International Immunology

This Article Abstract FREE Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (22) Request Permissions Google Scholar Articles by Kaufmann, M. Articles by Pircher, H. Search for Related Content PubMed PubMed Citation Articles by Kaufmann, M. Articles by Pircher, H. Social Bookmarking          What's this?

International Immunology, Vol. 11, No. 5, 731-738, May 1999
© 1999 Japanese Society for Immunology

Identification of an 2,6-sialyltransferase induced early after lymphocyte activation

Martina Kaufmann, Claudine Blaser, Shou Takashima¹, Reinhard Schwartz-Albiez², Shuichi Tsuji¹ and Hanspeter Pircher

Institute for Medical Microbiology and Hygiene, Department of Immunology, University of Freiburg, Hermann-Herder-Strasse 11, 79104 Freiburg, Germany
¹ Molecular Glycobiology, Frontier Research Program, The Institute of Physical and Chemical Research (RIKEN), Wako, Saitama 351-0198, Japan
² Tumor Immunology program, German Cancer Research Center, Im Neuenheimer Feld 280, 69120 Heidelberg, Germany

Correspondence to: H. Pircher

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
We have used mRNA differential display PCR to search for genes induced in activated T cells and we identified a gene encoding an 2,6-sialyltransferase (ST6GalNAc IV) that is rapidly induced in lymphocytes after antigen or mitogen stimulation. The 3.6 kb full-length cDNA clone (MK45) obtained contained a single open reading frame encoding a 302 amino acid protein and a 2.5 kb 3' untranslated region. MK45 expression in in vivo-activated CD8 T cells reached the highest level 4 h after antigen triggering and then declined rapidly to nearly base levels within 45 h. Northern blot analysis further revealed that MK45 expression was also induced in LPS-activated B cells and antigen-triggered CD4 T cells in vitro. MK45 expression was low or undetectable in most other mouse tissues examined, when compared to activated lymphocytes. Importantly, the mRNA expression level of other sialyltransferases remained largely unchanged during the early stage of lymphocyte activation. Finally, increased ecto-sialyltransferase activity and an altered sialylation pattern were demonstrated on the cell surface of early activated CD8 T cells. Our report identifies a candidate sialyltransferase gene that is involved in the early alteration of the sialylation pattern of cell surface molecules in activated lymphocytes.

Keywords: differential display, glycosyltransferases, lymphocyte stimulation, murine, sialylation

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
The identification of genes induced in T cell activation will lead to a better understanding of the mechanisms underlying this process. Using differential display mRNA PCR (1) we have now identified a gene which is strongly induced in stimulated lymphocytes as early as 4 h after interaction with the cognate peptide antigen in vivo. The predicted amino acid sequence of this gene showed high homologies to conserved regions in the S- and L-sialyl motifs of sialyltransferases.

These enzymes are a family of glycosyltransferases that catalyze the transfer of sialic acid to terminal positions of glycoproteins and glycolipids. Tissue and developmental stage-specific expression of sialyltransferases has been demonstrated, indicating that developmentally regulated carbohydrate structures may play an important ontological role (reviewed in 2). Due to their negative charge and their wide occurrence in exposed positions of cell surface molecules, sialic acids function as key determinants of oligosaccharide structures which mediate a variety of biological phenomena. Bound sialic acids may influence conformation of glycoproteins and glycolipids, modulate their biological activity, and are essential components of receptors. However, they may also function as biological masks by preventing recognition of receptors by the corresponding ligands (3).

Sialic acids are also thought to play an important role in the regulation of the immune response (4). Selectins require ligands possessing 2,3-sialic acids for proper recognition (reviewed in 5) and the B cell-specific differentiation antigen CD22, which is involved in cell activation, binds to cellular lactosamine sequences containing 2,6-sialic acids (6,7). Recently, the importance of sialyltransferases for the immune system has been convincingly demonstrated in ST6Gal sialyltransferase-deficient mice; these animals failed to generate an antibody response after antigen challenge (8). In the present study we report the cloning and the expression pattern of a member of the sialyltransferase family that was rapidly induced in lymphocytes after activation.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Animals
C57BL/6 mice were purchased from Harlan Winkelmann (Borchen, Germany). CD8 lymphocytic choriomeningitis virus (LCMV) TCR transgenic mice (line 327) (9), CD8 LCMV TCR/bcl-2 double transgenic mice (10) and CD4 LCMV TCR transgenic mice (11) were bred locally. Animals were kept under conventional conditions.

Peptides
The LCMV glycoprotein peptide 33–41 (GP33 peptide, KAVYNFATM, D^b) was purchased from Neosystem Laboratoire (Strasbourg, France) and dissolved in PBS. The LCMV glycoprotein peptide 61–80 (GP13 P13 peptide, GLNGPDIYKGVYQFKSVEFD, I-A^b) was a kind gift from Dr A. Oxenius (Zürich, Switzerland).

In vivo and in vitro stimulation of T and B cells
CD8 T cells were induced in vivo by i.p. injection of the LCMV GP33 peptide (500 µg in 200 µl PBS) into TCR/bcl-2 transgenic mice. Spleen cells were isolated at the indicated time points, and B and CD4 T cells were removed by a two-step negative selection procedure (Dynabeads; Deutsche Dynal, Hamburg, Germany). The isolated cells were >90% CD8⁺ LCMV TCR⁺. Resting CD8 T cells were isolated analogously from untreated mice. For in vitro stimulation, spleen cells from CD4 or CD8 LCMV TCR transgenic mice were incubated in IMDM (Gibco/BRL, Paisley, UK) supplemented with 10% FCS, penicillin/streptomycin and glutamine in the presence of LCMV GP P13 (5x10^–7 M) or LCMV GP33 (10^–7 M) peptide respectively. To obtain activated B cells, spleen cells from C57BL/6 mice depleted in vivo with anti-CD8 (YTS 169.4) and anti-CD4 (YTS 191.1) mAb (12) were stimulated with lipopolysaccharide (LPS; 10 µg/ml).

RNA isolation
Total RNA was isolated using a RNA isolation kit (Fluka Chemie, Buchs, Switzerland) according to the manufacturer's protocol. Poly(A)⁺ RNA was isolated from total RNA using oligo(dT)₂₅-coupled magnetic beads (Dynabeads mRNA direct kit; Deutsche Dynal).

First-strand cDNA synthesis
To remove genomic DNA, 10–50 µg total RNA was treated with RNase-free DNase I (Boehringer Mannheim, Mannheim, Germany) according to the manufacturer's instructions. Total RNA (2 µg) from resting and activated T cells was used for first-strand synthesis using Superscript II RNaseH^– reverse transcriptase (Gibco/BRL Life Technologies, Gaithersburg, MD). Synthesis was carried out at 42°C in a volume of 10 µl with an oligo(dT)₉ primer according to the manufacturer's instructions.

Differential display
The differential display analysis was performed as described (13), using the DELTA RNA fingerprinting kit (Clontech, Palo Alto, CA).

Clones were screened using a slot-blot hybridization procedure (14) to select for positive clones. Full-length cDNA was obtained using a modified version of 5'RACE PCR (Marathon cDNA amplification kit; Clontech) according to the manufacturer's instructions. Sequences were compared to EMBL GenBank (Heidelberg, Germany), using the FASTA algorithm.

Southern and Northern blot analysis
Genomic DNA was isolated from the kidneys of C57BL/6 mice and 20 µg samples were digested for 4 h with the restriction enzymes indicated. The digests were separated on a 0.8% agarose gel and transferred to nylon membranes (Gene Screen; DuPont Europe, Brussels, Belgium). For Northern blot analysis, 10 µg total RNA was run on an 1.2% agarose/1xMOPS/3.7% formaldehyde gel and transferred overnight to a nylon membrane (Gene Screen). As probes, the original 418 bp differential display fragment (probe A) and a 528 bp PCR fragment (probe B) generated using gene specific 5' (TTTACACCCCCCCTGCTTC) and 3' (TGTTGAGTGAGGGCAGGGTG) primers (Fig. 1A) were used. The probes were labeled with -³²P using the DECAprime II kit (Ambion, Austin, TX). Blots were hybridized according to the manufacturer's instructions and exposed to a BIOMAX MS film (Amersham, Little Chalfont, UK).

View larger version (23K): [in this window] [in a new window]   Fig. 1. (a) Schematic structure of the 3635 bp full-length cDNA clone MK45. The probes used for Northern and Southern blot analysis are indicated. (b) Nucleotide and deduced amino acid sequence of the ORF encoded by MK45. The putative transmembrane domain and the sialyl motifs L and S are indicated. The complete nucleotide sequence is available from the EMBL database under accession no. AJ007310.

 
Assessment of sialyltransferase expression in resting and activated CD8 T cells
RT-PCR was performed using cDNA from resting and activated CD8 T cells and sialyltransferase specific primers: ST3Gal I-5' ATGAGGAGGAAGACCCTCAAG, ST3Gal I-3' CCACCAGCCTCTTGTTCAAC, ST3Gal II-5' GATGAAGTGCTCTCTTCGGG, ST3Gal II-3' CAGGCACGATCTGGAACAGT, ST3Gal III-5' GTGAAGATGGGACTCTTGGT, ST3Gal III-3' ATTGCTCAGGTCGCTGCATG, ST3Gal IV-5' AGCCATGCTTCCAGGGTGAG, ST3Gal IV-3' CCTTGAAAGCTACCAGGACC, ST3Gal V-5' TCAGAGCTATGCTCAGGAAGTCTTGCAGAAG, ST3Gal V-3' ACTGTTCAACCTTATTACCACATCGAACTG, ST6Gal I-5'ATGATTCATACCAACTTGAAG, ST6Gal I-3'GGTGCCCCATTAAACCTCAG, ST6GalNAc I-5' CATGACGAGATATTGCAGAGG, ST6GalNAc I-3' CTGCCTTGCTCTGAGGATTC, ST6GalNAc II-5' AGACCCAGGTTCCCGCCAGG, ST6GalNAc II-3' GAAGTCTGGGTGCAGGAGCTT, ST6GalNAc III-5' TGGATACATAAATGTGAGGACCCAAGAG, ST6GalNAc III-3' GTGGATACTGTAGCAGGCATCCA, ST8Sia I-5' GGGACCCTATCAGTCACCAC, ST8Sia I-3' CTTCTGCAGTCCCTAGGAAG, ST8Sia II-5' TGAAGAATAAGCATTTCCAGACTTGTGCC, ST8Sia II-3' CAGAAGCCATAAAGGTAGATCTGAT, ST8Sia III-5' AGCCCGGGATGAGAAATTGC, ST8Sia III-3' TCATAATGGGCGACACATCT, ST8Sia IV-5' CACCCAAGATGCGCTCAATT, ST8Sia IV-3' TTGGTGAAACTTCAGGCAGG, ST8Sia V-5' CAGGATGCGCTACGCAGACC, ST8Sia V-3' TTCTCGTACCTCTGCAGCAC, MK45 5' GACATGGAGCTCCGAGCAGC, MK45 3' GGGCCTTCATGCTGTCTCTG. The abbreviated nomenclature for sialyltransferases follows the system of Tsuji et al. (15). PCR was performed at 94°C for 1 min, 55°C for 1 min and 72°C for 1.5 min for 20–40 cycles in steps of two cycles to detect the linear range of amplification.

An equivalent amount of template was assessed by G3PDH 5' (GGATCCACCACAGTCCATGCCATCAC) and 3' (AAGCTTTCCACCACCCTGTTGCTGTA) specific primers.

Flow cytometric detection of cell surface sialylation
Extracellular sialyltransferase activity was assessed by incorporation of CMP-9-fluoresceinyl-AcNeu (NeuAc–FITC; Boehringer Mannheim) as described (16). The cells were counterstained with phycoerythrin (PE)-labeled anti-CD8 mAb (PharMingen, San Diego, CA). Sialylated carbohydrate structures were analyzed using plant lectins from elderberry (Sambucus nigra L., SNA) and from Maackia amurensis (MAL II; both from Vector, Burlingame, CA). Cells (1x10⁶) were incubated with 5 µg of the biotinylated lectins in PBS/1% BSA for 15 min at room temperature, washed twice and stained with PE-labeled streptavidin (Caltag, Burlingame, CA) and FITC-labeled anti-CD8 (PharMingen). Staining was performed in PBS containing 2% FCS and 0.1% NaN₃. Viable cells were gated by a combination of forward light scatter and 90° side scatter, and analyzed on a FACSort flow cytometer (Becton Dickinson) using the CellQuest software.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Identification of a cDNA clone (MK45) encoding a sialyltransferase
We performed mRNA differential display PCR to identify genes induced early in T cell activation. By this procedure, we identified a product that appeared only in cDNA from activated, but not from resting CD8 T cells. DNA eluted from this particular band was re-amplified, cloned and sequenced. The resulting 418 bp fragment showed no significant homologies when compared to the EMBL GenBank. By 5'RACE PCR a 3635 bp full-length cDNA clone, named MK45, was obtained. This cDNA consists of a 234 bp 5' untranslated region (UTR), a single open reading frame (ORF) coding for a 302 amino acid protein and a 2492 bp 3' UTR (Fig. 1). Sequence comparison of the amino acid sequence revealed 50–60% homology to the conserved S- and L-sialyl-motifs of sialyltransferases, strongly indicating that the cloned gene is a member of the sialyltransferase family. Southern blot analysis of genomic DNA using probe A, located at the 3' end, and probe B, located directly behind the ORF (Fig. 1a), further revealed a simple pattern, indicating that MK45 represented a single-copy gene (Fig. 2).

View larger version (31K): [in this window] [in a new window]   Fig. 2. Southern blot analysis: 20 µg genomic DNA from C57BL/6 mice was digested with the enzymes indicated and the blotted membrane was hybridized with a 418 bp fragment located directly at the 3' end (probe A). Hybridization with probe B, located directly behind the ORF, yielded the same result (not shown).

 
MK45 is induced in lymphocytes early after activation in vivo and in vitro
Northern blot analysis revealed that MK45 mRNA was expressed in activated but not in resting CD8 T cells (Fig. 3). A single signal of ~3.7 kb was obtained with probe A (3' end), whereas probe B (behind ORF) resulted in multiple signals of ~3.7, 2 and 1.6 kb. This result indicated that three major transcripts (3.7, 2 and 1.6 kb), which differed in the length of their untranslated 3' ends, were generated from this gene.

View larger version (63K): [in this window] [in a new window]   Fig. 3. Northern blot analysis of MK45 expression in resting (r) and activated (a) CD8 T cells. Activated CD8 T cells were isolated ex vivo 4 h after LCMV peptide injection into LCMV TCR transgenic mice. For each lane, 10 µg of RNA was loaded. The membrane was hybridized with probe A, located directly at the 3' end (left), and with probe B, located directly behind the ORF (right). Ethidium bromide staining of 18S rRNA (bottom) shows equal RNA loading.

 
To study kinetics of MK45 expression, CD8 T cells were isolated from LCMV TCR/bcl-2 double transgenic mice at different time points after injection of the cognate LCMV GP33 peptide antigen. LCMV TCR/bcl-2 doubly transgenic mice were used for this experiment since the bcl-2 transgene prevents the GP33 peptide-induced peripheral deletion of the GP33-reactive CD8 T cells (10). As shown in Fig. 4(a), MK45 expression in CD8 T cells reached the highest level 4 h after antigen triggering and then declined rapidly to nearly base levels within 45 h. To examine whether MK45 expression was also induced after in vitro stimulation, spleen cells from CD8 LCMV TCR (line 327) and CD4 LCMV TCR (SMARTA) transgenic mice were cultured in the presence of the corresponding cognate peptide antigens. As depicted in Fig. 4(b and c), MK45 mRNA expression was also induced after in vitro stimulation of CD8 and CD4 T cells. In both cases, highest levels of expression were obtained 12 h after induction (Fig 4, lane 5 in b and c) indicating a slight difference in the kinetics of MK45 expression after in vivo or in vitro stimulation. In addition, MK45 mRNA expression was also induced in LPS-activated B cells within 4 h after stimulation (Fig. 4d). Taken together, these results indicated that MK45 expression was induced in CD4 and CD8 T cells as well as in B cells early after activation.

View larger version (46K): [in this window] [in a new window]   Fig. 4. Kinetics of MK45 expression. (a) CD8 T cells were isolated from CD8 LCMV TCR/bcl-2 transgenic mice at the indicated time points after GP33 peptide treatment. (b and c) Spleen cells from CD8 LCMV TCR (b) and CD4 LCMV TCR (c) transgenic mice were cultured in the presence of the corresponding cognate peptide antigens. In (d) B cells from C57BL/6 mice were stimulated with LPS. At the indicated time points, cultures were harvested, and total RNA was isolated and analyzed by Northern blotting. For each lane 10 µg of RNA was loaded. The membrane was hybridized with probe B. The 28S and 18S rRNA are indicated by bars. Ethidium bromide staining of 18S rRNA shows equal RNA loading.

 
Activated lymphocytes express abundant amounts of MK45 mRNA when compared to other tissues
MK45 expression in various mouse tissues was examined by Northern blotting. In comparison to activated lymphocytes, the 1.6 and 3.7 kb MK45 transcripts were expressed at low levels in lymphoid tissue (Fig. 5, lane 3–5) and in brain and heart (Fig. 5, lanes 7 and 8) but not in kidney, testis and liver (Fig. 5, lanes 6, 9 and 10). The 2 kb transcript, expressed in activated lymphocytes at intermediate levels, was expressed in brain tissue at comparable levels. Taken together, these results indicated that MK45 was expressed in activated lymphocytes at much higher levels than in any other tissue examined.

View larger version (128K): [in this window] [in a new window]   Fig. 5. Northern blot analysis of MK45 expression in different mouse tissues. RNA was isolated from resting (r) and activated (a) LCMV TCR transgenic CD8 T cells, and from the indicated mouse tissues. For each lane, 10 µg of RNA was loaded. The membrane was hybridized with probe B. The 28S and 18S rRNA are indicated by bars. Ethidium bromide staining of 18S rRNA shows equal RNA loading.

 
Sialyltransferases are not generally induced in lymphocyte activation
The above data show that antigen or mitogen stimulation of T and B cells induced a rapid and impressive increase of MK45 mRNA transcripts, which encodes a new member of the sialyltransferase family. To investigate whether sialyltransferases in general are induced in activated lymphocytes, expression of 15 different sialyltransferases was examined by RT-PCR. Expression of ST6GalNAc I, ST6GalNAc III and ST8Sia V was not detected neither in resting nor in activated CD8 T cells (not shown). As depicted in Fig. 6, most sialyltransferases, i.e. ST3Gal I, ST3Gal II, ST3Gal IV, ST3Gal V, ST6Gal I, ST6GalNAc II, ST8Sia II and ST8Sia III, were similarly expressed in resting and activated CD8 T. Expression of ST8Sia I and, to a lower extent, of ST8Sia IV was down-regulated, whereas expression of ST3Gal III was slightly up-regulated after activation. In confirmation of the Northern blot data, MK45 mRNA expression (Fig. 6l) was strongly induced in activated CD8 T cells. Taken together, these data showed that expression of most of the sialyltransferases examined did not significantly vary during the early phase of T cell activation.

View larger version (66K): [in this window] [in a new window]   Fig. 6. Expression of sialyltransferases in resting (r) and activated (a) CD8 T cells from LCMV TCR transgenic mice. RT-PCR was performed using specific primers for the sialyltransferases indicated as described in Methods. Amplification was performed for 20–40 cycles in steps of two cycles The number of cycles are indicated. (a) ST3Gal I, (b) ST3Gal II, (c) ST8Sia IV, (d) ST3 Gal IV, (e) ST3Gal V, (f) ST6Gal I, (g) ST3Gal III, (h) ST8Sia I, (i) ST8Sia II, (j) ST8Sia III, (k) ST6GalNAc II, (l) MK45. RT-PCR of the housekeeping gene G3PDH (m) was used as an internal control.

 
Increased ecto-sialyltransferase activity and altered sialylation pattern on the cell surface of activated CD8 T cells
To examine whether activated lymphocytes exhibited an increased sialyltransferase activity on their surface, incorporation of NeuAc–FITC into cell surface molecules of CD8 T cells was determined by flow cytometry. As shown in Fig. 7(a), the amount of FITC-labeled sialic acid incorporated was significantly higher in activated than in resting T cells, indicating that CD8 T cells displayed an increased sialyltransferase activity on their cell surface 24 h after activation. Finally, sialylated carbohydrate structures on CD8 T cells were analyzed using SNA, which preferentially binds to 2,6-bound sialic acids, and MAL II, which recognizes 2,3-linked sialic acids. As shown in Fig. 7(b), CD8 T cells, 24 h after activation, exhibited a significantly enhanced binding of the SNA lectin, indicating an increase in 2,6-linked sialic acids on carbohydrate structures of these cells.

View larger version (36K): [in this window] [in a new window]   Fig. 7. (a) Flow cytometric detection of ecto-sialyltransferase activity. Resting (left) and in vivo 24 h activated (right) spleen cells from LCMV TCR transgenic mice were incubated with NeuAc–FITC and incorporation of the fluorescence-labeled substrate was examined by flow cytometry after counterstaining with PE-labeled anti-CD8 mAb. (b) Lectin binding by resting (solid line) and activated (dotted line) CD8 T cells from LCMV TCR transgenic mice. Spleen cells were incubated with the lectins MAL (left) and SNA (right). The bound, biotinylated lectins were detected by PE-labeled streptavidin and the cells were counterstained with anti-CD8 mAb. The histograms display lectin binding of gated CD8+ T cells.

 

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
In the present study a 3.6 kb cDNA clone (MK45) was isolated which exhibited high homologies to conserved regions in the S- and L-sialyl-motifs of sialyltransferases. Independently, a 1.1 kb cDNA clone coding for the same protein but with a short 3' UTR has been isolated from mouse brain by another group using a PCR cloning strategy with degenerate primers. Due to the linkage and substrate specificity this latter protein has been named ST6GalNAc IV, since it represents a fourth type of GalNAc 2,6-sialyltransferase (Lee et al., J. Biol. Chem., in press). The presence of the several different mRNA isoforms found here for ST6GalNAc IV is a common feature of sialyltransferases and may be the result of differential exon, promotor and/or polyadenylation site usage (17–19). Characterization of the genomic structure will be necessary to precisely define the mechanism leading to the different mRNA transcripts of this particular gene.

Sialyltransferases are type II transmembrane proteins that are usually located in the Golgi apparatus. The cellular localization of the ST6GalNAc IV described here is unknown. The incorporation of FITC-labeled sialic acid into cell surface molecules of activated CD8 T cells without addition of exogenous sialyltransferase indicated that these cells exhibited sialyltransferase activity on their surface. Similar results have been obtained with the human B cell line JOK1 (16). However, we do not have direct evidence that this ecto-sialyltransferase activity is due to the induction of ST6GalNAc IV. So far, our attempts to induce ecto-sialyltransferase activity by expressing the MK45 cDNA clone in COS-7 or 293T cells have failed. We were also unable to detect cell surface molecules sialylated by Golgi located sialyltransferase in MK45-transfected cells using lectin staining (data not shown). It is possible that these negative results could be explained by a lack of the rather uncommon acceptor molecule NeuAc2,3Galß1,3GalNAc, required for this particular sialyltransferase in the cells used for transfection.

Stimulation of lymphocytes by antigen leads to a sequential induction of genes that are important for proliferation and differentiation. The first genes that are transcribed within minutes to a few hours after receptor ligation have been termed immediate early genes. Expression of the ST6GalNAc IV was induced in CD8 T cells 4 h after stimulation in vivo, indicating that this gene can be considered to be an early gene in lymphocytes. Most of the early genes described so far encode for proteins that act as pleiotropic regulators of cellular activation, such as cytokines, growth factors, receptors, oncogenes, transcription factors and signal transducers (reviewed in 20). In this context, it is remarkable that ST6GalNAc IV, which functions as a modifying enzyme, exhibits the same rapid kinetics in activated T and B cells.

Sialyltransferase activity in activated T cells has been previously analyzed in a small number of studies. However, to the best of our knowledge, a similar rapid induction of sialytransferase activity has not yet been reported. Yamashiro et al. (21) found up-regulation of ST8Sia I mRNA expression in concanavalin A-activated human T cells after 2 days of in vitro culture. In contrast, we observed down-regulation of ST8Sia I mRNA expression in murine CD8 T cells 4 h after antigen stimulation. This discrepancy may be due to the different stimuli employed (specific antigen versus mitogen), the different species (mouse versus human) and/or the different time points of induction (4 versus 48 h) analyzed. Basu et al. (22) observed increased sialyltransferase activities in phytohemagglutinin-activated lymphocytes within 18–36 h of in vitro culture. This result fits well with our data that an increase in sialyltransferase activity can precede the proliferative responses. However, down-regulation of 2,6-sialyltransferase activity in human T cells activated for 96 h by anti-CD3 and IL-2 has also been demonstrated (23).

The amount of sialic acid on the cell surface is also determined by sialidase activity. Earlier reports have revealed that T cells exhibit an increase in sialidase activity 2–5 days after activation that leads to hyposialylation of cell surface molecules (24–27). Recently, a decrease of sialylated cell surface carbohydrates due to increased sialidase activity has also been demonstrated on day 8 effector CD8 T cells from LCMV-infected mice (28). In contrast to this report, we here analyzed sialyltransferase activity in LCMV-specific CD8 T cells 4–45 h after antigen contact.

The B cell-specific surface antigen CD22, a lectin which recognizes 2,6-sialylated glycans (6,7), has been shown to play a regulatory role in B cell activation (29). Interactions with sialic acids may influence this regulatory role. Cyster et al. have proposed a role for 2,6-sialylated carbohydrates on cell surfaces in controlling BCR signaling (30). CD22 may bind to IgM molecules through 2,6-sialylated sugars, thereby negatively regulating antigen receptor signaling. In a non-lymphoid microenvironment, the level of 2,6-sialylated carbohydrates is low, favoring CD22–IgM association and negative regulation. When a B cell enters an activated lymphoid microenvironment that is rich in 2,6-linked sialic acid, CD22 is drawn away from IgM, which will augment BCR-mediated signaling. One may now speculate that fast induction of 2,6-sialytransferase activity, as described here for ST6GalNAc IV, in T and B cells may generate such a microenvironment and allow an enhanced B cell response.

Besides the proposed role in T–B cell interaction a further function of antigen-induced up-regulation of sialyltransferase activity in activated lymphocytes can be envisaged. Enhanced enzymatic addition of sialic acid to membrane proteins results in an increased negative charge of the cell surface. This may enhance disengagement of the activated lymphocytes from neighbouring cells and regulate their homing. To define the precise biological role of the sialyltransferase described here, mice deficient in ST6GalNAc IV would be of great value.

	Acknowledgments

 
We thank Dr A. Oxenius (Zürich, Switzerland) for the generous gift of CD4 LCMV TCR transgenic mice. We also thank S. Batsford for comments on the manuscript, M. Rawiel and A. Merling for excellent technical assistance, and S. Denkler and T. Imhof for animal husbandry. This work was supported by the State of Baden-Württemberg (Zentrum für Klinische Forschung I/Universitätsklinikum Freiburg).

	Abbreviations

 

Gal	galactose
GalNAc	N-acetylgalactosamine
GP33	glycoprotein peptide amino acid 33–41
LCMV	lymphocytic choriomeningitis virus
LPS	lipopolysaccharide
MAL	Maackia amurensis lectin
NeuAc	5' N-acetylneuraminic acid
ORF	open reading frame
OVA	ovalbumin
PE	phycoerythrin
Sia	sialic acid
SNA	Sambucus nigra L. lectin
ST	sialyltransferase
ST6GalNAc	sia2,3Galß1,3GalNAc GalNAc2,6-sialyltransferase
UTR	untranslated region

	Notes

 
Transmitting editor: K. Eichmann

Received 28 September 1998, accepted 21 January 1999.

	References

Top Abstract Introduction Methods Results Discussion References

 

1. Liang, P. and Pardee, A. B. 1992. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257:967.[Abstract/Free Full Text]
2. Tsuji, S. 1996. Molecular cloning and functional analysis of sialyltransferases. J. Biochem. 120:1.[Abstract/Free Full Text]
3. Schauer, R. 1985. Sialic acids and their role as biological masks. Trends Biochem. Sci. 10:357.[Web of Science]
4. Pilatte, Y., Bignon, J. and Lambre, C. R. 1993. Sialic acids as important molecules in the regulation of the immune system: pathophysiological implications of sialidases in immunity. Glycobiology 3:201.[Free Full Text]
5. Varki, A, 1994. Selectin ligands. Proc. Natl Acad. Sci. USA 91:7390.[Abstract/Free Full Text]
6. Stamenkovic, I., Sgroi, D., Aruffo, A., Sy, M. S. and Anderson, T. 1992. The B lymphocyte adhesion molecule CD22 interacts with the leukocyte common antigen CD45RO on T cells and 2-6-sialyl-transferase, CD75, on B cells. Cell 66:1122.
7. Sgroi, D., Varki, A., Braesch-Andersen, S. and Stamenkovic, I. 1993. CD22, a B cell-specific immunoglobulin superfamily member, is a sialic acid-binding lectin. J. Biol. Chem. 268:7011.[Abstract/Free Full Text]
8. Hennet, T., Chui, D., Paulson, J. C. and Marth, J. D. 1998. Immune regulation by the ST6Gal sialyltransferase. Proc. Natl Acad. Sci. USA 95:4504.[Abstract/Free Full Text]
9. Pircher, H., Bürki, K., Lang, R., Hengartner, H. and Zinkernagel, R. M. 1989. Tolerance induction in double specific T-cell receptor transgenic mice varies with antigen. Nature 342:559.[Medline]
10. Petschner, F., Zimmermann, C., Strasser, A., Grillot, D., Nunez, G. and Pircher, H. 1998. Constitutive expression of Bcl-x or Bcl-2 prevents peptide antigen-induced T cell deletion but does not influence T cell homeostasis after a viral infection. Eur. J. Immunol. 28:560.[Web of Science][Medline]
11. Oxenius, A., Bachmann, M. F., Zinkernagel, R. M. and Hengartner, H. 1998. Virus-specific MHC class II-restricted TCR-transgenic mice: effects on humoral and cellular immune responses after viral infection. Eur. J. Immunol. 28:390.[Web of Science][Medline]
12. Cobbold, S. P., Jayasuriya, A., Nash, A., Prospero, T. D. and Waldmann, H. 1984. Therapy with monoclonal antibodies by elimination of T cell subsets in vivo. Nature 312:548.[Medline]
13. Blaser, C., Kaufmann, M., Müller, C., Zimmermann, C., Wells, V., Mallucci, L. and Pircher, H. 1998. ß-Galactoside-binding protein secreted by activated T cells inhibits antigen-induced proliferation of T cells. Eur. J. Immunol. 28:1.[Web of Science][Medline]
14. Vögeli-Lange, R., Bürckert, N., Boller, T. and Wiemken, A. 1996. Rapid selection and classification of positive clones generated by mRNA differential display. Nucleic Acids Res. 24:1385.[Free Full Text]
15. Tsuji, S., Datta, A. D. and Paulson, J. C. 1996. Systematic nomenclature for sialyltransferases. Glycobiology 6:5.[Free Full Text]
16. Gross, H.-J., Merling, A., Moldenhauer, G. and Schwartz-Albiez, R. 1996. Ecto-sialyltransferase of human B lymphocytes reconstitutes differentiation markers in the presence of exogenous CMP-N-acetyl-neuraminic acid. Blood 87:5113.[Abstract/Free Full Text]
17. Lo, N.-W. and Lau, J. T. Y. 1996. Transcription of the ß-galactoside 2,6-sialyltransferase gene in B lymphocytes is directed by a separate and distinct promoter. Glycobiology 6:271.[Abstract/Free Full Text]
18. Yoshida, Y., Kurosawa, N., Kanematsu, T., Taguchi, A., Arita, M., Kojima, N. and Tsuji, S. 1996. Unique genomic structure and expression of the mouse 2,8-sialyltransferase (ST8Sia III) gene. Glycobiology 6:573.[Abstract/Free Full Text]
19. Wang, X., Vertino, A., Eddy, R. L., Byers, M. G., Jani-Sait, S. N., Shows, T. B. and Lau, J. T. Y. 1993. Chromosome mapping and organization of the human ß-galactoside 2,6-sialyltransferase gene. J. Biol. Chem. 268:4355.[Abstract/Free Full Text]
20. Kelly, K. and Siebenlist, U. 1995. Immediate-early genes induced by antigen receptor stimulation. Curr. Opin. Immunol. 7:327.[Web of Science][Medline]
21. Yamashiro, S., Okada, M., Haraguchi, M., Furukawa, K., Lloyd, K. O. and Shiku, H. 1995. Expression of 2, 8-sialyltranferase (GD3 synthase) gene in human cancer cell lines: high level expression in melanomas and up-regulation in activated T lymphocytes. Glycoconj. J. 12:894.[Web of Science][Medline]
22. Basu, S. K., Whisler, R. L. and Yates, A. J. 1986. Effects of lectin activation on sialyltransferase activities in human lymphocytes. Biochemistry 25:2577.[Medline]
23. Piller, F., Piller, V., Fox, R. I. and Fukuda, M. 1988. Human T-lymphocyte activation is associated with changes in O-glycan biosynthesis. J. Biol. Chem. 263:15146.[Abstract/Free Full Text]
24. Landolfi, N. F., Leone, J., Womack, J. E. and Cook, R. G. 1985. Activation of T lymphocytes results in an increase in H-2-encoded neuraminidase. Immunogenetics 22:159.[Web of Science][Medline]
25. Taira, S. and Nariuchi, H. 1988. Possible role of neuraminidase in activated T cells in the recognition of allogeneic Ia. J. Immunol. 141:440.[Abstract]
26. Landolfi, N. F. and Cook, R. G. 1986. Activated T-lymphocytes express class I molecules which are hyposialylated compared to other lymphocyte populations. Mol. Immunol. 23:297.[Web of Science][Medline]
27. Casabó, L. G., Mamalaki, C., Kioussis, D. and Zamoyska, R. 1994. T cell activation results in physical modification of the mouse CD8ß chain. J. Immunol. 152:3974.
28. Galvan, M., Murali-Krishna, K., Lau Ming, L., Baum, L. and Ahmed, R. 1998. Alterations in cell surface carbohydrates on T cells from virally infected mice can distinguish effector/memory CD8⁺ T cells from naive cells. J. Immunol. 161:641.[Abstract/Free Full Text]
29. Sato, S., Tuscano, J. M., Inaoki, M. and Tedder, T. F. 1998. CD22 negatively and positively regulates signal transduction through the B lymphocyte antigen receptor. Immunology 10:287.
30. Cyster, J. G. and Goodnow, C. C. 1997. Tuning antigen receptor signaling by CD22: integrating cues from antigens and the microenvironment. Immunity 6:509.[Web of Science][Medline]

CiteULike    Connotea    Del.icio.us    What's this?

This article has been cited by other articles:

				S. Rifat, T. J. Kang, D. Mann, L. Zhang, A. C. Puche, N. M. Stamatos, S. E. Goldblum, R. Brossmer, and A. S. Cross Expression of sialyltransferase activity on intact human neutrophils J. Leukoc. Biol., October 1, 2008; 84(4): 1075 - 1081. [Abstract] [Full Text] [PDF]

				J. D. Hernandez, J. Klein, S. J. Van Dyken, J. D. Marth, and L. G. Baum T-cell activation results in microheterogeneous changes in glycosylation of CD45 Int. Immunol., July 2, 2007; (2007) dxm053v1. [Abstract] [Full Text] [PDF]

				E. M. Comelli, M. Sutton-Smith, Q. Yan, M. Amado, M. Panico, T. Gilmartin, T. Whisenant, C. M. Lanigan, S. R. Head, D. Goldberg, et al. Activation of Murine CD4+ and CD8+ T Lymphocytes Leads to Dramatic Remodeling of N-Linked Glycans J. Immunol., August 15, 2006; 177(4): 2431 - 2440. [Abstract] [Full Text] [PDF]

				P. J. Stocker and E. S. Bennett Differential Sialylation Modulates Voltage-gated Na+ Channel Gating throughout the Developing Myocardium J. Gen. Physiol., February 27, 2006; 127(3): 253 - 265. [Abstract] [Full Text] [PDF]

				C. Kao, M. A. Daniels, and S. C. Jameson Loss of CD8 and TCR binding to Class I MHC ligands following T cell activation Int. Immunol., December 1, 2005; 17(12): 1607 - 1617. [Abstract] [Full Text] [PDF]

				R. Morgan, G. Gao, J. Pawling, J. W. Dennis, M. Demetriou, and B. Li N-Acetylglucosaminyltransferase V (Mgat5)-Mediated N-Glycosylation Negatively Regulates Th1 Cytokine Production by T Cells J. Immunol., December 15, 2004; 173(12): 7200 - 7208. [Abstract] [Full Text] [PDF]

				M. Lanteri, V. Giordanengo, N. Hiraoka, J.-G. Fuzibet, P. Auberger, M. Fukuda, L. G. Baum, and J.-C. Lefebvre Altered T cell surface glycosylation in HIV-1 infection results in increased susceptibility to galectin-1-induced cell death Glycobiology, December 1, 2003; 13(12): 909 - 918. [Abstract] [Full Text] [PDF]

				M. Amano, M. Galvan, J. He, and L. G. Baum The ST6Gal I Sialyltransferase Selectively Modifies N-Glycans on CD45 to Negatively Regulate Galectin-1-induced CD45 Clustering, Phosphatase Modulation, and T Cell Death J. Biol. Chem., February 21, 2003; 278(9): 7469 - 7475. [Abstract] [Full Text] [PDF]

				J. D. Hernandez and L. G. Baum Ah, sweet mystery of death! Galectins and control of cell fate Glycobiology, October 1, 2002; 12(10): 127R - 136R. [Abstract] [Full Text] [PDF]

				T. M. Onami, L. E. Harrington, M. A. Williams, M. Galvan, C. P. Larsen, T. C. Pearson, N. Manjunath, L. G. Baum, B. D. Pearce, and R. Ahmed Dynamic Regulation of T Cell Immunity by CD43 J. Immunol., June 15, 2002; 168(12): 6022 - 6031. [Abstract] [Full Text] [PDF]

This Article Abstract FREE Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (22) Request Permissions Google Scholar Articles by Kaufmann, M. Articles by Pircher, H. Search for Related Content PubMed PubMed Citation Articles by Kaufmann, M. Articles by Pircher, H. Social Bookmarking          What's this?

Online ISSN 1460-2377 - Print ISSN 0953-8178

Copyright © 2009 Japanese Society for Immunology

Oxford Journals Oxford University Press

• Site Map
• Privacy Policy
• Frequently Asked Questions

Other Oxford University Press sites: Oxford University Press Oxford Journals China Oxford Journals Japan American National Biography Booksellers' Information Service Children's Fiction and Poetry Children's Reference Corporate & Special Sales Dictionaries Dictionary of National Biography Digital Reference English Language Teaching Higher Education Textbooks Humanities International Education Unit Law Medicine Music Online Products Oxford English Dictionary Reference Rights and Permissions Science School Books Social Sciences Very Short Introductions World's Classics