Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (33)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Fischer, H.-G.
Right arrow Articles by Bielinsky, A. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fischer, H.-G.
Right arrow Articles by Bielinsky, A. K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 11, No. 8, 1265-1274, August 1999
© 1999 Japanese Society for Immunology

Antigen presentation function of brain-derived dendriform cells depends on astrocyte help

Hans-Georg Fischer and Anja K. Bielinsky1

Institute for Medical Microbiology and Virology, Heinrich-Heine-University, Universitätsstrasse 1, Geb. 22.21, 40225 Düsseldorf, Germany

Correspondence to: H.-G. Fischer


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
In mouse brain primary culture, supplementation with granulocyte macrophage colony-stimulating factor (GM-CSF) induces development of dendriform cells emerging on the astroglia monolayer. As revealed by flow cytofluorimetric analysis, >70% of isolated cells are CD11c+ and express the dendritic cell (DC) marker 33D1. Additional expression of F4/80 and CD11b suggests a myeloid origin of these cells. The lymphoid DC marker CD8{alpha} is lacking while DEC-205 has been detected on ~10% of the cells. When freshly isolated, such brain-derived DC-like cells are excellent antigen-presenting cells (APC) but their functional capability is lost during subculture with GM-CSF. In contrast, their antigen presentation function remains stable in the presence of GM-CSF plus astrocytes or astrocyte-conditioned medium. The responsible astrocytic activity co-fractionates with macrophage colony-stimulating factor (M-CSF). Neutralization of the activity with anti-M-CSF antibody and substitution with recombinant M-CSF provide evidence that, in addition to GM-CSF, M-CSF is required to preserve the functional capability of these brain-derived APC. Responsiveness of the isolated cells to M-CSF is substantiated by the expression of c-fms/M-CSF receptor gene. Consistently, GM-CSF proves stimulatory for astrocytes by up-regulating their secretion of M-CSF. Furthermore, depletion or blocking of endogenous M-CSF in primary brain cell culture prevents the development of functionally active APC regardless of exogenous GM-CSF. In sum, these findings ascribe an immature DC phenotype to GM-CSF-grown myeloid brain cells and indicate a role for astrocytic M-CSF in maintaining their antigen presentation function.

Keywords: antigen presentation, astrocytes, brain, dendritic cells, macrophage colony-stimulating factor


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Dendritic cells (DC) constitute a heterogenous family of bone marrow-derived cells which, during maturation, are specialized for antigen capture, migration and T cell activation (1). These professional antigen-presenting cells (APC) express high levels of co-stimulatory molecules and strongly produce IL-12 upon triggering via CD40 or by microbial agents (24). Signals which govern the development of DC in vivo are still unresolved; however, in vitro evidence indicates a key role for granulocyte macrophage colony-stimulating factor (GM-CSF) in promoting DC differentiation (5). The isolation of DC exhibiting either lymphoid or myeloid surface markers led to the recent concept that at least two DC subsets exist (reviewed in 6) which originate from differently committed precursors and home at distinct sites in lymph nodes and spleen (710). A phenotype marker common to DC in the mouse is CD11c (11). In addition, CD8{alpha} and CD1d seem to be selectively expressed by putative lymphoid precursor-derived DC, their myeloid counterparts express the DC-restricted marker 33D1, and share F4/80 and CD11b with cells of the monocyte/macrophage lineage (711).

Professional APC are rare or absent within the central nervous system (CNS) as suggested by the lack of parenchymal cells bearing MHC class II antigens. Although microglia and other macrophages associated with the CNS can be induced by IFN-{gamma} to express MHC class II molecules in vitro and function as APC in inflammatory brain diseases (reviewed in 12), the identity of cells which initiate an intracerebral, antigen-directed immune response has remained obscure. Since macrophage/microglial progenitors are lifelong present in the mouse CNS (13) and GM-CSF is a secretory product of glia cells (14), we addressed the question whether DC can differentiate from brain cells. As previously shown (15), a population of F4/80+ CD11b+ MHC IIlow dendriform cells develops in GM-CSF-supplemented brain cell culture in intimate vicinity to astroglia. Brain cells propagated with GM-CSF were distinguished from resting microglia by their IFN-{gamma}-independent APC function, strong IL-12 secretion and weak expression of the macrophage marker membrane C1q (15). At the single-cell level, a relation to DC was supported by patch-clamp analyses revealing that most of the GM-CSF-grown brain cells exhibit a unique, Kv1.3-dominated profile in voltage-gated K+ currents (16) similar to that of splenic DC (17).

In the present study, we specify the phenotype of these brain-derived professional APC and demonstrate their loss of function in the absence of astrocytes. A paracrine astrocytic signal required in addition to GM-CSF to preserve the capability for antigen presentation is identified and the interdependent action of both cytokines in functional maturation of these APC is analyzed.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Animals
BALB/c mice and (C57BL/10xC3H/HeJ)F1 hybrids were bred in the Tierversuchsanlage, University of Düsseldorf, from breeding stock originally supplied by Charles River (Kisslegg, Germany).

Media, reagents and cytokines
Medium for brain cell culture was DMEM supplemented with 10% FCS (< 10 pg/ml LPS) and 2 mM L-glutamine. For the culture of T cells and for proliferation assays IMDM (Gibco, Eggenstein, Germany) with 5% FCS, glutamine and 50 µM 2-mercaptoethanol was used. Bovine insulin was kindly provided by G. Seipke (Hoechst, Frankfurt, Germany), purified protein derivative of tuberculin (PPD) by G. Reber (Behringwerke, Marburg, Germany). Recombinant murine IL-1{alpha} and tumor necrosis factor (TNF)-{alpha} were from Genzyme (Cambridge, MA), recombinant murine M-CSF, GM-CSF and human IL-2 were gifts of M. Baccarini (Fraunhofer Institute for Toxicology, Hannover, Germany), F. Seiler (Behringwerke) and L. Kaiser (EuroCetus, Frankfurt, Germany) respectively.

Astroglia
Primary brain cell cultures were prepared from newborn mice as described (15). Following enzymatical digest (45 min in 0.1 U/ml collagenase + 0.8 U/ml dispase and a further 45 min with an additional 0.2 mg/ml DNase I) of minced cortices, cells were seeded at a density of 3–4x105/ml into tissue culture plates or flasks. After reaching confluence at day 7–11, monolayers were fed by daily renewing the medium to suppress development of microglia. Astroglia were cultured for 2–4 weeks until used for experiments. As controlled by immunofluorescence staining, >95% of cells express the astrocytic marker glial fibrillary acidic protein.

Preparation and fractionation of astrocyte-conditioned medium
Astroglia (5x105–106 cells/ml) were stimulated by incubation with GM-CSF (20 ng/ml) or phorbol myristate acetate (PMA; 1 ng/ml) in FCS-depleted medium. After 7 days, the supernatant (SN) was collected. SN from PMA-stimulated astroglia was further concentrated by filtration through a 30 kDa membrane (Amicon, Beverly, MA). The retentate was dialyzed against 30 mM Tris–HCl, pH 7.4, and subjected to gel filtration on a PD10 column (Pharmacia, Uppsala, Sweden). For testing of biological activity the pooled concentrated material was filter sterilized and stored at –70°C. Further purification was performed by FPLC: samples of 2 ml were applied on a `Mono Q' column (Pharmacia) which had been equilibrated with 30 mM Tris–HCl, pH 7.4. Sixty fractions of 1 ml were eluted in that buffer under a discontinuous salt gradient (0–1000 mM NaCl). Fractions were filter-sterilized and stored at –70°C. For some experiments fractions under the M-CSF peak at 500 mM Na+ were pooled.

M-CSF assays
To analyze astrocyte secretion of M-CSF, 106 cells/ml were incubated for 48 h in serum-free medium with TNF-{alpha}, IL-1{alpha} or GM-CSF as indicated, or remained untreated. Specificity of the GM-CSF stimulus was controlled by addition of neutralizing anti-GM-CSF mAb MP1-31G6 (Endogen, Woburn, MA). Supernatants were tested for M-CSF by ELISA: maxisorp plates (Nunc, Roskilde, Denmark) were coated with serial dilutions of samples or M-CSF standard in 50 mM Na2B4O7, 150 mM NaCl, pH 9.0. After blocking with 1% skimmed milk and washes with PBS, rat anti-mouse M-CSF mAb YYG-106 (Dianova, Hamburg, Germany) diluted to 100 µg/ml in the blocking solution was allowed to bind to the solid-phase antigen. Binding was detected by using peroxidase-conjugated anti-rat IgM + IgG and o-phenylenediamine or tetramethylbenzidine, and measurement of OD at 490 and 450 nm respectively. The lower detection limit of this assay was 0.5–1 ng/ml M-CSF. Results expressed are mean values ± SD from triplicate determinations.

A bioassay for M-CSF was performed by using cells from M-CSF-driven day 4 mouse bone marrow culture and anti-M-CSF mAb YYG-106 (20 µg/ml) for control. In flat-bottom A/2 microtiter wells, cells (2x103/100 µl) were incubated for 84 h with serially diluted samples or M-CSF standard. Proliferation was measured via incorporation of [3H]thymidine (14.8 kBq/well) during the last 36 h. Results are given as mean U/ml with SD < 10% from 2-fold determinations. One unit of M-CSF activity (corresponding to 15 ng/ml M-CSF) was defined as the concentration which induces half-maximal proliferation of indicator cells.

Culture and isolation of brain-derived APC
Confluent brain cell cultures were treated with GM-CSF (20 ng/ml). In some experiments, the medium was renewed daily and supplemented with GM-CSF plus M-CSF (each 20 ng/ml). Anti-M-CSF mAb YYG-106 (20 µg/ml) had been added when indicated. Seven to 10 days later, loosely adherent dendriform cells were detached by horizontal shaking (120 r.p.m., 2 h at 37°C) with a yield amounting to one-third of the initial brain cell number. Harvested cells were used for flow cytometry or testing of APC function, or were subcultured (0.5–1x106 cells/well) in six-well plates. In some experiments, these cells were subcultured on a layer of allogeneic astroglia (106 cells/2 ml) or separate from those in collagen-coated transwell insets (Costar, Cambridge, MA; pore size 0.4 µm) positioned above. For subsequent assays cells were rinsed from the transwell membrane or were harvested from direct co-culture by shaking off.

Flow cytometry
Antibodies used were: hamster anti-CD11c mAb N418 (Endogen), rat anti-F4/80 mAb CI:A3-1, FITC-labeled rat anti-DC mAb 33D1 (Biotrend, Cologne, Germany), biotinylated rat anti-CD11b mAb M1/70.15, and phycoerythrin (PE)-labeled mouse anti-CD8{alpha} mAb 53-6.7 (PharMingen, San Diego, CA) and rat anti-DEC-205 mAb NLDC-145 (Dianova). Species- and isotype-matched control antibodies, extravidin-FITC and FITC-labeled F(ab')2 fragments of goat anti-rat or anti-hamster IgG as secondary reagents were obtained from PharMingen or Dianova.

Isolated cells were washed and surface stained as described (15). In addition, DNA was stained with propidium iodide. For flow cytometry using a FACScan (Becton Dickinson, Mountain View, CA) samples were gated on microglia-like cells based on forward and side scatter and controlled by F4/80 staining. Per sample 104 intact cells were collected and analyzed using the Lysys II software.

T cell proliferation assays
According to the genotype of newborn mice, the APC function of brain-derived cells was tested against either CD4+ clone ST2/K.9 recognizing bovine insulin with I-A{alpha}bAßk or PPD-specific CD4+ T cell line LNC.2 of BALB/c origin. As detailed in (15), both T cells respond similarly in proliferation assay to brain-derived APC. Reference APC for subcultured cells were cells kept in GM-CSF-supplemented primary culture. Test APC were irradiated and then incubated with syngeneic T cells in the presence or absence of the respective antigen. The proliferation was measured via incorporation of [3H]thymidine (7.4 kBq/well) during the last 14–20 h of 3 day incubation. Results from liquid scintillation counting are presented as mean c.p.m. of triplicate test cultures with SD < 15%.

This assay was modified to quantitate the antigen presentation function-supporting activity in astrocyte SN. Brain-derived APC were irradiated and then incubated in flat-bottom A/2 microtiter wells (3x103 cells/100 µl) with serial dilutions of astrocyte SN or M-CSF. In some experiments, samples had been preincubated for 3 h with anti-M-CSF mAb YYG-106 (20 µg/ml). After 24 h, the medium was replaced by IMDM plus 5% FCS, and T cells (104/well) and antigen (50 µg/ml) were added. Subsequent measurement of T cell proliferation was carried out as described.

RT-PCR
RT-PCR amplification was carried out using the RNA PCR kit from Perkin Elmer (Branchburg, NJ) with rTth DNA polymerase combining activities for reverse transcriptase and DNA polymerase. Sequences of mouse c-fms/M-CSF receptor-specific oligonucleotide primers and probe were: 5'-TCCAACTATGTTGTCAAGGGCAATGCGCTG (sense), 5'-CAGGTTAGCATAGTCCTGGTCTCTCCTCTC (antisense) and 5'-GGGTCT- TCTGGTAGGCTCCAGGTCCCAGCAGG (probe). G3PDH-specific primers were from Clontech (Palo Alto, CA). The reaction mix containing the respective 3' primer and 250 ng of total RNA was heated to 70°C for 15 min. Following quick cooling, the 5' primer was added, and PCR was performed by initial incubation at 95°C for 2 min and subsequently 40 cycles at 95°C/1 min, 60°C/1 min and 72°C/2 min. PCR products were separated by electrophoresis through 1% agarose and visualized with ethidium bromide.

For Southern blot, gels were denatured for 45 min in 0.5 M NaOH, 1.5 M NaCl, then neutralized for a further 45 min in 0.5 M Tris–HCl, 3 M NaCl, pH 8.0 and blotted overnight to a Nytran (Schleicher & Schüll, Dassel, Germany) membrane. Then, the membrane was UV cross-linked (0.6 J/cm2). The probe had been labeled at the 5' end with [{gamma}-32P]ATP using T4 polynucleotide kinase (Boehringer Mannheim). Following hybridization overnight at 68°C, the filters were washed twice in 2xSSC, 0.1% SDS and then in 0.1xSSC, 0.1% SDS for 5 min each at room temperature. Finally, the filters were exposed to Kodak SB-2 film.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
DC-like cells develop in brain cell primary culture supplemented with GM-CSF
We previously demonstrated that GM-CSF triggers the emergence of professional APC in primary brain cell culture (15). For a detailed phenotypic examination such cells were subjected to immunofluorescence staining of surface markers which are restricted to DC and/or characterize a DC subset (Fig. 1Go). More than 95% of isolated cells expressed F4/80 and CD11b, thus confirming their original classification to microglia/brain macrophage. In addition, a majority of >70% stained positive for the DC markers CD11c and 33D1. CD8{alpha} was not detected but a proportion of ~10% of isolated cells expressed DEC-205 which so far has been found on Langerhans cells and some DC from lymphoid organs (710,18). Similar results were obtained with cells harvested at day 12, 14, 19 or 22 of primary brain cell culture from BALB/c or (B10xC3H)F1 mice. Collectively, these data prove that most of GM-CSF-grown brain cells exhibit the phenotype of myeloid DC at an intermediate maturational stage.



View larger version (9K):
[in this window]
[in a new window]
 
Fig. 1. Microglia-like cells enriched from GM-CSF-treated brain cell culture phenotypically resemble myeloid DC. Loosely adherent dendriform cells were isolated from day 14 primary brain cell culture treated with GM-CSF (20 ng/ml). Cells were stained for cytofluorimetric analysis with mAb N418 (anti-CD11c), 33D1 (anti-DC), CI:A3-1 (anti-F4/80), M1/70.15 (anti-CD11b), NLDC-145 (anti-DEC-205), 53-6.7 (anti-CD8{alpha}) or isotype-matched control mAb. Results from one representative experiment of four are expressed showing the respective control staining (open histogram) and specific mAb binding (dark histogram).

 
The capability of GM-CSF-grown dendriform brain cells for antigen presentation decreases following isolation but is preserved in the presence of astrocytes and GM-CSF
Enrichment of DC-like cells in the isolated brain cell population correlates with their IFN-{gamma}-independent capability for antigen presentation (15). However, this function is lost during separate culture with GM-CSF (Fig. 2AGo). Antigen presentation function was judged by measuring the proliferative T cell response induced by an optimal number of test APC. After 3 days of subculture, the capability for antigen presentation was diminished by 20% compared to that of cells kept in primary culture. Maintenance of isolated dendriform brain cells (DBC) for 9 days resulted in an almost complete loss of APC function. Since DBC are excellent APC from day 12 of GM-CSF-treated brain cell culture (15), these findings highlight a time-dependent decrease in function upon isolation.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 2. Presence of astrocytes and GM-CSF preserves APC function of DBC. (A) Dendriform cells were isolated from GM-CSF-treated brain cell culture at day 13 ({lozenge}) or 19 ({blacktriangleup}) and were subcultured with GM-CSF. At day 22, cells were irradiated and incubated at titrated numbers with bovine insulin-specific CD4+ T clone ST2/K.9 (2x104 cells) in the presence or absence of antigen (50 µg/ml). Reference APC were cells isolated at day 22 from continued primary culture (•). T cell proliferation was measured via uptake of [3H] thymidine. Proliferation without antigen was <480 c.p.m. (B) At day 16 of GM-CSF-treated primary culture, DBC were isolated and subcultured for 5 days with or without GM-CSF, alone or in co-culture with allogeneic astroglia. Then, cells were harvested and tested as APC against PPD-specific LNC.2 T cells. Freshly isolated cells from day 21 brain cell primary culture served as reference APC. Mean c.p.m. values of triplicate test cultures with SD <15% are given representing proliferation of 104 T cells in the presence of 103 APC and PPD (black bars) or without antigen (open bars).

 
In order to test whether other brain cells influence APC function of GM-CSF-grown DBC, isolated cells were subcultured with allogeneic astroglia in the presence or absence of GM-CSF. Subsequently, antigen presentation by re-isolated cells was measured. As shown by the proliferative T cell response at a ratio of 1 APC per 10 T cells, these cells retained >90% of functional activity over 5 days in the presence of both astrocytes and GM-CSF (Fig. 2BGo). Without GM-CSF, astrocytes mediated a weak supportive effect. Incubation with GM-CSF alone allowed brain-derived APC to induce a T cell response at ~40% of the level achieved by freshly isolated cells.

In combination with GM-CSF, a soluble astrocytic factor(s) confers prolonged APC function in DBC
To test if the interaction between astrocytes and GM-CSF-grown DBC requires cell–cell contact or is mediated by a soluble factor(s), isolated DBC were subcultured in transwells above an astrocyte layer. After 8 days of such co-culture, antigen presentation function of DBC was comparable to that of cells from unseparated co-culture. As depicted in Fig. 3Go(A), astrocytes or GM-CSF alone delivered a weak and half-maximal support respectively. The combination, however, enabled the test APC to perform ~90% of the function of freshly isolated DBC. Direct incubation of DBC with astrocyte-conditioned media was equally effective: SN from GM-CSF-treated astroglia optimally prevented the loss of APC function. In comparison, GM-CSF and/or SN from untreated astroglia were significantly less effective (Fig. 3BGo). These data indicate that astrocytes help DBC via soluble molecules.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3. Astrocytes preserve APC function of DBC via soluble factor(s). (A) Comparable to the experimental design in Fig. 2Go(B), DBC from day 17 primary culture with GM-CSF were subcultured for 8 days in transwells above medium or allogeneic astroglia in the presence or absence of GM-CSF. Antigen presentation function of re-isolated cells and of reference APC from day 25 primary culture was measured in proliferation assay with PPD-specific LNC.2 T cells. Values represent the mean c.p.m. with SD <15% from triplicate test cultures containing 103 APC and 104 T cells with PPD (black bars) or without (open bars). (B) Day 14 DBC were subcultured for 5 days with GM-CSF (20 ng/ml) and/or medium conditioned by untreated (SN) or GM-CSF-treated (SNGM-CSF) astroglia (5x105 cells/ml, 48 h) completed with FCS. Reference APC were isolated from GM-CSF-treated day 19 primary culture. Then, cells were tested for APC function in T cell proliferation assay with LNC.2 T cells as described above.

 
In astrocyte-conditioned medium, the activity maintaining APC function of DBC co-fractionates with M-CSF and is functionally identical with this cytokine
The activity supporting APC function of DBC was purified from SN of PMA-stimulated astroglia since such cells release 6 times more of this activity than untreated astrocytes (data not shown). Filtration of astrocyte-conditioned medium through a molecular sieve (30 kDa) membrane concentrated the activity in the retentate (not shown). Subsequent fractionation by anion-exchange chromatography on a Mono Q column revealed that the majority of the recovered activity was eluted over the 400–600 mM NaCl region of the gradient with a peak at 500 mM (Fig. 4AGo). This fraction constituted ~22% of the total recovered activity. The 500 mM NaCl fractions from several runs were pooled and tested in a series of cytokine assays. No bioactivity for IL-1, IL-2, IL-3, IL-4, IFN or TNF was detected in this material nor was IL-10, IL-12, GM-CSF or nerve growth factor found by ELISA. Minute IL-6 activity was detected (not shown) but M-CSF was highly enriched by the purification protocol as determined by ELISA and bioassay (Fig. 4BGo). Obviously, the astrocyte activity which supports APC function of DBC co-fractionated with astrocytic M-CSF.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 4. The activity supporting APC function of DBC co-fractionates with astrocytic M-CSF. (A) Chromatography of a 110-fold concentrated SN from PMA-stimulated astroglia. Details are given in Methods. In fractions eluted under a 0–1000 mM NaCl gradient, the protein content (left) and the activity which supports APC function of DBC (right) were quantified. Irradiated cells were incubated for 24 h with serially diluted samples prior to use as APC (3x103/well) in T cell proliferation assays with PPD-specific LNC.2 T cells (104/well). Values represent proliferation in the presence of antigen (without <590 c.p.m.) and APC pretreated with 54-fold diluted eluates. (B) M-CSF was quantified by ELISA (left) and bioassay (right). For ELISA, samples were 3-fold diluted. Measuring range in bioassay was from 420 c.p.m. (medium control) to 23,400 c.pm. (maximum proliferation with M-CSF standard).

 
To test whether M-CSF can replace the astrocyte activity, isolated DBC were subcultured in the presence of GM-CSF plus M-CSF followed by measurement of APC function. As shown in Fig. 5Go, administration of recombinant M-CSF instead of astrocyte-conditioned medium resulted at concentrations between 30 and 300 ng/ml in most efficient antigen presentation by subcultured DBC. This effect was abolished by addition of neutralizing anti-M-CSF mAb. Furthermore, this antibody blocked the supportive activity in the 500 mM NaCl fraction of astrocyte SN (Fig. 6Go). Thus, in addition to GM-CSF, M-CSF proved to be required by DBC to preserve their capability for antigen presentation.



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 5. M-CSF up-regulates antigen presentation function in GM-CSF-grown DBC. Brain-derived APC were isolated at day 18 from GM-CSF-treated primary culture and were pulsed for a further 24 h with titrated M-CSF in the presence ({blacktriangledown}) or absence (*) of neutralizing anti-M-CSF mAb YYG-106 (20 µg/ml). Then, cells were irradiated and co-cultured (3x103/well) with insulin-specific T clone ST2/K.9 (104 cells/well) in the presence or absence of antigen. Proliferation was measured via thymidine incorporation. Without antigen it was <740 c.p.m.

 


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 6. Anti-M-CSF mAb blocks the astrocyte activity supporting antigen presentation function of DBC. Brain-derived APC were isolated at day 18 from GM-CSF-treated primary culture and were incubated for a further 24 h in serial dilutions of the 500 mM NaCl fraction prepared (see Fig. 4Go) from astrocyte SN ({blacksquare}). In half of the cultures, additional anti-M-CSF mAb YYG-106 (20 µg/ml) was present ({blacktriangledown}). Then, cells were irradiated and tested against T cell clone ST2/K.9 as described in Fig. 5Go. Proliferation without antigen was <960 c.p.m.

 
GM-CSF up-regulates secretion of M-CSF by astrocytes
Our observation that SN from GM-CSF-treated astroglia was more efficient in supporting APC function of DBC than was the combination of SN from untreated astroglia plus GM-CSF implies that GM-CSF may affect astrocyte production of M-CSF. This hypothesis was tested by directly measuring astrocyte M-CSF release in the presence of GM-CSF. For comparison, cells were exposed to IL-1{alpha} or TNF-{alpha} which both significantly stimulate secretion of M-CSF in astrocytes (19). Quantitation of M-CSF protein after 48 h in the SN indicated a strong and dose-dependent up-regulation of M-CSF release by IL-1{alpha} and TNF-{alpha}. A weaker response was found in GM-CSF-treated astroglia (Fig. 7Go): At the concentration used to promote outgrowth of dendriform brain cells from primary culture, GM-CSF triggered an ~4-fold increased secretion of M-CSF by astrocytes.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 7. GM-CSF stimulates astrocyte secretion of M-CSF. In serum-free culture, astroglia (106 cells/ml) were exposed for 48 h to titrated doses of TNF-{alpha}, IL-1{alpha} or GM-CSF or remained untreated. Anti-GM-CSF mAb MP1-31G6 (100 µg/ml) was present in part of GM-CSF-treated and untreated cultures (dark bars). M-CSF release into the SN (light bars) was quantified by ELISA.

 
Maturation of brain-derived APC depends on the coordinate action of M-CSF and GM-CSF
Whether endogenous M-CSF in brain cell primary culture contributes to the development of antigen-presenting DBC was analyzed by depletion experiments. At the beginning of supplementation with GM-CSF, either neutralizing anti-M-CSF mAb was added or the medium was deprived of endogenous factors by daily renewal. In parallel cultures, the medium was continuously supplemented with recombinant M-CSF, controls were maintained without cytokine supplementation. Ten days later, loosely adherent cells were isolated with a markedly reduced yield in M-CSF-depleted cultures. Measurement of APC function indicated (Fig. 8AGo) that anti-M-CSF treatment or the lack of GM-CSF led to functionally incompetent cells. By comparison, cells harvested from factor-depleted culture to which M-CSF plus GM-CSF had been re-added proved as excellent in antigen presentation as those from GM-CSF-treated unimpaired culture, demonstrating that the combination of endogenous M-CSF and exogenous GM-CSF triggers functional maturation of APC. Responsiveness of these cells to M-CSF was further substantiated by RT-PCR, which revealed expression of the c-fms/M-CSF receptor gene in the isolated cells (Fig. 8BGo). Transcripts for c-fms/M-CSF receptor were also found in cells from M-CSF-depleted culture, indicating refractory expression to occur even in the absence of the cytokine.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 8. Development of brain-derived APC depends on the presence of GM-CSF and M-CSF. (A) Parallel to supplementation with GM-CSF (•) of day 8 primary brain cell cultures, anti-M-CSF mAb YYG-106 (20 µg/ml) was added and this was repeated in 2-day intervals ({blacktriangledown}). Alternatively, the medium was daily renewed with GM-CSF plus additional (*) or without ({square}) M-CSF. A control culture remained untreated. At day 18, loosely adherent dendriform cells were isolated and tested as APC against T cell clone ST2/K.9. Proliferation in the presence of APC from untreated control culture was <7200 c.p.m. (dashed line), in the absence of antigen <610 c.p.m. (B) Total RNA was extracted from DBC isolated at day 22 from GM-CSF-treated (lane 2) or additionally M-CSF-depleted (3) primary culture. Samples were analyzed by RT-PCR and Southern blot for transcripts of M-CSF receptor/c-fms. Lane 1 represents the H2O control. As a control for equal amplification and gel loading, the G3PDH gene message was analyzed simultaneously.

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The phenotypical and functional characterization of dendriform cells enriched from GM-CSF-treated brain cells highlights a development of immature DC-like APC from intracerebral progenitors. In general, the CNS environment is considered immunosuppressive due to neuronal activity which down-regulates antigen presentation in epidermal DC (20) or microglia (21). Nevertheless, the detection of DC-like cells at the choroid plexus (22) and their emergence in the brain parenchyma during experimental allergic encephalomyelitis and in delayed-type hypersensitivity lesions (23,24) indicate that DC may, indeed, mature within the CNS. The even distribution of DC-like cells in the inflamed brain (23) renders a blood-born origin unlikely and favors generation from pre-existing (13) immature microglia.

By expressing CD11c, 33D1, F4/80 and CD11b, GM-CSF-grown DBC phenotypically correspond to the myeloid DC in spleen (7) and resemble long-term-cultured splenic DC (25). As found on these two DC populations, a remarkable number of DBC co-expresses the myeloid markers F4/80 and CD11b with DEC-205, suggesting that expression of this multi-lectin receptor is not confined to the lymphoid-related DC subset and may be up-regulated in culture (9). Functionally, these brain-derived cells resemble DC as defined by their intrinsic capability for antigen presentation to Th1 and Th2 cells (15); however, they lack co-stimulatory molecules and fail to activate naive T cells (H. G. Fischer and U. Bonifas, unpublished). Together, both phenotypic and functional characteristics suggest that GM-CSF-grown DBC are immature myeloid DC.

Surprisingly, astrocyte help proved to be prerequisite for these cells to acquire and continuously perform APC function. Identification of M-CSF as the astrocyte product required for functional maturation and prolonged activity of brain-derived APC reveals an unusual cofactor for GM-CSF effects on professional APC. So far, GM-CSF has been proven essential for the differentiation of DC with IL-4 acting as cofactor in most in vitro systems (summarized in 26). In addition, recent evidence indicates that hematopoietic growth factors which engage tyrosine-kinase receptors, i.e. stem cell factor/c-kit ligand, flt3-ligand and M-CSF, can stimulate the growth of myeloid-derived DC progenitors (27). In combination with GM-CSF, c-kit ligand was found to expand DC from bone marrow precursors (28). Similarly, systemic administration of flt3-ligand to mice increases the number of myeloid- and lymphoid-derived DC in bone marrow, thymus, spleen, peripheral blood and other tissues (29). In line with these data is our finding that M-CSF which is structurally most closely related to flt3-ligand promotes development of DC-like APC from brain cells: M-CSF withdrawal during primary culture of mixed glial cells prevents generation of APC even in the presence of GM-CSF. Since in mouse brain M-CSF as well as its receptor are constitutively expressed (30), our findings imply a permanent potential for the differentiation of IFN-{gamma}-independent APC from intracerebral progenitors. Trigger would be a local release of GM-CSF,e.g. as a consequence of CNS inflammation.

The effect of M-CSF in promoting development of brain-derived APC and maintaining them in a functionally active stage seems to conflict with the generally accepted model that M-CSF exclusively determines differentiation to macrophages. However, M-CSF effects on brain-derived APC were only observed in the presence of GM-CSF or following a 24 h pulse treatment of GM-CSF-primed cells. Comparable findings have been reported on mouse epidermal DC lines (31), bone marrow cells (5) and fetal skin DC (32), where a mixture of M-CSF and GM-CSF promotes DC proliferation. Continuous expression of the M-CSF receptor as found in GM-CSF-grown brain cells has been detected on a GM-CSF plus fibroblast SN-dependent DC line established from mouse spleen (25). Cells of this DC line phenotypically most closely resemble the DBC and likewise are capable of presenting soluble antigen without preactivation. Final maturation in terms of increased mobility and IL-12 production is triggered by TNF-{alpha} and occurs within hours. Interestingly, M-CSF alone failed to convert these DC to macrophages (25), suggesting the existence of an irreversibly DC-committed stage before proliferation ends.

On brain cells, M-CSF so far has been characterized as a potent mitogen for microglia (33). To a lesser extent, M-CSF, like GM-CSF, stimulates proliferation of cells isolated from GM-CSF-driven primary culture (34). Since astroglia are a source of both cytokines (14,35) and GM-CSF up-regulates M-CSF release by astrocytes, exogenous GM-CSF produces in mixed glia culture a direct and, via paracrine astrocytic M-CSF, an indirect effect on the development and growth of brain-derived APC.

In conclusion, the present data delineate a novel pathway leading to antigen-presenting brain cells. Generation of phenotypically DC-like APC from brain progenitors dependent on astrocyte help indicates how APC could develop intracerebrally due to a trigger by glial cytokines.


    Acknowledgments
 
We wish to thank Ursula Bonifas, Karin Buchholz and Bernd Nitzgen for technical assistance. We also thank Manuela Baccarini, Edgar Schmitt and Fritz Seiler for providing cytokines, T cells or antibodies. This work was supported by the Deutsche Forschungsgemeinschaft (SFB 194/B11).


    Abbreviations
 
APCantigen-presenting cells
DBCdendriform brain cells
CNScentral nervous system
DCdendritic cell
GM-CSFgranulocyte macrophage colony stimulating factor
M-CSFmacrophage colony stimulating factor
PMAphorbol myristate acetate
PPDpurified protein derivative
SNsupernatant
TNFtumor necrosis factor

    Notes
 
1 Present address: Department of Molecular Biology, Cell Biology and Biochemistry, Division of Biology and Medicine, Brown University, Providence, RI 02912, USA Back

Transmitting editor: A. McMichael

Received 1 December 1998, accepted 27 April 1999.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Steinman, R. M. 1991. The dendritic cell system and its role in immunogenicity. Annu. Rev. Immunol. 9:271.[Web of Science][Medline]
  2. Koch, F., Stanzl, U., Jennewein, P., Janke, K., Heufler, C., Kämpgen, E., Romani, N. and Schuler, G. 1996. High level IL-12 production by murine dendritic cells: up-regulation via MHC class II and CD40 molecules and downregulation by IL-4 and IL-10. J. Exp. Med. 184:741.[Abstract/Free Full Text]
  3. Heufler, C., Koch, F., Stanzl, U., Topar, G., Wysocka, G., Trinchieri, G., Enk, A., Steinman, R. M., Romani, N. and Schuler, G. 1996. Interleukin-12 is produced by dendritic cells and mediates TH1 development as well as interferon-{gamma} production by TH1 cells. Eur. J. Immunol. 26:659.[Web of Science][Medline]
  4. Reis e Sousa, C., Hieny, S., Scharton-Kersten, T., Jankovic, D., Charest, H., Germain, R. N. and Sher, A. 1997. In vivo microbial stimulation induces rapid CD40 ligand-independent production of interleukin 12 by dendritic cells and their redistribution to T cell areas. J. Exp. Med. 186:1819.[Abstract/Free Full Text]
  5. Inaba, K., Inaba, M., Romani, N., Aya, H., Deguchi, M., Ikehara, S., Muramatsu, S. and Steinman, R. M. 1992. Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte/macrophage colony-stimulating factor. J. Exp. Med. 176:1693.[Abstract/Free Full Text]
  6. Cella, M., Sallusto, F. and Lanzavecchia, A. 1997. Origin, maturation and antigen presenting function of dendritic cells. Curr. Opin. Immunol. 9:10.[Web of Science][Medline]
  7. Pulendran, B., Lingappa, J., Kennedy, M. K., Smith, J., Teepe, M., Rudensky, A., Maliszewski, C. R. and Maraskovsky, E. 1997. Developmental pathways of dendritic cells in vivo. Distinct function, phenotype, and localization of dendritic cell subsets in Flt3 ligand-treated mice. J. Immunol. 159:2222.[Abstract/Free Full Text]
  8. Leenen, P. J. M., Radosevic, K., Voerman, J. S. A., Salomon, B., van Rooijen, N., Klatzmann, D. and van Ewijk, W. 1998. Heterogeneity of mouse spleen dendritic cells: in vivo phagocytic activity, expression of macrophage markers, and subpopulation turnover. J. Immunol. 160:2166.[Abstract/Free Full Text]
  9. Vremec, D. and Shortman, K. 1997. Dendritic cell subtypes in mouse lymphoid organs. J. Immunol. 159:565.[Abstract]
  10. Salomon, B., Cohen, J. L., Masurier, C. and Klatzmann, D. 1998. Three populations of mouse lymph node dendritic cells with different origins and dynamics. J. Immunol. 160:708.[Abstract/Free Full Text]
  11. Metlay, J. P., Witmer-Pack, M. D., Agger, R., Crowley, M. T., Lawless, D. and Steinman, R. M. 1990. The distinct leukocyte integrins of mouse spleen dendritic cells as identified with new hamster monoclonal antibodies. J. Exp. Med. 171:1753.[Abstract/Free Full Text]
  12. Sedgwick, J. D. and Hickey, W. F. 1997. Antigen presentation in the central nervous system. In Keane, R. W. and Hickey, W. F., eds, Immunology of the Nervous System, p. 364. Oxford University Press, New York.
  13. Alliot, F., Lecain, E., Grima, B. and Pessac, B. 1991. Microglial progentiors with a high proliferative potential in the embryonic and adult mouse brain. Proc. Natl Acad. Sci. USA 88:1541.[Abstract/Free Full Text]
  14. Malipiero, U. V., Frei, K. and Fontana, A. 1990. Production of hemopoietic colony-stimulating factors by astrocytes. J. Immunol. 144:3816.[Abstract]
  15. Fischer, H. G., Nitzgen, B., Germann, T., Degitz, K., Däubener, W. and Hadding, U. 1993. Differentiation driven by granulocyte-macrophage colony-stimulating factor endows microglia with interferon-{gamma}-independent antigen presentation function. J. Neuroimmunol. 42:87.[Web of Science][Medline]
  16. Fischer, H. G., Eder, C., Hadding, U. and Heinemann, U. 1995. Cytokine-dependent K+ channel profile of microglia at immunologically defined functional states. Neuroscience 64:183.[Web of Science][Medline]
  17. Fischer, H. G. and Eder, C. 1995. Voltage-gated K+ currents of mouse dendritic cells. FEBS Lett. 373:127.[Web of Science][Medline]
  18. Witmer-Pack, M. D., Swiggard, W. J., Mirza, A., Inaba, K. and Steinman, R. M. 1995. Tissue distribution of the DEC-205 protein that is detected by the monoclonal antibody NLDC-145. Cell. Immunol. 163:157.[Web of Science][Medline]
  19. Théry, C., Stanley, E. R. and Mallat, M. 1992. Interleukin 1 and tumor necrosis factor-{alpha} stimulate the production of colony-stimulating factor 1 by murine astrocytes. J. Neurochem. 59:1183.[Web of Science][Medline]
  20. Hosoi, J., Murphy, G. F., Egan, C. L., Lerner, E. A., Grabbe, S., Asahina, A. and Granstein, R. D. 1993. Regulation of Langerhans cell function by nerves containing calcitonin gene-related peptide. Nature 363:159.[Medline]
  21. Neumann, H. and Wekerle, H. 1998. Neuronal control of the immune response in the central nervous system: linking brain immunity to neurodegeneration. J. Neuropathol. Exp. Neurol. 57:1.[Web of Science][Medline]
  22. Matyszak, M. K., Lawson, L. J., Perry, V. H. and Gordon, S. 1992. Stromal macrophages of the choroid plexus situated at an interface between the brain and peripheral immune system constitutively express major histocompatibility class II antigens. J. Neuroimmunol. 40:173.[Web of Science][Medline]
  23. Matsumoto, Y., Hara, N., Tanaka, R. and Fujiwara, M. 1986. Immunohistochemical analysis of the rat central nervous system during experimental allergic encephalomyelitis, with special reference to Ia-positive cells with dendritic morphology. J. Immunol. 136:3668.[Abstract]
  24. Matyszak, M. K. and Perry, V. H. 1996. The potential role of dendritic cells in immune-mediated inflammatory diseases in the central nervous system. Neuroscience 74:599.[Web of Science][Medline]
  25. Winzler, C., Rovere, P., Rescigno, M., Granucci, F., Penna, G., Adorini, L., Zimmermann, V. S., Davoust, J. and Ricciardi-Castagnoli, P. 1997. Maturation stages of mouse dendritic cells in growth factor-dependent long-term cultures. J. Exp. Med. 185:317.[Abstract/Free Full Text]
  26. Peters, J. H., Gieseler, R., Thiele, B. and Steinbach, F. 1996. Dendritic cells: from ontogenetic orphans to myelomonocytic descendants. Immunol. Today 17:273.[Web of Science][Medline]
  27. Lyman, S. D. and Jacobsen, S. E. W. 1998. c-kit ligand and flt3 ligand: stem/progenitor cell factors with overlapping yet distinct activities. Blood 91:1101.[Free Full Text]
  28. Young, J. W., Szabolcs, P. and Moore, M. A. S. 1995. Identification of dendritic cell colony-forming units among normal human CD34+ bone marrow progenitors that are expanded by c-kit-ligand and yield pure dendritic cell colonies in the presence of granulocyte/macrophage colony-stimulating factor and tumor necrosis factor {alpha}. J. Exp. Med. 182:1111.[Abstract/Free Full Text]
  29. Maraskovsky, E., Brasel, K., Teepe, M., Roux, E. R., Lyman, S. D., Shortman, K. and McKenna, H. J. 1996. Dramatic increase in the numbers of functionally mature dendritic cells in flt3 ligand-treated mice: multiple dendritic cell subpopulations identified. J. Exp. Med. 184:1953.[Abstract/Free Full Text]
  30. Chang, Y., Albright, S. and Lee, F. 1994. Cytokines in the central nervous system: expression of macrophage colony-stimulating factor and its receptor during development. J. Neuroimmunol. 52:9.[Web of Science][Medline]
  31. Xu, S., Ariizumi, K., Edelbaum D., Bergstresser, P. B. and Takashima, A. 1995. Cytokine-dependent regulation of growth and maturation in murine epidermal dendritic cell lines. Eur. J. Immunol. 25:1018.[Web of Science][Medline]
  32. Jakob, T., Saitoh, A. and Udey, M. C. 1997. E-cadherin-mediated adhesion involving Langerhans cell-like dendritic cells expanded from murine fetal skin. J. Immunol. 159:2693.[Abstract]
  33. Suzumura, A., Sawada, M., Yamamoto, H. and Marunouchi, T. 1990. Effects of colony-stimulating factors on isolated microglia in vitro. J. Neuroimmunol. 30:111.[Web of Science][Medline]
  34. Fischer, H. G., Bielinsky, A. K., Nitzgen, B., Däubener, W. and Hadding, U. 1993. Functional dichotomy of mouse microglia developed in vitro: differential effects of macrophage and granulocyte/macrophage colony-stimulating factor on cytokine secretion and antitoxoplasmic activity. J. Neuroimmunol. 45:193.[Web of Science][Medline]
  35. Frei, K., Nohava, K., Malipiero, U. V., Schwerdel, C. and Fontana, A. 1992. Production of macrophage colony-stimulating factor by astrocytes and brain macrophages. J. Neuroimmunol. 40:189.[Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Neurosci.Home page
A. L. Zozulya, S. Ortler, J. Lee, C. Weidenfeller, M. Sandor, H. Wiendl, and Z. Fabry
Intracerebral Dendritic Cells Critically Modulate Encephalitogenic versus Regulatory Immune Responses in the CNS
J. Neurosci., January 7, 2009; 29(1): 140 - 152.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
H. H. Zhang, S. Basu, F. Wu, C. G. Begley, C. J. M. Saris, A. R. Dunn, A. W. Burgess, and F. Walker
Macrophage-colony stimulating factor is required for the production of neutrophil-promoting activity by mouse embryo fibroblasts deficient in G-CSF and GM-CSF
J. Leukoc. Biol., October 1, 2007; 82(4): 915 - 925.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. L. Zozulya, E. Reinke, D. C. Baiu, J. Karman, M. Sandor, and Z. Fabry
Dendritic Cell Transmigration through Brain Microvessel Endothelium Is Regulated by MIP-1{alpha} Chemokine and Matrix Metalloproteinases
J. Immunol., January 1, 2007; 178(1): 520 - 529.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Karman, H. H. Chu, D. O. Co, C. M. Seroogy, M. Sandor, and Z. Fabry
Dendritic Cells Amplify T Cell-Mediated Immune Responses in the Central Nervous System
J. Immunol., December 1, 2006; 177(11): 7750 - 7760.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
N. Kostulas, H.-L. Li, B.-G. Xiao, Y.-M. Huang, V. Kostulas, and H. Link
Dendritic Cells Are Present in Ischemic Brain After Permanent Middle Cerebral Artery Occlusion in the Rat
Stroke, April 1, 2002; 33(4): 1129 - 1134.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. R. Fischer, Y. Luo, M. Luo, L. Santambrogio, and M. E. Dorf
RANTES-Induced Chemokine Cascade in Dendritic Cells
J. Immunol., August 1, 2001; 167(3): 1637 - 1643.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Santambrogio, S. L. Belyanskaya, F. R. Fischer, B. Cipriani, C. F. Brosnan, P. Ricciardi-Castagnoli, L. J. Stern, J. L. Strominger, and R. Riese
Developmental plasticity of CNS microglia
PNAS, May 22, 2001; 98(11): 6295 - 6300.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
M. Pashenkov, Y.-M. Huang, V. Kostulas, M. Haglund, M. Soderstrom, and H. Link
Two subsets of dendritic cells are present in human cerebrospinal fluid
Brain, March 1, 2001; 124(3): 480 - 492.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H.-G. Fischer and G. Reichmann
Brain Dendritic Cells and Macrophages/Microglia in Central Nervous System Inflammation
J. Immunol., February 15, 2001; 166(4): 2717 - 2726.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H.-G. Fischer, U. Bonifas, and G. Reichmann
Phenotype and Functions of Brain Dendritic Cells Emerging During Chronic Infection of Mice with Toxoplasma gondii
J. Immunol., May 1, 2000; 164(9): 4826 - 4834.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (33)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Fischer, H.-G.
Right arrow Articles by Bielinsky, A. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fischer, H.-G.
Right arrow Articles by Bielinsky, A. K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?