids 246–368) inhibited IL-5-induced proliferation by 50%, whereas forced expression of full-length BAM11 in Y16 cells did not affect the IL-5 responsiveness. We have also shown that BAM11 (amino acids 246–368) inhibited the kinase activity of Btk. These results suggest that the binding of BAM11 to Btk plays a regulatory role in the Btk signal transduction pathway. A cell fractionation study and analysis using EGFP-fused Btk protein demonstrated that a proportion of Btk is present within the nucleus.

Keywords: IL-5, LTG19, ENL, signal transduction


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Note added in proof
 References
 
Bruton's tyrosine kinase (Btk) is a member of the Btk/Tec family of cytoplasmic tyrosine kinases, and has been implicated in cytoplasmic signal transduction through cell surface molecules including B cell receptor (BCR) (1,2), high-affinity Ig E receptor (Fc{varepsilon}RI) (3,4) and cytokine receptors (5). Mutation of Btk causes X-linked immunodeficiency (Xid) in mice (6,7) and X-linked agammaglobulinemia (XLA) in humans (8,9). B cells from Xid mice carry a single amino acid substitution (Arg28 to Cys) in Btk and have defects in their responses to stimulation via BCR (10), IL-5 receptor (11,12), IL-10 receptor (13), Fc{varepsilon}RI (14) and CD38 (15,16). Thus, Btk appears to be critical for multiple signaling pathways that are important for B cell development and activation. It was also recently demonstrated that Fc{varepsilon}RI-induced degranulation was reduced in Xid mast cells (17).

Like other Btk/Tec family kinases, Btk is composed of pleckstrin homology (PH), and unique Tec homology (TH), SH3, SH2 and kinase domains in this order from the N to C termini (18). The catalytic activity of Btk seems to be controlled by regulatory interactions with other molecules (1). The proline-rich sequence within the TH domain mediates interactions with the SH3 domains of Src family kinases (19). It has been shown that phosphorylation of Tyr551 by a Src family kinase induces the autophosphorylation of Tyr223 and augmented kinase activity (20,21). We previously reported that Lyn is upstream of Btk activation in CD38 signaling (22). Lyn may interact with the TH domain of Btk via its SH3 domain and phosphorylate a tyrosine residue in Btk. Recently, a novel Btk–SH3 binding protein, Sab, has been described and it negatively regulates Btk kinase activity (23,24).

PH domains have been found in many proteins involved in signal transduction as well as in cytoskeletal proteins (25,26). Several molecules, including ß{gamma} complexes of heterotrimeric G protein (27), protein kinase C (PKC) (28), phosphatidylinositol[3,4,5]triphosphate (PIP3) (29,30), BAP-135/TFII-I (31,32) and the filamentous form of actin (33), have been shown to interact with the PH domain of Btk. BCR stimulation induces interaction between the PH domain of Btk and PIP3 and recruits Btk to membrane fraction (34). Btk is able to modulate tyrosine phosphorylation of phopholipase C and sustained calcium release and flux in B cells (30,35).

To further elucidate the regulatory mechanism of Btk activity and its signaling pathway, we attempted to identify additional proteins that interact with Btk and now describe one protein, BAM11, that associates with the Btk PH domain in vivo. A sequence homology search revealed that BAM11 has 89% homology (at the amino acid level) to human LTG19/ENL, which was originally identified as one of the fusion partners involved in the chromosomal translocations of 11q23, MLL/ALL-1/HRX, in infantile leukemias (36,37). We also provide evidence that BAM11 participates in regulation of Btk kinase activity.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Note added in proof
 References
 
Screening and isolation of murine BAM11 cDNA
A cDNA fragment of the Btk PH domain (corresponding to amino acids 1–153) was generated by PCR using murine Btk cDNA as a template and cloned into the bacterial expression vector pGEX-2a (Amersham Pharmacia Biotech, Uppsala, Sweden). The glutathione S-transferase (GST) fusion protein was induced and purified by Bulk GST Purification Module (Amersham Pharmacia Biotech). A {lambda}gt11 cDNA library made from IL-5-dependent early B cell line, Y16 (38), was screened using GST–Btk (PH) as the probe. Phage clones (1.0x106) were plated at a density of 5x104 plaques per 140 mmx100 mm agarose plate. After incubation for 4 h at 42°C, the plates were overlaid with nitrocellulose filters presoaked in 10 mM isopropyl-D-galactopyranoside, as described (39). Incubation was continued for 4 h at 37°C to induce the protein. The filters were then removed, washed with TBST (10 mM Tris–HCl, pH 7.5, 150 mM NaCl and 0.05% Tween-20) at 4°C and blocked using TBST containing 5% skim milk for 30 min at 4°C. After blocking, the GST–Btk (PH) probes were added at a concentration of 1 µg/ml and the incubation was continued overnight at 4°C. The filters were washed with TBST 3 times and incubated with anti-GST antiserum (1:1000 dilution) (39) for 2 h at 4°C. The filters were again washed with TBST 3 times, followed by an incubation with alkaline phosphatase-conjugated swine anti-rabbit IgG (Dako, Glostrup, Denmark; 1:1000 dilution) for 1 h at 4°C. After washing with TBST, the filters were incubated with alkaline phosphatase reaction solution [0.5 mM MgCl2 and 25 mM Na2CO3 (pH 9.8), containing 0.4 mM of nitroblue tetrazolium and 0.4 mM 5-bromo-4-chloro-3-indolylphosphate-p-toluidine salt (Wako Junyaku, Tokyo, Japan)]. To obtain specific clones that bound to the PH domain of Btk, the clones were probed with the GST-Btk (PH) or GST respectively at the third screening.

Cell lines and antibodies
Y16 and IL-2-dependent CTLL (40) were maintained in RPMI 1640 supplemented with 8% FCS, 100 U/ml penicillin, 100 µg/ml streptomycin and 50 µM 2-mercaptoethanol in the presence of IL-5 (5 U/ml) and IL-2 (5 U/ml). Rabbit anti-Btk polyclonal antibody was produced by immunization with a peptide fragment of mouse Btk, amino acid residues 176–193. In some experiments we used goat anti-Btk (C-20) (Santa Cruz Biotechnology, Santa Cruz, CA). Anti-T7-tag (Invitrogen, Carlsbad, CA), anti-myc (clone 9E10; ATCC, Rockville, MD), anti-FLAG (Sigma, St Louis, MO), anti-Tec (Upstate Biotechnology, Lake Placid, NY), anti-paxillin (Affiniti Research Products, Nottingham, UK) and anti-phosphotyrosine (clone 4G10; Upstate Biotechnology) antibodies were also purchased.

Vectors and constructs
pME18S-myc mammalian expression vector was provided by Tadashi Yamamoto (University of Tokyo). The DNA encoding the full-length BAM11 was amplified by PCR. The amplified products were cloned into the EcoRI sites of pME18S-myc to produce the plasmid pME18S-myc-BAM11. To produce FLAG-tagged Btk, DNA fragments encoding the full length of Btk were amplified by PCR. The amplified products were cloned between the BamHI and EcoRI sites of the pFLAG-mac vector (Sigma) to produce the plasmid pFLAG-Btk. For construction of GST fusion proteins, DNA fragments encoding the truncated form of BAM11, #11-1 (amino acids 1-368), #11-2 (amino acids 131–256), #11-3 (amino acids 240–368) or #11-4 (amino acids 363–547) were amplified by PCR. The amplified products were cloned into EcoRI sites of pGEX-4T (Amersham Pharmacia Biotech). To generate T7 epitope-tagged Btk, the DNA fragments encoding full-length Btk were amplified by PCR using forward and reverse primers incorporated EcoRI sites at their 5' ends. The reverse primer also contained a sequence encoding T7 sequences (MASMTGGQQMG). The amplified products were cloned into the EcoRI sites of pApuro vector, provided by Tomohiro Kurosaki (Kansai Medical University, Moriguchi, Osaka, Japan). To produce Btk mutant lacking the PH domain, the DNA fragments encoding amino acids 138–659 of Btk were amplified by PCR using forward (AGAGCTCGAGCCATGCTGGTACAGAAATACCAT) and reverse (AGAGCGGCCGCTCAGGATTCTTCATCCATC) primers, and the amplified products were cloned between XhoI and NotI sites of the pME18S vector. To produce EGFP fusion constructs, the DNA fragments encoding Btk, Btk (K430R) and GAPDH were amplified by PCR. These amplified products were cloned into pEGFP-N1 vectors (Clontech, Palo Alto, CA). All constructions were verified by nucleotide sequencing.

Preparation of cell lysates of IL-5-stimulated Y16 transfectants
Y16, Y16/BAM11 (full), Y16/BAM11 (amino acids 1–186) and Y16/BAM11 (amino acids 240–368) cells were deprived of IL-5 for 15 h of incubation before stimulation. Subsequently, cells were cultured at 107 cells/ml with 2000 U/ml of IL-5 for 5 min at 37°C. They were then harvested by centrifugation and lysed in ice-cold lysis buffer (2x107 cells/ml) containing 20 mM Tris–HCl, pH 7.4, 150 mM NaCl, 1% Triton X-100, 10% glycerol, 2 mM EDTA, 100 U/ml aprotinin, 1 mM NaF, 1 mM Na3VO4 and 10 µg/ml leupeptin. Unsolubilized materials were removed by centrifugation for 15 min at 12 000 g.

Immunoprecipitation and Western blot analysis
Cell lysates were prepared and subjected to immunoprecipitation as previously described (5). Briefly, cell lysates of Y16 transfectants and Cos7 cells expressing Btk/myc-BAM11 or Btk (amino acids 138–659)/myc-BAM11 were precleared with Protein G–Sepharose 4B and incubated at 4°C overnight with 10 µg of anti-Btk antibody or anti-Tec antibody. Immune complexes were collected on Protein G–Sepharose during a 60 min incubation at 4°C, washed 5 times with lysis buffer and boiled for 5 min with 2xLaemmli's sample buffer. For the Western blot, samples were electrophoresed on SDS–polyacrylamide gels (8%) and transferred to an Immobilon-P membrane (Nihon Millipore, Tokyo, Japan). After blocking with TBS containing 5% BSA the membranes were incubated with the appropriate primary antibody and washed in TBS containing 0.1% Tween 20 (TBS-T). After incubation with goat anti-mouse IgG or goat anti-rabbit IgG secondary antibodies coupled to horseradish peroxidase, the membranes were washed 4 times with TBS-T and subjected to an ECL detection system (Amersham Pharmacia Biotech).

Binding assay for GST fusion proteins with Btk
Interaction of the GST fusion proteins made from truncated BAM11 attached to Btk was examined as follows. Equal amounts of GST fusion proteins were incubated with bacterial cell lysates expressing FLAG-Btk for 4 h at 4°C and washed with 0.1% of Triton X-100. After adding the SDS–PAGE sample buffer, the precipitates bound to GST fusion proteins were eluted by boiling and examined by immunoblotting with the anti-FLAG mAb.

Proliferation assay
Y16, CTLL or their transfectants (1x104/well) were cultured for 48 h with various concentrations of IL-5 or IL-2. The cells were pulse labeled with [3H]thymidine (0.2 µCi/well) during the last 6 h of their 48 h culture period and the incorporation of radioactivity was measured.

In vitro kinase assay
The T7-Btk pApuro vector was transfected into Cos7 cells. After 48 h, the cells were lysed with a kinase lysis buffer (1% Triton X-100, 10 mM NaH2PO4/Na2HPO4, pH 7.0, 150 mM NaCl, 5 mM EDTA, 1 mM PMSF and 10 µg/ml leupeptin) and the T7 epitope-tagged Btk protein was immunopurified using anti-T7-tag antibody and Protein G–Sepharose beads (Amersham Pharmacia Biotech). The purified GST–Btk protein expressed by insect cells using the baculovirus expression system was provided by Keisuke Horikawa (University of Tokyo). The T7– or GST–Btk was dissolved in kinase buffer and the appropriate amount of GST fusion proteins and 2 µg of a peptide, containing the Btk autophosphorylation site (KKVVALYDYMPMN), were added. The reaction was initiated by addition of 20 µCi of [{gamma}-32P]ATP (Amersham Pharmacia Biotech) and 20 pmol of unlabeled ATP, and then allowed to proceed for 5 min at 25°C, and finally stopped by adding cold ATP and EDTA. The mixture was then transferred onto P81 phosphocellulose paper. After washing, the amount of incorporated [{gamma}-32P]ATP was measured using a scintillation counter.

Subcellular fractionation
The cells were washed twice with SET (150 mM NaCl, 50 mM Tris–HCl and 1 mM EDTA, pH 7.2) and scraped into hypotonic buffer (1 mM EGTA, 1 mM EDTA, 1 mM Na3VO4, 2 mM MgCl2, 10 mM KCl, 1 mM dithiothreitol, 40 µg/ml PMSF, 10 µg/ml pepstain and 10 µg/ml leupeptin) (41). The cells were incubated for 30 min on ice and then dounce-homogenized. The homogenate was loaded onto 1 ml of 1 M sucrose cushion and centrifuged at 1600 g for 10 min to pellet the nuclei. The supernatants were fractionated into pellets (membrane fraction) and supernatants (cytosol fraction) by centrifugation at 100,000 g for 30 min at 4°C. The nuclear pellet was solubilized in hypotonic lysis buffer containing 0.5% Nonidet P-40, 0.1% deoxycholate and 0.1% Brij-35, and then centrifuged at 12,000 g for 15 min to remove any insoluble material. We monitored the purity of each fraction by measuring the activity of cytosol marker enzyme, lactate dehydrogenase, as previously described (42).

Histochemistry
The Btk–EGFP, Btk (K430R)–EGFP, GAPDH–EGFP and myc-BAM11 constructs were introduced into Cos7 cells using electropolation. After 48 h, the cells were collected and fixed onto 0.1% poly-L-lysine-treated glass slides. For the staining of myc-BAM11, glass slides were incubated with mouse anti-myc antibody (9E10) followed by FITC-conjugated rabbit anti-mouse IgG. All samples were incubated with 0.1 mg/ml of propidium iodide (PI) for 15 min at room temperature. The localization of the EGFP fusion proteins and BAM11 was monitored by confocal laser scanning microscopy (CLSM) (BioRad, Hercules, CA)


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Note added in proof
 References
 
Isolation of a molecule which binds to the PH domain of Btk
We used an expression cloning technique to isolate a molecule that associates with the PH domain of Btk. A fusion protein made from GST and the Btk PH domain (GST–BTK-PH) was used as a probe to screen a {lambda}gt11 cDNA expression library originating from the murine early B cell line Y16. Induced {lambda}gt11 recombinant proteins from the cDNA library were transferred to nitrocellulose filters and the filters were hybridized with GST–Btk-PH. By the third round of screening with 1.0x106 independent phage clones, three clones demonstrated prominent binding to GST–Btk-PH, but not to GST protein alone. The nucleotide sequence of these clones indicated that each clone originated from different mRNAs. One of these clones (clone #11) was selected for isolation of full-length cDNA and further analysis. Using the 5'- and 3'-RACE method, a full-length cDNA was obtained. Sequence analysis of this full-length cDNA revealed that the predicted open reading frame is 1641 nucleotides, which encodes 547 amino acid residues (Fig. 1Go). This protein was termed BAM11 (Btk Associated Molecule-11). Northern blotting analysis demonstrated that the transcripts of this gene are expressed in a variety of murine tissues (brain, heart, thymus, liver, spleen, lymph node, bone marrow, intestine, muscle and lung) (data not shown). A sequence homology search revealed that BAM11 has 89% homology to human LTG19/ENL at the amino acid level (Fig. 2Go).



View larger version (70K):
[in this window]
[in a new window]
 
Fig. 1. Nucleotide sequence and deduced amino acid sequence of BAM11. The nucleotide sequence is shown on the upper line; the deduced amino acid sequence is shown on the lower line. The numerical positions of the nucleotides are also shown.

 


View larger version (102K):
[in this window]
[in a new window]
 
Fig. 2. Sequence homology of BAM11 with human LTG19/ENL. The deduced amino acid sequences from BAM11 cDNA and human LTG19/ENL are aligned using GENETYX-MAC software. Identical amino acids are boxed. The possible tyrosine kinase phosphorylation motifs of [R/K]-[X2/X3]-[D/E]-[X2/X3]-Y are underlined. The nuclear localization sequences in the BAM11 are depicted as overlined.

 
Btk association with BAM11 in cells
To analyze the in vivo association between Btk and BAM11, human myc epitope-tagged BAM11 was expressed in Y16 cells. The cell lysates were immunoprecipitated with anti-Btk antibody and co-precipitated myc-BAM11 was detected by immunoblotting with monoclonal anti-human myc antibody. A 78–80 kDa band was found in immunoprecipitates with anti-Btk antibody of myc-BAM11-transfected Y16 cells, but not in immunoprecipitates from non-transfected Y16 cells (Fig. 3AGo, lane 3 versus lane 1). To clarify the binding specificity of BAM11 to Btk, the association of BAM11 with Tec was examined using anti-Tec antibody for immunoprecipitation. BAM11 protein was not detected in the immunoprecipitates following anti-Tec antibody treatment (Fig. 3AGo, lane 4). Involvement of the PH domain of Btk in the in vivo interaction between Btk and BAM11 was confirmed by using Cos7 cells expressing wild-type Btk or Btk lacking the PH domain. As shown in Fig. 3Go(B), association of Btk with BAM11 was detected when wild-type Btk and BAM11 were co-expressed in Cos7 cells, but was not detected when Btk lacking the PH domain was expressed (Fig. 3BGo, lane 2 versus lane 3). These results suggest that Btk interacts with BAM11 via the PH domain in vivo and demonstrate that BAM11 associates with the PH domain of Btk in cells, but not with the PH domain of Tec kinase.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 3. Associations between BAM11 and Btk in cells. (A) Y16 cells or myc epitope-tagged BAM11-expressing Y16 transfectants were lysed and immunoprecipitated with anti-Btk (lanes 1 and 3) or anti-Tec (lane 4) antibody. The precipitates were separated using SDS–PAGE, transferred to membranes and blotted with anti-myc antibody. Preimmune rabbit sera were used as a control (lane 2) (upper panel). The blot was stripped and reprobed with anti-Btk or anti-Tec antibodies (lower panel). (B) Cos7 cells transfected with Btk (wild-type) together with myc-BAM11 (lane 2) or Btk lacking the PH domain (amino acids 138–659) together with myc-BAM11 (lane 3) or non-transfected Cos7 cells (lane 1) were lysed and immunoprecipitated with anti-Btk antibody. The precipitates were separated using SDS–PAGE, transferred to membranes and blotted with anti-myc antibody (upper panel). The blot was stripped and reprobed with anti-Btk antibody (lower panel).

 
Determination of the region in BAM11 responsible for the association with Btk
In order to determine the BAM11 Btk-binding region, we generated GST fusion proteins containing full-length BAM11 and various truncated mutants (Fig. 4Go). By using the same amounts of GST fusion protein conjugated onto glutathione-coupled Sepharose beads, we carried out binding assays for association with Btk. When bacterial cell lysates expressing FLAG-tagged Btk were incubated with GST alone, no Btk protein was detected by immunoblotting (Fig. 4Go). However, the GST fusion proteins containing full-length BAM11 (GST-#11-full) did bind Btk. Furthermore, the GST fusion protein, GST-#11-1 (containing amino acids 1-368), GST-#11-2 (amino acids 131–256) and GST-#11-3 (amino acids 240–368) was able to bind Btk, but GST-#11-4 (amino acids 363–547) was observed not to bind Btk. These findings indicate that the region of BAM11 responsible for binding to Btk lies between amino acid residues 240 and 256. It should be noted that the other regions of BAM11 may also contribute to certain extent to the binding of Btk, since the amounts of Btk bound to each BAM11 truncated protein differed.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 4. Location of the Btk binding site in BAM11. Upper panel shows the schematic representation of the deletion mutants of GST–BAM11 fusion proteins used for the binding assay (upper panel). Equal amounts of the deletion mutants of GST–BAM11 fusion proteins were bound to glutathione-coupled Sepharose beads and incubated with bacterial cell lysates expressing FLAG–Btk for 4 h at 4°C. The precipitated complexes were then separated using SDS–PAGE, transferred to membranes and blotted with an anti-FLAG antibody (lower panel).

 
Effect of the overexpression of BAM11 protein on IL-5 signaling
As we reported (5), Y16 exhibits not only IL-5-dependent proliferation but also enhanced Btk activity upon IL-5 stimulation. So we examined whether forced expression of BAM11 proteins affected IL-5-induced proliferation in Y16. cDNA for BAM11/full-length, BAM11/aa1–186 and BAM11/aa240–368 were stably transfected into Y16 or CTLL. Clones thus established were stimulated with IL-5 or IL-2 and the uptake of [3H]thymidine was determined. Three independent clones expressing the same levels of transgene-derived BAM11 proteins were examined for each transfectant and similar results were obtained. The representative results are shown in Fig. 5Go. As shown in Fig. 5Go(A), forced expression of BAM11/full and BAM11/aa1–186 did not affect IL-5-induced proliferation, while the proliferative response was reduced by 50% in the clones that overexpressed BAM11/aa240–368. The degree of the reduction was dependent on the expression levels of the BAM11/aa240–368 (Fig. 5CGo). CTLL clones expressing either BAM11/full, BAM11/aa1–186 or BAM11/aa240–368 did not show any reduction in IL-2 responsiveness (Fig. 5BGo).



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 5. Effects of BAM11 protein overexpression on IL-5- or IL-2-induced proliferation and Btk activation. BAM11/full, BAM11/aa1–186 and BAM11/aa240–368 proteins were stably overexpressed in Y16 cells (A) or CTLL cells (B). Parental cells ({square}), BAM11/full (•), BAM11/aa1–186 ({circ}) and BAM11/aa240–368 ({blacktriangleup}) transfectants (1x104/well/0.2 ml) were cultured with various concentrations of IL-5 (A) or IL-2 (B). The cells were pulse labeled with [3H]thymidine for the last 6 h of 48 h cultures. Clones expressing different amounts of BAM11/aa240–368 (•, {blacksquare} and {blacktriangleup}) and parental Y16 cells ({square}) were cultured with various concentrations of IL-5 (C, upper). Level of expressed BAM11/aa240–368 in each transfectant was estimated by Western blot (C, lower). Results represent the mean ± SD of triplicate determinations. (D): Y16, Y16/BAM11(full), Y16/BAM11(amino acids 1–186) and Y16/BAM11(amino acids 240–368) cells were stimulated with 2000 U/ml mIL-5 for 5 min. Cells were lysed and immunoprecipitated with anti-Btk antibody. Immune complexes were subjected to Western blotting using anti-phosphotyrosine mAb (4G10) and tyrosine-phosphorylated Btk were detected by the ECL assay. There were two tyrosine-phosphorylated bands around 78 kDa, the lower band corresponded to Btk (upper). The same blot was stripped and reprobed with anti-Btk antibody (lower panel).

 
Inhibition of Btk kinase activity by BAM11
The inhibitory effect of BAM11/aa240–368 overexpression on the IL-5-induced proliferation described above led us to evaluate whether the BAM11 protein regulates Btk kinase activity. Then, we examined Btk activities after IL-5 stimulation in Y16 transfectants. In contrast to the marked enhancement of autophosphorylation of Btk in parental Y16 cells, BAM11/full and BAM11/aa1–186 transfectants, enhancement of Btk autophosphorylation in the BAM11/aa240–368 transfectant was weak (Fig. 5DGo). The analysis by densitometery revealed that the extent of the enhancement of Btk autophosphorylation in BAM11/full and BAM11/aa1–186 transfectants were comparable with that of Y16, whereas the enhancement of Btk autophosphorylation in the BAM11/aa240–368 transfectant was reduced by 60% (data not shown). Next, to examine direct effects of BAM11 on Btk kinase activity, we carried out an in vitro kinase assay on Btk in the presence of BAM11 proteins. T7 epitope-tagged murine Btk was immunopurified from the lysate of Cos7 cells transfected with T7 epitope-tagged murine Btk cDNA as described in Methods. The kinase activity of the immunopurified Btk expressed by Cos7 cells was assayed using a peptide substrate with the sequence KKVVALYDYMPMN, which corresponded to the amino acid residues 217–229 of murine Btk. The tyrosine at residue 223 in this sequence is the Btk autophosphorylation site. This peptide does not contain any serine or threonine residues and has been shown to be a good substrate for Btk (24,43). As shown in Fig. 6Go(A), the kinase activity of immunopurified Btk was inhibited by the addition of GST-BAM11/aa240–368 protein to the reaction in a dose-dependent manner. In contrast, no inhibition of Btk kinase activity was observed following the addition of GST protein alone or GST-BAM11/aa1–186 protein. These results suggest that BAM11/aa240–368 acts as an inhibitor of Btk kinase activity. To exclude the effects of other cellular protein which could be co-immunoprecipitated with Btk from the mammalian cells, we also used recombinant GST–Btk which was expressed by insect cells. Like Btk expressed by Cos7 cells, the kinase activity of Btk expressed by insect cells was inhibited by GST-BAM11/aa240–368 protein (Fig. 6BGo). We infer from these results that the reduction of IL-5 responsiveness by the overexpression of BAM11/aa240–368 in Y16 cells might be due to inhibition of the IL-5-enhanced Btk activity.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 6. Effects of BAM11 protein on the kinase activity of Btk. Immunoprecipitated Btk expressed by Cos7 cells (A) or insect cells (B) was mixed with the indicated concentrations of GST ({square}), GST-BAM11/full (•), GST-BAM11/aa1–186 ({circ}) or GST-BAM11/aa240–368 ({blacktriangleup}) proteins. The in vitro kinase assay was carried out using the peptide substrate as described in Methods.

 
Subcellular localization of Btk
As described above, BAM11 has 89% homology to human LTG19/ENL at the amino acid level. It has been shown that LTG19/ENL localizes in the nucleus (44) and BAM11 protein also contains nuclear targeting sequences (Fig. 2Go). In order to obtain further clues to the association pattern of Btk and BAM11, the subcellular localization of Btk in Y16 was determined. Cell lysates of Y16 were fractionated into nuclear and cytoplasmic fractions, and amounts of Btk protein in each fraction were detected by immunoblotting. We also used CTLL and Btk cDNA transfected CTLL as controls. The purity of each fraction was assessed by reprobing the same blot with anti-paxillin antibody that recognize paxillin, which is a cytoskeletal protein. Results revealed that contamination of cytoplasmic fractions into nuclear fractions were <10%. We also monitored lactate dehydrogenase activity that is also a cytoplasmic enzyme (42). The distribution of enzyme activity in each fraction from the Y16 cells was 91% cytosolic and 9% nuclear (data not shown). Btk protein (78 kDa) was found at a similar extent in both the nuclear and cytoplasmic fractions of Y16 and CTLL transfectants (Fig. 7Go, lanes 1–4), but not in the fractions from untransfected CTLL cells (Fig. 7Go, lanes 5 and 6). In this experiment, we used 10 µg of protein from each fraction. It should be noted that when we adjusted the amount of protein based on cell number (1.5x106), Btk proteins were detected only in the cytoplasmic fractions (data not shown).



View larger version (58K):
[in this window]
[in a new window]
 
Fig. 7. Subcellular localization of Btk. Y16, CTLL or CTLL-mBtk transfectants were homogenized in a hypotonic buffer. The nuclei were pelleted using a 1 M sucrose cushion. The supernatants the sucrose cushion were then centrifuged (150,000 g, 30 min) and used as the cytosol fraction. A 10 µg sample of proteins from each fraction was separated on SDS–PAGE, transferred to a PVDF membrane and blotted with anti-Btk antibody (upper panel). The blot was stripped and reprobed with an anti-paxillin antibody to examine the purity of each fraction (lower panel)

 
We then took a different approach to assess the subcellular localization of Btk. Btk–EGFP fusion protein was transiently expressed in Cos7 cells and analyzed by CLSM. Cos7 transfectants were fixed on glass slides and their nuclei were stained with propidium iodide (red). Since Btk–EGFP protein was detected as a green color, yellow spots indicated Btk proteins in the nuclei. As shown in Fig. 8Go(A), marked nuclear Btk staining, especially in the nuclear membrane area, was observed. These observations were consistence with the results of Western blot analysis using subcellular fractionation (Fig. 7Go). When a control cytoplasmic protein, GAPDH (45), was expressed in Cos7 cells, GAPDH was not detected in the nucleus (Fig. 8CGo). We also examined the relationship between Btk localization and Btk activity. Transfectants of the kinase inactivated (K430R) Btk mutant appeared to show a similar localization pattern in the nuclei to that of transfectants of wild-type Btk (Fig. 8BGo). These results suggest that the localization of Btk in nuclei is independent of Btk activity. We also stained myc-BAM11 transfectants with anti-myc antibody. Results revealed that like human LTG19/ENL protein (44), most of the BAM11 existed within the nucleus (Fig. 8DGo).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 8. Subcellular localization of Btk–EGFP, Btk (K430R)–EGFP and myc-BAM11 fusion proteins in Cos7 cells. Cos7 cells expressing EGFP fusion constructs (green) (A) Btk–EGFP, (B) Btk (K430R)–EGFP and (C) GAPDH–EGFP were analyzed using CLSM. Cos7 cells expressing myc-BAM11 (D) were stained with a mouse anti-myc antibody followed by FITC-conjugated anti-mouse IgG antibody (green). The nuclei were stained with propidium iodide (red).

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Note added in proof
 References
 
This study contains three major findings. (i) We identified a molecule, BAM11, which can bind to the PH domain of Btk both in vitro and in vivo. A sequence homology search revealed that BAM11 has 89% homology to human LTG19/ENL at the amino acid level. (ii) Forced expression of a truncated BAM11 protein (amino acids 246–368) in Y16 cells reduced the proliferative response induced by IL-5. The same truncated BAM11 protein also inhibited Btk activity measured by the in vitro kinase assay. (iii) Immunoblot analysis using anti-Btk antibody and cell staining analysis using EGFP–Btk fusion protein demonstrated that a small proportion of Btk proteins exists within the nucleus.

The activity of Btk appears to be controlled by binding to other protein molecules. Full activation of Btk appears to depend on transphosphorylation of Tyr551 by a Src family kinase (46). Yao et al. (28) provided evidence that multiple isoforms of PKC interact with Btk and PKC-mediated phosphorylation down-regulates the enzymatic activity of Btk. The PH domain of the cytoplasmic tyrosine kinases, including that of Btk, is implicated as a protein interaction domain. Through its physical association with the PH domain of Btk, we have identified BAM11 as a possible molecule which controls Btk activity. Though BAM11 contains three possible tyrosine phosphorylation sites and can associate with Btk in Y16 cells, tyrosine phosphorylation of BAM11 upon IL-5 stimulation has not been observed (data not shown). This suggests that BAM11 is not a major substrate of Btk in Y16 cells.

BAM11 has 89% homology to human LTG19/ENL at the amino acid level that was originally identified as one of the fusion partners involved in chromosomal translocations of 11q23, MLL/ALL-1/HRX, in human leukemia cells (36,37). The function of LTG19/ENL is not fully understood. Rubnitz et al. (47) reported that LTG19/ENL could activate transcription of synthetic reporter genes in both lymphoid and myeloid cells. In leukemia cells, it has been suggested that the t(11;19) chromosomal translocation fuses a DNA binding domain, AT-hook, from the MLL/ALL-1/HRX protein with LTG19/ENL protein, resulting in the formation of a new transcription factor that may play an important role for leukemogenesis.

We have reported that the B cells of XID mice fail to respond to IL-5 (11,12) and Y16 exhibits not only IL-5-dependent proliferation but also enhanced Btk activity upon IL-5 stimulation (5). Li et al. (48) provided evidence that the expression of a gain-of-function mutant of Btk (E41K) in Y16 induced IL-5-independent growth. These observations indicate the importance of the Btk signaling pathway in B cells to respond to IL-5 and we infer that the Btk signaling pathway is involved in IL-5-dependent proliferation of Y16 cells. Here we have shown the association of BAM11 with the PH domain of Btk and a truncated form of BAM11/aa240–368, that contains the Btk-binding region, reduced both IL-5-induced proliferation and IL-5-induced enhancement of Btk autophosphorylation in Y16 cells. We also revealed that BAM11/aa240–368 partially inhibited Btk activity measured by the in vitro kinase assay. The extent of the suppression of IL-5-induced proliferation of Y16 transfectants depended on the amounts of expressed BAM11/aa240–368 protein, indicating that BAM11/aa240–368 directly (or indirectly) affects the IL-5 signaling in Y16 cells rather than the artifact of transfection experiments. However, it should be noted that full-length BAM11 affected neither IL-5 responsiveness nor Btk activity in this experimental system. BAM11 may have the potential to regulate Btk activity, but other factors may be required for the full expression of its function. One possibility is that the binding of another molecule to BAM11 may modulate the tertiary structure of BAM11 and the modulated BAM11 exhibits functions shown for BAM11/aa240–368 in this study. This possibility is currently under investigation.

It has been reported that the activation of Btk depends on both transphosphorylation by a Src family kinase and membrane localization (49). The membrane localization of Btk is controlled by the binding of phospholipid moieties (1,35). In this study, we showed by means of biochemical analysis using parental Y16 cells that Btk was detected in the nucleus at a similar extent as in the cytoplasm on a per protein basis (Fig. 7Go). Btk was detected in the cytoplasm but was hardly detectable in the nucleus in per cell number basis that may be due to a low sensitivity to detect a tiny amount of Btk in the nucleus. Results of confocal microscopic analysis using Cos7 transfectants revealed a significant localization of Btk in the nucleus. Overexpression of a particular protein might lead to inappropriate localization of the protein.However, this does not exclude the possibility that Btk may localize in nucleus. These results may reflect the fact that the Btk sequence contains the bipartite type of nuclear localization signal, KRSQQKKKTSPLNFKKR at amino acid residue 12, which is composed of two basic residues, 10 residues as a spacer and another basic region consisting of at least three basic residues out of five residues (50). To clarify the quantity of Btk in the nucleus, further experiments using a more physiological setting would be necessary in future. Although the current role of Btk in the nucleus has not sufficiently been clarified at present, Btk might regulate transcription factor activity of LTG19/ENL (BAM11). The possibility that Btk is involved in leukemogenesis will also be considered. By analyzing the role of Btk from the viewpoint of the crisis mechanism of leukemia, we may be able to clarify the function of Btk in the nucleus.

Analysis of BAM11-deficient mice would be considered as another approach to clarify the functional relationship between BAM11 and Btk. The tissue distribution of BAM11 is substantially broader than that of Btk, which is restricted to hematopoietic cells. BAM11 may also associate with other cellular proteins in B-lineage cells than Btk, although BAM11 is able to associate with the PH domain of Btk in preference to that of Tec kinase. Further analysis of BAM11 and the role of Btk in the nucleus should bring new insight regarding molecular mechanisms of Btk-mediated B cell development and proliferation.


    Note added in proof
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Note added in proof
 References
 
The nucleotide sequence of mouse BAM11 has been deposited in the GenBank database (accession No. AF298887).


    Acknowledgments
 
We are grateful to Drs Tatsuo Kinashi and Satoshi Takaki for their valuable suggestions. We are also grateful to Drs Yoshihiro Takemoto and Yasuhiro Hashimoto for their helpful advice on the screening of BAM11. We thank Drs T. Yamamoto, T. Kurosaki, K. Horikawa, and T. Kouro for providing pME18S-myc vector, pApuro vector, purified Btk expressed by insect cells and anti-Btk antibody respectively. We thank Dr Paul W. Kincade and Gavin Maxwell for critical reading of the manuscript. This study was supported in part by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, Sports and Culture of Japan, and by Kato Memorial Bioscience Foundation.


    Abbreviations
 
Btk Bruton's tyrosine kinase
CLSM confocal laser scanning microscopy
GST glutathione S-transferase
PIP3 phosphatidylinositol[3,4,5]triphosphate
PH pleckstrin homology
PKC protein kinase C
TH Tec homology
Xid X-linked immune deficiency
XLA X-linked agammaglobulinemia

    Notes
 
The first two authors contributed equally to this work

Transmitting editor: D. Kitamura

Received 27 March 2000, accepted 16 June 2000.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Note added in proof
 References
 

  1. Kurosaki, T. 1999. Genetic analysis of B cell antigen receptor signaling. Annu. Rev. Immunol. 17:555.[Web of Science][Medline]
  2. Satterthwaite, A. B., Li, Z. and Witte, O. N. 1998. Btk function in B cell development and response. Semin. Immunol. 10:309.[Web of Science][Medline]
  3. Kawakami, Y., Yao, L., Miura, T., Tsukada, S., Witte, O. N. and Kawakami, T. 1994. Tyrosine phosphorylation and activation of Bruton tyrosine kinase upon Fc epsilon RI cross-linking. Mol. Cell. Biol. 14:5108.[Abstract/Free Full Text]
  4. Kawakami, Y., Kitaura, J., Hata, D., Yao, L. and Kawakami, T. 1999. Functions of Bruton's tyrosine kinase in mast and B cells. J. Leuk. Biol. 65:286.[Abstract]
  5. Sato, S., Katagiri, T., Takaki, S., Kikuchi, Y., Hitoshi, Y., Yonehara, S., Tsukada, S., Kitamura, D., Watanabe, T., Witte, O. N. and Takatsu, K. 1994. IL-5 receptor-mediated tyrosine phosphorylation of SH2/SH3-containing proteins and activation of Bruton's tyrosine and Janus 2 kinases. J. Exp. Med. 180:2101.[Abstract/Free Full Text]
  6. Rawlings, D. J., Saffran, D. C., Tsukada, S., Largaespada, D. A., Grimaldi, J. C., Cohen, L., Mohr, R. N., Bazan, J. F., Howard, M., Copeland, N. G., Jenkins, N. A. and Witte, O. N. 1993. Mutation of unique region of Bruton's tyrosine kinase in immunodeficient XID mice. Science 261:358.[Abstract/Free Full Text]
  7. Thomas, J. D., Sideras, P., Smith, C. I., Vorechovsky, I., Chapman, V. and Paul, W. E. 1993. Colocalization of X-linked agammaglobulinemia and X-linked immunodeficiency genes. Science 261:355.[Abstract/Free Full Text]
  8. Tsukada, S., Saffran, D. C., Rawlings, D. J., Parolini, O., Allen, R. C., Klisak, I., Sparkes, R. S., Kubagawa, H., Mohandas, T., Quan, S., Belmont, J. W., Cooper, M. D., Conley, M. E. and Witte, O. N. 1993. Deficient expression of a B cell cytoplasmic tyrosine kinase in human X- linked agammaglobulinemia. Cell 72:279.[Web of Science][Medline]
  9. Vetrie, D., Vorechovsky, I., Sideras, P., Holland, J., Davies, A., Flinter, F., Hammarstrom, L., Kinnon, C., Levinsky, R., Bobrow, M., Smith, C. I. E. and Bentley, D. R. 1993. The gene involved in X-linked agammaglobulinaemia is a member of the src family of protein-tyrosine kinases [published erratum appears in Nature 1993; 364(6435):362]. Nature 361:226.[Medline]
  10. Smith, C. I., Islam, K. B., Vorechovsky, I., Olerup, O., Wallin, E., Rabbani, H., Baskin, B. and Hammarstrom, L. 1994. X-linked agammaglobulinemia and other immunoglobulin deficiencies. Immunol. Rev. 138:159.[Web of Science][Medline]
  11. Hitoshi, Y., Sonoda, E., Kikuchi, Y., Yonehara, S., Nakauchi, H. and Takatsu, K. 1993. IL-5 receptor positive B cells, but not eosinophils, are functionally and numerically influenced in mice carrying the X-linked immune defect. Int. Immunol. 5:1183.[Abstract/Free Full Text]
  12. Koike, M., Kikuchi, Y., Tominaga, A., Takaki, S., Akagi, K., Miyazaki, J., Yamamura, K. and Takatsu, K. 1995. Defective IL-5-receptor-mediated signaling in B cells of X-linked immunodeficient mice. Int. Immunol. 7:21.[Abstract/Free Full Text]
  13. Go, N. F., Castle, B. E., Barrett, R., Kastelein, R., Dang, W., Mosmann, T. R., Moore, K. W. and Howard, M. 1990. Interleukin 10, a novel B cell stimulatory factor: unresponsiveness of X chromosome-linked immunodeficiency B cells. J. Exp. Med. 172:1625.[Abstract/Free Full Text]
  14. Hata, D., Kawakami, Y., Inagaki, N., Lantz, C. S., Kitamura, T., Khan, W. N., Maeda-Yamamoto, M., Miura, T., Han, W., Hartman, S. E., Yao, L., Nagai, H., Goldfeld, A. E., Alt, F. W., Galli, S. J., Witte, O. N. and Kawakami, T. 1998. Involvement of Bruton's tyrosine kinase in FcepsilonRI-dependent mast cell degranulation and cytokine production. J. Exp. Med. 187:1235.[Abstract/Free Full Text]
  15. Kikuchi, Y., Yasue, T., Miyake, K., Kimoto, M. and Takatsu, K. 1995. CD38 ligation induces tyrosine phosphorylation of Bruton tyrosine kinase and enhanced expression of interleukin 5-receptor alpha chain: synergistic effects with interleukin 5. Proc. Natl Acad. Sci. USA 92:11814.[Abstract/Free Full Text]
  16. Yamashita, Y., Miyake, K., Kikuchi, Y., Takatsu, K., Noda, S., Kosugi, A. and Kimoto, M. 1995. A monoclonal antibody against a murine CD38 homologue delivers a signal to B cells for prolongation of survival and protection against apoptosis in vitro: unresponsiveness of X-linked immunodeficient B cells. Immunology 85:248.[Web of Science][Medline]
  17. Setoguchi, R., Kinashi, T., Sagara, H., Hirosawa, K. and Takatsu, K. 1998. Defective degranulation and calcium mobilization of bone-marrow derived mast cells from Xid and Btk-deficient mice. Immunol. Lett. 64:109.[Web of Science][Medline]
  18. Tsukada, S., Rawlings, D. J. and Witte, O. N. 1994. Role of Bruton's tyrosine kinase in immunodeficiency. Curr. Opin. Immunol. 6:623.[Web of Science][Medline]
  19. Cheng, G., Ye, Z. S. and Baltimore, D. 1994. Binding of Bruton's tyrosine kinase to Fyn, Lyn, or Hck through a Src homology 3 domain-mediated interaction. Proc. Natl Acad. Sci. USA 91:8152.[Abstract/Free Full Text]
  20. Park, H., Wahl, M. I., Afar, D. E., Turck, C. W., Rawlings, D. J., Tam, C., Scharenberg, A. M., Kinet, J. P. and Witte, O. N. 1996. Regulation of Btk function by a major autophosphorylation site within the SH3 domain. Immunity 4:515.[Web of Science][Medline]
  21. Kurosaki, T. and Kurosaki, M. 1997. Transphosphorylation of Bruton's tyrosine kinase on tyrosine 551 is critical for B cell antigen receptor function. J. Biol. Chem. 272:15595.[Abstract/Free Full Text]
  22. Yasue, T., Nishizumi, H., Aizawa, S., Yamamoto, T., Miyake, K., Mizoguchi, C., Uehara, S., Kikuchi, Y. and Takatsu, K. 1997. A critical role of Lyn and Fyn for B cell responses to CD38 ligation and interleukin 5. Proc. Natl Acad. Sci. USA 94:10307.[Abstract/Free Full Text]
  23. Matsushita, M., Yamadori, T., Kato, S., Takemoto, Y., Inazawa, J., Baba, Y., Hashimoto, S., Sekine, S., Arai, S., Kunikata, T., Kurimoto, M., Kishimoto, T. and Tsukada, S. 1998. Identification and characterization of a novel SH3-domain binding protein, Sab, which preferentially associates with Bruton's tyrosine kinase (BtK). Biochem. Biophys. Res. Commun. 245:337.[Web of Science][Medline]
  24. Yamadori, T., Baba, Y., Matsushita, M., Hashimoto, S., Kurosaki, M., Kurosaki, T., Kishimoto, T. and Tsukada, S. 1999. Bruton's tyrosine kinase activity is negatively regulated by Sab, the Btk-SH3 domain-binding protein. Proc. Natl Acad. Sci. USA 96:6341.[Abstract/Free Full Text]
  25. Musacchio, A., Gibson, T., Rice, P., Thompson, J. and Saraste, M. 1993. The PH domain: a common piece in the structural patchwork of signalling proteins. Trends Biochem. Sci. 18:343.[Web of Science][Medline]
  26. Lemmon, M. A., Ferguson, K. M. and Schlessinger, J. 1996. PH domains: diverse sequences with a common fold recruit signaling molecules to the cell surface. Cell 85:621.[Web of Science][Medline]
  27. Tsukada, S., Simon, M. I., Witte, O. N. and Katz, A. 1994. Binding of beta gamma subunits of heterotrimeric G proteins to the PH domain of Bruton tyrosine kinase. Proc. Natl Acad. Sci. USA 91:11256.[Abstract/Free Full Text]
  28. Yao, L., Kawakami, Y. and Kawakami, T. 1994. The pleckstrin homology domain of Bruton tyrosine kinase interacts with protein kinase C. Proc. Natl Acad. Sci. USA 91:9175.[Abstract/Free Full Text]
  29. Li, Z., Wahl, M. I., Eguinoa, A., Stephens, L. R., Hawkins, P. T. and Witte, O. N. 1997. Phosphatidylinositol 3-kinase-gamma activates Bruton's tyrosine kinase in concert with Src family kinases. Proc. Natl Acad. Sci. USA 94:13820.[Abstract/Free Full Text]
  30. Fluckiger, A. C., Li, Z., Kato, R. M., Wahl, M. I., Ochs, H. D., Longnecker, R., Kinet, J. P., Witte, O. N., Scharenberg, A. M. and Rawlings, D. J. 1998. Btk/Tec kinases regulate sustained increases in intracellular Ca2+ following B-cell receptor activation. EMBO J. 17:1973.[Web of Science][Medline]
  31. Yang, W. and Desiderio, S. 1997. BAP-135, a target for Bruton's tyrosine kinase in response to B cell receptor engagement. Proc. Natl Acad. Sci. USA 94:604.[Abstract/Free Full Text]
  32. Novina, C. D., Kumar, S., Bajpai, U., Cheriyath, V., Zhang, K., Pillai, S., Wortis, H. H. and Roy, A. L. 1999. Regulation of nuclear localization and transcriptional activity of TFII- I by Bruton's tyrosine kinase. Mol. Cell. Biol. 19:5014.[Abstract/Free Full Text]
  33. Yao, L., Janmey, P., Frigeri, L. G., Han, W., Fujita, J., Kawakami, Y., Apgar, J. R. and Kawakami, T. 1999. Pleckstrin homology domains interact with filamentous actin. J. Biol. Chem. 274:19752.[Abstract/Free Full Text]
  34. Li, T., Rawlings, D. J., Park, H., Kato, R. M., Witte, O. N. and Satterthwaite, A. B. 1997. Constitutive membrane association potentiates activation of Bruton tyrosine kinase. Oncogene 15:1375.[Web of Science][Medline]
  35. Takata, M. and Kurosaki, T. 1996. A role for Bruton's tyrosine kinase in B cell antigen receptor-mediated activation of phospholipase C-gamma 2. J. Exp. Med. 184:31.[Abstract/Free Full Text]
  36. Tkachuk, D. C., Kohler, S. and Cleary, M. L. 1992. Involvement of a homolog of Drosophila trithorax by 11q23 chromosomal translocations in acute leukemias. Cell 71:691.[Web of Science][Medline]
  37. Yamamoto, K., Seto, M., Komatsu, H., Iida, S., Akao, Y., Kojima, S., Kodera, Y., Nakazawa, S., Ariyoshi, Y., Takahashi, T. and Ueda, R. 1993. Two distinct portions of LTG19/ENL at 19p13 are involved in t(11;19) leukemia. Oncogene 8:2617.[Web of Science][Medline]
  38. Takaki, S., Tominaga, A., Hitoshi, Y., Mita, S., Sonoda, E., Yamaguchi, N. and Takatsu, K. 1990. Molecular cloning and expression of the murine interleukin-5 receptor. EMBO J. 9:4367.[Web of Science][Medline]
  39. Takemoto, Y., Furuta, M., Li, X. K., Strong-Sparks, W. J. and Hashimoto, Y. 1995. LckBP1, a proline-rich protein expressed in haematopoietic lineage cells, directly associates with the SH3 domain of protein tyrosine kinase p56lck. EMBO J. 14:3403.[Web of Science][Medline]
  40. Takaki, S., Murata, Y., Kitamura, T., Miyajima, A., Tominaga, A. and Takatsu, K. 1993. Reconstitution of the functional receptors for murine and human interleukin 5. J. Exp. Med. 177:1523.[Abstract/Free Full Text]
  41. Chen, R. H., Sarnecki, C. and Blenis, J. 1992. Nuclear localization and regulation of erk- and rsk-encoded protein kinases. Mol. Cell. Biol. 12:915.[Abstract/Free Full Text]
  42. Storrie, B. and Madden, E. A. 1990. Isolation of subcellular organelles. Methods Enzymol. 182:203.[Web of Science][Medline]
  43. Bence, K., Ma, W., Kozasa, T. and Huang, X. Y. 1997. Direct stimulation of Bruton's tyrosine kinase by G(q)-protein alpha-subunit. Nature 389:296.[Medline]
  44. Joh, T., Kagami, Y., Yamamoto, K., Segawa, T., Takizawa, J., Takahashi, T., Ueda, R. and Seto, M. 1996. Identification of MLL and chimeric MLL gene products involved in 11q23 translocation and possible mechanisms of leukemogenesis by MLL truncation. Oncogene 13:1945.[Web of Science][Medline]
  45. Shashidharan, P., Chalmers-Redman, R. M., Carlile, G. W., Rodic, V., Gurvich, N., Yuen, T., Tatton, W. G. and Sealfon, S. C. 1999. Nuclear translocation of GAPDH–GFP fusion protein during apoptosis. Neuroreport 10:1149.[Web of Science][Medline]
  46. Rawlings, D. J., Scharenberg, A. M., Park, H., Wahl, M. I., Lin, S., Kato, R. M., Fluckiger, A. C., Witte, O. N. and Kinet, J. P. 1996. Activation of BTK by a phosphorylation mechanism initiated by SRC family kinases. Science 271:822.[Abstract]
  47. Rubnitz, J. E., Morrissey, J., Savage, P. A. and Cleary, M. L. 1994. ENL, the gene fused with HRX in t(11;19) leukemias, encodes a nuclear protein with transcriptional activation potential in lymphoid and myeloid cells. Blood 84:1747.[Abstract/Free Full Text]
  48. Li, T., Tsukada, S., Satterthwaite, A., Havlik, M. H., Park, H., Takatsu, K. and Witte, O. N. 1995. Activation of Bruton's tyrosine kinase (Btk) by a point mutation in its pleckstrin homology (PH) domain. Immunity 2:451[Web of Science][Medline]
  49. Mahajan, S., Fargnoli, J., Burkhardt, A. L., Kut, S. A., Saouaf, S. J. and Bolen, J. B. 1995. Src family protein tyrosine kinases induce autoactivation of Bruton's tyrosine kinase. Mol. Cell. Biol. 15:5304.[Abstract]
  50. Dingwall, C. and Laskey, R. A. 1991. Nuclear targeting sequences—a consensus? Trends Biochem. Sci. 16:478.[Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
J. Rajaiya, J. C. Nixon, N. Ayers, Z. P. Desgranges, A. L. Roy, and C. F. Webb
Induction of Immunoglobulin Heavy-Chain Transcription through the Transcription Factor Bright Requires TFII-I
Mol. Cell. Biol., June 15, 2006; 26(12): 4758 - 4768.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Rajaiya, M. Hatfield, J. C. Nixon, D. J. Rawlings, and C. F. Webb
Bruton's Tyrosine Kinase Regulates Immunoglobulin Promoter Activation in Association with the Transcription Factor Bright
Mol. Cell. Biol., March 15, 2005; 25(6): 2073 - 2084.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B.-g. Moon, S. Takaki, K. Miyake, and K. Takatsu
The Role of IL-5 for Mature B-1 Cells in Homeostatic Proliferation, Cell Survival, and Ig Production
J. Immunol., May 15, 2004; 172(10): 6020 - 6029.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
M. Hirano, Y. Kikuchi, S. Nisitani, A. Yamaguchi, A. Satoh, T. Ito, H. Iba, and K. Takatsu
Bruton's tyrosine kinase (Btk) enhances transcriptional co-activation activity of BAM11, a Btk-associated molecule of a subunit of SWI/SNF complexes
Int. Immunol., May 1, 2004; 16(5): 747 - 757.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. Takesono, L. D. Finkelstein, and P. L. Schwartzberg
Beyond calcium: new signaling pathways for Tec family kinases
J. Cell Sci., January 8, 2002; 115(15): 3039 - 3048.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Horikawa, H. Kaku, H. Nakajima, H. W. Davey, L. Henninghausen, I. Iwamoto, T. Yasue, A. Kariyone, and K. Takatsu
Essential Role of Stat5 for IL-5-Dependent IgH Switch Recombination in Mouse B Cells
J. Immunol., November 1, 2001; 167(9): 5018 - 5026.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (12)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Kikuchi, Y.
Right arrow Articles by Takatsu, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kikuchi, Y.
Right arrow Articles by Takatsu, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?