International Immunology, Vol. 11, No. 9, 1423-1429,
September 1999
© 1999 Japanese Society for Immunology
Prf, a novel Ets family protein that binds to the PU.1 binding motif, is specifically expressed in restricted stages of B cell development
Department of Biophysics and Biochemistry, Graduate School of Science, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan
1 Department of Immunology, National Institute of Infectious Diseases, 1-23-1 Toyama, Shinjuku-ku, Tokyo 162-8640, Japan
Correspondence to: H. Sakano
| Abstract |
|---|
|
|
|---|
During the development of lymphocytes, expression of the Ig genes is strictly regulated in a tissue-specific manner and in a time-ordered fashion. We have previously shown that the PU.1 binding motif in the Ig
3' enhancer (
E3') and a novel Ets family protein other than PU.1 may be possibly involved in the control of V
J
joining. In the attempt to isolate the novel Ets family protein, we have screened cDNA libraries with the yeast one-hybrid method and identified a new PU.1-related factor, Prf. This novel Ets family protein is shown to interact with the PU.1 binding sequences in various promoters and enhancers, including
E3'. It was found that expression of the prf gene is predominant in the B-lineage cells, with the exception of immature B cells. Since Prf does not exhibit functions of transcriptional activity, this novel protein may act as an antagonist against other Ets family proteins, e.g. PU.1 and Spi-B. Possible roles of Prf with respect to the B cell differentiation are discussed.
Keywords: 3' enhancer, B cell development, Ets family protein, Ig
gene, PU.1
| Introduction |
|---|
|
|
|---|
Pluripotent bone marrow stem cells differentiate into eight distinct cell lineages in mammalian hematopoiesis. Molecular mechanisms underlying the lineage commitment of stem cells are still largely unknown. It is generally accepted that the process is regulated by signals from stroma cells and by hematopoietic transcription factors. They include GATA-1 for red blood cell maturation (1,2); Ikaros for development of lymphocytes, NK cells and neutrophils (3,4); and Oct-2 for T cell-independent B cell activation and maturation (5,6).
During the development of lymphocytes, expression of antigen receptor genes is regulated in a cell-type-specific manner. In the Ig
gene, two enhancer regions, the intron enhancer (E
) and the 3'-enhancer (
E3'), play crucial roles in the developmentally controlled expression (710). An Ets family protein, PU.1, has been shown to bind to the
E3' and enhance the transcription of the Ig
gene (11). Using transgenic substrates, we have previously shown that the PU.1 binding motif in the
E3' is a cis-acting DNA element responsible for the negative control of V
J
joining (12,13). However, the PU.1 protein itself may not be the recombinational repressor, because PU.1 is expressed in all of B cell developmental stages. We assume that a novel Ets family protein other than PU.1 may be involved in the recombinational regulation. In order to isolate the PU.1-related protein, we have screened cDNA libraries with the yeast one-hybrid system using the
E3' sequence as a probe. Here we report a novel PU.1-related factor, Prf, which is specifically expressed in restricted stages of B cell development.
| Methods |
|---|
|
|
|---|
cDNA library construction and yeast one-hybrid screening
A murine thymus cDNA library was constructed with oligo(dT)1218 and random hexameric primers (SuperScript Choice System for cDNA Synthesis; Gibco/BRL, Gaithersburg, MD) in a plasmid vector pGAD424 (Clontech, Palo Alto, CA), using poly(A)+ RNA prepared from newborn thymi of BALB/c mice.
Bait plasmids, pHISi-PU and pLacZi-PU, were constructed with synthetic DNA oligomers containing three repeats of the PU.1-NF-EM5 binding region sequences of the
E3', TTTGAGGAACTGAAAACAG (11). To obtain a yeast reporter strain YMPU3i3, the bait plasmids were linearized and integrated into the yeast genome of a strain YM4271 by homologous recombination.
Yeast one-hybrid screening with the thymus cDNA library was carried out on His, Ura, SD plates supplemented with 25 mM 3-amino-1,2,4-triazole (14).
In vitro expression and gel-shift assay
For in vitro expression, prf cDNA of 729 bp was subcloned into a pBluescript vector (Stratagene, La Jolla, CA). RNA was translated from the recombinant pBluescript plasmid with T3 RNA polymerase. In vitro translations were performed with an aliquot of in vitro synthesized RNA (0.5 µg) preheated at 65°C for 10 min and 33 µl of nuclease-treated rabbit reticulocyte lysate (Promega, Madison, WI) with or without 20 µCi of [35S] methionine. Translation reactions were carried out in a 50 µl reaction mixture at 30°C for 90 min.
For the gel-shift assay, Prf protein (2 µl of translation mixture) was incubated with 10,000 c.p.m. of 32P-labeled double-stranded oligonucleotide probes in 20 µl of reaction mixture containing 25 mM NaCl, 100 µg/ml poly(dI;dC), 50 µg/ml of denatured and non-denatured salmon sperm DNA, 0.25 mg/ml BSA, 10 mM TrisHCl (pH 7.5), 1 mM EDTA and 1 mM dithiothreitol at 4°C for 30 min. Samples were loaded on 5% polyacrylamide gels (29:1, acrylamide:bisacrylamide) and electrophoresed in 0.25xTBE (1xTBE is 0.09 M Tris, 0.09 M boric acid and 0.005 M EDTA). Oligonucleotides for probes were synthesized according to the putative PU.1 binding sites. Ig
E3' wild-type: GCTACCGTCACACTGCTTTGATCAAGAAGACCCTTTGAGGAACTGAAAACAGAACCT. Ig
E3' mutant:GCTACCGTCACACTGCTTTGATCAAGAAGACCCTTT-TCTTCGCTGAAAACAGAACCT. Ig
E24: ATAAAAGGAAGTGAAACCAAG. c-fes promoter: AACCGCGGGAGGAGGAAGCGCGG. Fc
RI promoter: CTAGGCAATTTCCCTTCCTCTT. Only top-strand sequences are shown here. Mutated resides are underlined.
Cell sorting and RT-PCR analysis
To isolate Ig B (pro- and pre-B) cells (NK1.1, B220+, HSA+, Ig, CD23) and immature B cells (NK1.1, B220+, HSA+, Ig+), bone marrow cells from C57BL/6 mice were stained with biotinylated anti-NK1.1 mAb, allophycocyanin (APC)-coupled anti-B220 mAb, phycoerythrin (PE)-conjugated anti-HSA mAb and FITC-conjugated anti-IgM, anti-IgD and anti-CD23 mAb, followed by incubation with Texas Red-coupled streptavidin. Dead cells were discriminated by uptake of propidium iodide, and viable cells were sorted under the forward- and side-scatter lymphocyte gate on a FACS Vantage (Becton Dickinson, Mountain View, CA). Circulating B cells in the bone marrow were discriminated by the expression of low levels of HSA (HSAdull) from immature B cells (HSA+) in FACS sorting.
To purify splenic B cells (B220+, Thy-1) and splenic T cells (B220, Thy-1+), splenocytes were stained and sorted with APC-coupled anti-B220 mAb and PE-conjugated anti-Thy-1 mAb. For the separation of thymic CD3lo (Thy-1+, CD3lo), thymic CD3hi (Thy-1+, CD3hi), thymic Thy-1 (Thy-1, CD3hi, B220) and thymic B220+ cells (Thy-1dull, CD3lo, B220+), thymocytes were stained with PE-conjugated anti-Thy-1 mAb, FITC-conjugated anti-CD3 mAb and APC-coupled anti-B220 mAb.
To isolate pro-B and pre-B cells, non-B-lineage cells were first depleted from bone marrow cells using MACS (Miltenyi Biotec, Bergisch Gladbach, Germany) with the following antibodies: anti-NK1.1 mAb, anti-CD5 mAb, anti-Gr-1 mAb, TER119 and anti-Thy1 mAb. The bone marrow B lineage cells were stained with the following antibodies and then stained with Texas Red-coupled streptavidin: biotinylated anti-IgM, anti-IgD and anti-CD23 mAb; APC-coupled anti-B220 mAb; PE-conjugated anti-HSA mAb; and FITC-conjugated anti-CD43 mAb. All antibodies for staining were purchased from PharMingen (San Diego, CA).
Total RNAs were prepared from 5x104 sorted cells using the RNeasy Mini-kit (Qiagen, Hilden, Germany) according to the manufacturer's instruction. cDNA was made from total RNA samples with SuperScript II reverse transcriptase (Gibco/BRL) in a 10 µl scale. Reverse transcriptase reaction products were subjected to 40 cycles of denaturation at 94°C for 30 s, primer annealing at 53°C for 1 min and primer extension at 72°C for 1.5 min with AmpliTaq Gold (Perkin-Elmer, Norwalk, CT). PCR products were separated in 1.5% agarose gels and either stained with ethidium bromide or transferred to Hybond-N+ membrane (Amersham, Pharmacia, Uppsala, Sweden) and subjected to Southern blotting. Hybridization was performed with the full-length prf coding sequence as a probe. Nucleotide sequences of a primer pair used for amplification of prf fragments are: forward primer, 5'-CGAATTCCATGACTTGTTGTATTG-3'; reverse primer, 5'-TCTCGAGTTTTGTGACAGACACTA-3'. These primers are designed to generate the full-length of the prf coding sequence (729 bp). For amplification of ß-actin, the following primer pair was used: 5'-ATGGATGACGATATCGCT-3' and 5'-ATGAGGTAGTCTGTCAGGT-3'.
Northern blotting
A mouse multiple tissue blot (Clontech) was incubated with 32P-labeled prf cDNA or ß-actin cDNA at 65°C according to the manufacturer's instructions. 460 bp ApaLIHincII fragment of prf cDNA was used as probe. The filter was washed with 0.5xSSC, 0.2% (w/v) SDS at 65°C for 30 min.
Transcriptional activation assay
Full-length cDNA of PU.1 (amino acids 1272), Prf (amino acids 1243), Prf (amino acids 44243) or Prf (amino acids 93243) was cloned separately into a plasmid vector pGBT9 (Clontech). A yeast strain HF7c was transformed with recombinant plasmid and incubated on the His SD plate.
| Results |
|---|
|
|
|---|
Structure of the Prf protein
From the 5x106 clones of the murine thymic cDNA library, three positive clones were isolated using the
E3' probe containing the PU.1-NF-EM5 binding region sequences (11). The obtained clones were not identical and met all specific binding criteria. Nucleotide sequencing revealed that two of the clones code for the murine PU.1 protein. The third clone (#6-2) was found to encode a novel protein, containing an Ets DNA binding domain (Fig. 1A
(33%) (18), human Erg (31%) (19), human SAP1B (32%) (20), human Erf (30%) (21) and human TEL (36%) (22). Judging from the predicted amino acids sequence, no functional domain was evident in the N- or C-terminus of Prf. When the Prf fragment spanning from amino acid residue 44 to 112 was fused to the GAL4-activation domain, the fusion protein did not show any binding to the bait DNA (data not shown). This indicated that Prf was binding to the bait DNA in the C-terminal region rather than in the N-terminal region, mostly likely with the Ets DNA binding domain.
|
|
|
Prf protein indeed binds to the PU.1 binding motif
To study in vitro binding, Prf protein was translated with the reticulocyte lysate as shown in Fig. 3
E3') (Fig. 3B
|
It has been reported that PU.1 recognizes the purine-rich sequence in the regulatory region of various genes contributing to cell differentiation and development. We, therefore, studied whether the Prf protein could bind to the PU.1 binding motifs of other genes, e.g. Ig
24 enhancer (24), c-fes promoter (25) and Fc
RI promoter (26). It was found that all the PU.1 binding motifs so far tested were bound by the Prf protein. It should be mentioned that a PU.1 motif in the Fc
RI promoter showed lower Prf-binding affinity (Fig. 3C
B cell- and stage-specific expression of Prf
Cell type specificity of Prf expression was studied by Northern blotting of poly(A)+ RNA isolated from various tissues. To avoid cross-hybridization to other Ets family genes, an ApaLIHincII fragment (460 bp) of prf cDNA, which lacks most of the sequence coding for the Ets domain, was used as a probe. As shown in Fig. 4
, three distinct bands of prf transcripts (1.5, 1.9 and 2.4 kb) were detected at high levels in the spleen. Low-level transcripts detected in the liver may be due to residual lymphoid cells in the tissue. Size differences of these transcripts probably represent alternative splicing or differential processing stages of a common precursor RNA. We have isolated and sequenced a Prf-positive cDNA clone from a murine splenic cDNA library, probably corresponding to the 2.4 kb transcript of the prf gene. Since a stop codon is found upstream of the Ets domain coding region (data not shown), this transcript cannot encode a functional DNA binding protein.
To further study the cell-type specificity of prf expression, RT-PCR was performed with FACS-sorted cells from various lymphoid tissues. As shown in Fig. 5
, Prf is specifically expressed in B cells of bone marrow, spleen and thymus (Fig. 5A
, lanes 2, 4, and 9). It is interesting that the Prf expression temporarily ceases in Ig+ immature B cells (Fig. 5A
, lane 1) during the B cell development in bone marrow. We have studied the expression of prf in the FACS-sorted pro-B cells (B220+, Ig, HSA+, CD43+) and pre-B cells (B220+, Ig, HSA+, CD43) from bone marrow. The expression of prf was detected in the pre-B cells by RT-PCR, but not in pro-B cells (Fig. 5B
). In our sorting, the level of contamination of circulating B cells (B220+, Ig+, HSA+) in the pre-B fraction was <1% and should not influence the RT-PCR experiment.
|
Prf does not show any transcriptional activation function in yeast
When a fusion protein containing both the GAL4-DNA binding domain and transcriptional activation domain of a transcriptional factor is produced, the yeast strain HF7c can grow on the His SD plates and express ß-gal (Fig. 6
|
| Discussion |
|---|
|
|
|---|
Using the Ig
E3' sequence as a probe, we have isolated a cDNA clone coding for a novel Ets family protein, Prf, which is highly homologous to PU.1 and Spi-B within the Ets DNA binding domain. Ets family proteins are known to play key roles in the immune response and in the lymphoid cell development. For example, PU.1 is expressed in B lymphocytes, macrophages, granulocytes and monocytes (15,27), and is known to function as an important regulatory protein in hematopoiesis and in erythroleukemic transformation (2830). In contrast to PU.1, Spi-B expression is restricted to the lymphoid lineage, although Spi-B and PU.1 share many target genes in erythroid, myeloid and lymphoid cells. Their distinct patterns of expression may suggest that these genes have separate roles in regulating the immune system. PU.1/ mice showed various defects in T cell development as well as in the generation of B lymphocytes, monocytes and granulocytes (28), while Spi-B/ mice exhibited severe abnormalities in B cell functions and in the T cell-mediated humoral immunity (31).
In comparison to the PU.1 and Spi-B proteins, Prf has two unique characteristics. One is an unusual pattern of expression, which is restricted in pre-B cells and mature B cells. Unlike Prf, PU.1 is expressed in all stages of B lineage cells and Spi-B is expressed in increasing amounts as B cells differentiate (32) (Table 1
). The other interesting feature is that Prf has no transcriptional activation function. Although Prf shares many target genes with PU.1 and Spi-B, its mode of action appears to be totally different. Both PU.1 and Spi-B act in a positive manner to activate various genes in the immune system. However, Prf may not be able to function by itself, because it lacks transcriptional activity. It is possible that Prf acts on the target genes as an antagonist against PU.1 or Spi-B. Prf may function in a similar manner as Erf, another Ets family protein, known to act as a repressor for the Ets-2 by competitive binding to the promoter (21,33). Erf is expressed ubiquitously and has an Ets DNA binding domain at the N-terminus and a repressor domain at the C-terminus. It can antagonize the activities of other Ets family proteins that act as positive transcriptional regulators. Although there is no significant homology between Prf and Erf, other than the Ets DNA binding domain, it is tempting to assume that Prf may function as a negative regulator, like Erf, during the development of B cells.
|
If Prf works as an antagonist against PU.1 or Spi-B, it will be interesting to study why the expression of Prf is temporally regulated during the B cell development in bone marrow. One intriguing possibility is that Prf may negatively regulate the stage-specific rearrangement of the Ig
light chain gene. It is also possible that Prf is involved in the negative selection of autoreactive immature B cells or in the homing of B cells from bone marrow to peripheral lymphoid tissue. We are currently in the process of producing prf / mutant mice. If such knockout mice are generated, they will hopefully establish the physiological roles of the Prf protein. | Note added in proof |
|---|
|
|
|---|
After the submission of our manuscript, Bemark et al. (J. Biol. Chem. 274:10259) reported the spi-C gene whose sequence is basically the same as our prf.
| Acknowledgments |
|---|
This work was supported by the Special Promotion Research Grant of Monbusho in Japan, and grants from the Toray Science Foundation, Mitsubishi Foundation and Nissan Science Foundation. H. N. was supported by a research grant from Kurata Science Foundation. The authors are grateful to Richard A. Maki for his valuable comments and Hitomi Sakano for critical reading of the manuscript.
| Abbreviations |
|---|
E3' | Ig 3' enhancer |
| PE | phycoerythrin |
| APC | allophycocyanin |
| Notes |
|---|
Transmitting editor: K. Okumura
Received 1 April 1999, accepted 13 May 1999.
| References |
|---|
|
|
|---|
- Pevny, L., Simon, M. C., Robertson, E., Klein, W. H., Tsai, S.-F., D'Agati, V., Orkin, S. H. and Costantini, F. 1991. Erythroid differentiation in chimeric mice blocked by a targeted mutation in the gene for transcription factor GATA-1. Nature 349:257.[Medline]
- Simon, M. C., Pevny, L., Wiles, M. V., Keller, G., Costantini, and Orkin, S. H. 1992. Rescue of erythroid development in the gene-targeted GATA embryonic stem cells. Nat. Genet. 1:92.[Web of Science][Medline]
- Georgopoulos, K., Bigby, M., Wang, J. H., Molnar, A., Wu, P., Winandy, S. and Sharpe, A. 1994. The Ikaros gene is required for the development of all lymphoid lineages. Cell 79:143.[Web of Science][Medline]
- Winandy, S., Wu, P. and Georgopoulos, K. 1995. A dominant mutation in the Ikaros gene leads to rapid development of leukemia and lymphoma. Cell 83.:289.[Web of Science][Medline]
-
Corcoran, L. M., Karvelas, M., Nossal, G. J., Ye, Z.-S., Jacks, T. and Baltimore, D. 1993. Oct-2, although not required for early B-cell development, is critical for later B-cell maturation and for postnatal survival. Genes Dev. 7:570.
[Abstract/Free Full Text] - Corcoran, L.M. and Karvelas, M. 1994. Oct-2 is required early in T cell-independent B cell activation for G1 progression and for proliferation. Immunity 1:635.[Web of Science][Medline]
-
Atchison, M. L. and Perry, R. P. 1987. The role of the
enhancer and its binding factor NF
B in the developmental regulation of
gene transcription. Cell 48:121.[Web of Science][Medline]
-
Lenardo, M., Pierce, J. W. and Baltimore, D. 1987. Protein-binding sites in Ig gene enhancers determine transcriptional activity and inducibility. Science 236:1573.
[Abstract/Free Full Text] -
Meyer, K. B., Sharpe, M. J., Surani, M. A. and Neuberger, M. S. 1990. The importance of the 3'-enhancer region in immunoglobulin
gene expression. Nucleic Acids Res. 18:5609.[Abstract/Free Full Text] -
Pongubala, J. M. R. and Atchison, M. L. 1991. Functional characterization of the developmentally controlled immunoglobulin kappa 3' enhancer: regulation by Id, a repressor of helix-loop-helix transcription factors. Mol. Cell Biol. 11:1040.
[Abstract/Free Full Text] -
Pongubala, J. M. R., Nagulapalli, S., Klemsz, M. J., McKercher, S. R., Maki, R. A. and Atchison, M. L. 1992. PU.1 recruits a second nuclear factor to a site important for immunoglobulin
3' enhancer activity. Mol. Cell Biol. 12:368.[Abstract/Free Full Text] -
Hiramatsu, R., Akagi, K., Matsuoka, M., Sakumi, K., Nakamura, H., Kingsbury, L., David, C., Hardy, R. R., Yamamura, K. and Sakano, H. 1995. The 3' enhancer region determines the B/T specificity and pro-B/pre-B specificity of immunoglobulin V
J
joining. Cell 83:1113.[Web of Science][Medline]
-
Hayashi, R., Takemori, T., Kodama, M., Suzuki, M., Tsuboi, A., Nagawa, F. and Sakano, H. 1997. The PU.1 binding site is a cis-element that regulates pro-B/pre-B specificity of V
J
joining. J. Immunol. 159:4145.[Abstract]
-
Durfee, T., Becherer,K., Chen, P. L., Yeh, S. H., Yang, Y., Kilburn, A. E., Lee, W. H. and Elledge, S. J. 1993. The retinoblastoma protein associates with the protein phosphatase type 1 catalytic subunit. Genes Dev. 7:555.
[Abstract/Free Full Text] - Klemsz, M. J., McKercher, S. R., Celeda, A., Van Beveren, C. and Maki, R. A. 1990. The macrophage and B cell-specific transcription factor PU.1 is related to the ets oncogene. Cell 61;113.
-
Ray, D., Bosselut, R., Ghysdael, J., Mattei, M. G., Tavitian, A. and Moreau-Gachelin, F. 1992. Characterization of Spi-B, a transcription factor related to the putative oncoprotein Spi-1/PU.1. Mol. Cell Biol. 12:4297.
[Abstract/Free Full Text] - Chen, J. H. 1990. Cloning, sequencing, and expression of mouse c-ets-1 cDNA in baculovirus expression system. Oncogene Res. 5:277.[Web of Science][Medline]
-
LaMarco, K., Thompson, C. C., Byers, B. P., Walton, E. M. and McKnicht, S. L. 1991. Identification of Ets- and notch-related subunits in GA binding protein. Science 253:789.
[Abstract/Free Full Text] -
Rao, V. N., Papas, T. S. and Reddy, E. S., 1987. erg, a human ets-related gene on chromosome 21: alternative splicing, polyadenylation, and translation. Science 237:635.
[Abstract/Free Full Text] - Dalton, S. and Treisman, R. 1992. Characterization of SAP-1, a protein recruited by serum response factor to the c-fos serum response element. Cell 68:597.[Web of Science][Medline]
- Sgouras, D. N., Athanasiou, M. A., Beal, G. J., Jr, Fisher, R. J., Blair, D. G. and Mavrothalassitis, G. J. 1995. ERF: an ETS domain protein with strong transcriptional repressor activity, can suppress ets-associated tumorigenesis and is regulated by phosphorylation during cell cycle and mitogenic stimulation. EMBO J. 14:4781.[Web of Science][Medline]
- Golub, T. R., Barker, G. F., Lovett, M. and Gilliland, D. G. 1994. Fusion of PDGF receptor ß to a novel ets-like gene, tel, in chronic myelomonocytic leukemia with t(5;12) chromosomal translocation. Cell 77:307.[Web of Science][Medline]
- Kodandapani, R., Pio, F., Ni, C. Z., Piccialli, G., Klemsz, M., McKercher, S. R., Maki, R. A. and Ely, K.R. 1996. A new pattern for helix-turn-helix recognition revealed by the PU.1 ETS-domainDNA complex. Nature 380:456.[Medline]
-
Eisenbeis, C. F., Singh, H. and Storb, U. 1993. PU.1 is a component of a multiprotein complex which binds an essential site in the murine immunoglobulin
24 enhancer. Mol. Cell Biol. 13:6452.[Abstract/Free Full Text] -
Heydemann, A., Juang, G., Hennessy, K., Parmacek, M. S. and Simon, M. C. 1996. The myeloid-cell-specific c-fes promoter is regulated by Sp1, PU.1 and a novel transcription factor. Mol. Cell Biol. 16:1676.
[Abstract/Free Full Text] -
Perez, C., Coeffier, E., Moreau-Gachelin, F., Wietzerbin, J. and Benech, P. D. 1994. Involvement of the transcription factor PU.1/Spi-1 in myeloid cell-restricted expression of an interferon-inducible gene encoding the human high-affinity Fc
receptor. Mol. Cell Biol. 14:5023.[Abstract/Free Full Text] -
Chen, H. M., Zhang, P., Voso, M. T., Hohaus, S., Gonzalez, D. A., Glass, C. K., Zhang, D. E. and Tenen, D. G. 1995. Neutrophils and monocytes express high levels of PU.1 (Spi-1) but not Spi-B. Blood 85:2918.
[Abstract/Free Full Text] - McKercher, S. R., Torbett, B. E., Anderson, K. L., Henkel, G. W., Vestal, D. J., Baribault, H., Klemsz, M., Feeney, A. J., Wu, G. E., Paige, C. J. and Maki, R. A. 1996. Targeted disruption of the PU.1 gene results in multiple hematopoietic abnormalities. EMBO J. 15:5647.[Web of Science][Medline]
- Moreau-Gachelin, F., Tavitian, A. and Tambourin, P. 1988. Spi-1 is a putative oncogene in virally induced murine erythroleukemias. Nature 331:277.[Medline]
-
Schuetze, S., Stenberg, P. E. and Kabat, D. 1993. The Ets-related transcription factor PU.1 immortalizes erythroblasts. Mol. Cell Biol. 13:5670.
[Abstract/Free Full Text] - Su, G. H., Chen, H. M., Muthusamy, N., Garrett-Sinha, L. A., Baunoch, D., Tenen, D. G. and Simon, M. C. 1997. Defective B cell receptor-mediated responses in mice lacking the Ets protein, Spi-B. EMBO J. 16:7118.[Web of Science][Medline]
-
Su, G. H., Ip, H. S., Cobb, B. S., Lu, M. M., Chen, H. M. and Simon, M. C. 1996. The Ets protein Spi-B is expressed exclusively in B cells and T cells during development. J. Exp. Med. 184: 203.
[Abstract/Free Full Text] -
Day, R. N., Liu, J., Sundmark, V., Kawecki, M., Berry, D. and Elsholtz, H. P. 1998. Selective inhibition of prolactin gene transcription by the ETS-2 repressor factor. J. Biol. Chem. 273:31909.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
B. L. Schweitzer, K. J. Huang, M. B. Kamath, A. V. Emelyanov, B. K. Birshtein, and R. P. DeKoter Spi-C Has Opposing Effects to PU.1 on Gene Expression in Progenitor B Cells J. Immunol., August 15, 2006; 177(4): 2195 - 2207. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. L. Schweitzer and R. P. DeKoter Analysis of Gene Expression and Ig Transcription in PU.1/Spi-B-Deficient Progenitor B Cell Lines J. Immunol., January 1, 2004; 172(1): 144 - 154. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Anderson, S. L. Nelson, H. B. Perkin, K. A. Smith, M. J. Klemsz, and B. E. Torbett PU.1 Is a Lineage-specific Regulator of Tyrosine Phosphatase CD45 J. Biol. Chem., March 2, 2001; 276(10): 7637 - 7642. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. Anderson, X. Sun, A. L. Miracle, G. W. Litman, and E. V. Rothenberg Evolution of hematopoiesis: Three members of the PU.1 transcription factor family in a cartilaginous fish, Raja eglanteria PNAS, January 16, 2001; 98(2): 553 - 558. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








