Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (15)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Chen, F.
Right arrow Articles by Rothenberg, E. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, F.
Right arrow Articles by Rothenberg, E. V.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 11, No. 5, 677-688, May 1999
© 1999 Japanese Society for Immunology

Specific regulation of Fos family transcription factors in thymocytes at two developmental checkpoints

Fei Chen, Dan Chen1 and Ellen V. Rothenberg

Division of Biology 156-29, California Institute of Technology, 1200 East California Boulevard,Pasadena, CA 91125, USA

Correspondence to: E. V. Rothenberg


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
A central question in T cell development is what makes cortical thymocytes respond to stimulation in a qualitatively different way than any other thymocyte subset. Part of the answer is that AP-1 function changes drastically at two stages of T cell development. It undergoes striking down-regulation as thymocytes differentiate from immature, CD4CD8 double-negative (DN) TCR thymocytes to CD4+CD8+ double-positive (DP) TCRlo cortical cells, and then returns in the cells that mature to TCRhigh, CD4+CD8 or CD4CD8+ single-positive (SP) thymocytes. At all three stages, the jun family mRNAs can be induced similarly. However, we demonstrate that DP cortical thymocytes are specifically impaired in c-fos and fosB mRNA induction, even when stimuli are used that optimize survival of the cells and a form of in vitro maturation. fra-2 expression is induction independent but much lower in DP cells than in the other subsets. Overall Fos family protein induction accordingly is severely decreased in DP cells. Defective c-Fos and FosB expression in cortical thymocytes is functionally significant, because antibody supershift experiments show that in activated immature and mature thymocytes, most detectable AP-1 DNA-binding complexes do contain c-Fos or FosB. Thus, defective c-Fos and FosB expression in cortical thymocytes qualitatively alters any AP-1 complexes they might express. The cortical thymocytes are not deficient in mRNA expression for any of the constitutive transcription factors that are known to be needed to drive c-Fos or FosB expression, so it is possible that the activity of these factors is developmentally regulated through a post-transcriptional mechanism.

Keywords: AP-1, ß-selection, positive selection, T cell development


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
T cell precursors undergo a cascade of developmental changes in the thymus, where TCR gene rearrangements confer specificity on the developing cells, the self-reactive cells are eliminated by negative selection and prospective antigen-specific cells are promoted to survive by positive selection. The operation of these selection mechanisms is based on the unique activation physiology of newly TCR+ cells. Such cells have qualitatively different responses to stimulation than either their precursors or their descendants. Before any TCR gene rearrangement, the earliest T cell precursors are functionally competent in a conventional way, with the abilities to express IL-2 and the IL-2 receptor {alpha} chain (CD25) in response to Ca2+ and protein kinase C signals (reviewed in 1). However, these abilities are lost as the cells assemble functional TCR ß chains and pass through `ß selection' to become typical cortical thymocytes. As long as they remain in the CD4+CD8+ [`double-positive' (DP)] cortical thymocyte stage, the cells are programmed to undergo death or positive selection in response to stimulation, rather than to express cytokines or CD25. They regain typical functional responsiveness only when and if they undergo positive selection. The ability of low doses of self-antigen in the thymus to shape the T cell repertoire is entirely dependent on the qualitatively altered responsiveness to stimulation of cortical thymocytes.

At least one important factor contributing to the alteration of responsiveness in cortical thymocytes is the selective failure of these cells to activate AP-1 DNA-binding and transcriptional activity upon stimulation, under conditions that would be mitogenic for peripheral T cells (2,3). Because AP-1-like factors are implicated in a wide range of responses to stimulation (48), the block to AP-1 mobilization in cortical thymocytes could play a direct role in the general diversion of the responses of these cells from effector function to fate determination. Several recent reports indicate that gross perturbation of AP-1 activity can indeed interfere with normal thymocyte population dynamics (9,10) and that AP-1 induction may contribute to thymocyte survival (11).

Changes in AP-1 availability are thus targets of thymocyte differentiation; they may also play some controlling role in thymocyte selection. To be able to test this connection it is necessary to define the molecular basis for the changes in AP-1 activity. AP-1 can be any of a set of heterodimers composed of members of two families of proteins, the Jun family and the Fos family (12,13). At least four Fos proteins (c-Fos, FosB, Fra-1 and Fra-2) and three Jun proteins (c-Jun, JunB and JunD) have been found. The dimer complexes formed by different combinations of Jun–Jun or Jun–Fos proteins may have similar sequence binding specificities but different binding affinities and different trans-activation activities (1416). Differential expression of Fos and Jun family genes can be mediated either transcriptionally or post-transcriptionally, since both the mRNA and the protein for many of these components are unstable and subject to regulation at the level of decay. Moreover, for a given Jun–Jun or Fos–Jun dimer, both DNA-binding and trans-activation activities can be strongly influenced by post-translational modification (12,17,18). Thus changes in AP-1 DNA-binding activity can be mediated by changes in the expression of one or a few Fos or Jun family genes, by differential stabilization or destabilization of the proteins, or by changes in the kinases and phosphatases that act on them. The redundancy and cross-regulation of AP-1 components have made it difficult to infer the basis of AP-1 regulation in lymphocyte development simply via perturbations of function in gene-disruption mutants (9,10,19).

In this work, therefore, we determine the basis for the decrease in AP-1 activity during the DP stage of normal murine thymocyte development by direct analysis of individual AP-1 components. We have used RT-PCR to measure AP-1 subunit mRNA accumulation in three stages of thymocyte development: immature (pre-TCR gene rearrangement), cortical-type (TCR+, prior to positive selection) and mature medullary-type (following positive selection), and we have correlated the ability to express the various RNAs with the presence of the relevant proteins. Our data show that the altered activation behavior of the cortical thymocytes is based on a specific, severe defect in expression of c-Fos and FosB. There is, however, a pronounced difference between the regulation of the Jun family and Fos family proteins. The cortical thymocyte defect does not seem to be caused by a failure to express positive regulatory factors of c-fos itself, such as Elk-1, SRF or CREB, suggesting that passage through developmental checkpoints in the thymus instead alters the activity of these upstream regulators at a post-translational or post-transcriptional level.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Reagents
12-O-Tetradecanoyl phorbol 13-acetate (TPA), calcium ionophore A23187 and ionomycin (Sigma, St Louis, MO), were dissolved in DMSO to stock concentrations of 10 µg/ml, 40 µM and 200 µg/ml respectively. All stock solutions were kept at –80°C. Cortisone acetate (50 mg/ml; Merck Sharp & Dohme, West Point, PA) was administered at 2.5 mg/mouse by i.p. injection.

Cells
Thymocytes were prepared from 4- to 6-week-old mice, C57BL/6 unless otherwise indicated. Immature CD4CD8 [double-negative (DN)] TCR thymocytes were prepared from RAG2–/– mice, and cortical and mature-type thymocytes were obtained from MHC-deficient mice and cortisone-injected C57BL/6 mice respectively. The MHC-deficient mice (ß2-microglobulin–/–, class II0) were bred and maintained in our colony, from founders generously donated by Dr Ellen Robey (UC Berkeley). Other protocols were also used to separate cortical-type and medullary-type thymocytes.

(i) Cortical CD4+ CD8+ TCRlo thymocytes (DP), which are deficient in sialic acid on the cell surface, can adhere strongly to peanut agglutinin (PNA; Vector, Burlingame, CA) and were enriched by PNA panning as previously described (20,21). Mature medullary-type thymocytes, which are TCRhigh and CD4+CD8 or CD4CD8+ [single-positive (SP)], were prepared based on their glucocorticoid resistance, as the thymocytes surviving 2 days after treatment with cortisone as indicated above.
(ii) As an alternative method, the fractionation of cortical and mature thymocytes was carried out by magnetic cell sorting based on the different expression of heat-stable antigen (HSA, i.e. CD24) on the surface of these two types of cells. Unfractionated cells were stained with anti-HSA antibody (M1/69, as hybridoma supernatant) for 30 min at 4°C. The cells were then spun down and washed with a solution of CBSS/BSA/Azide (CBSS/BSA/Azide = 1.25xHBSS without phenol red, plus 2.5 mg/ml BSA and 0.03% sodium azide) to remove the excess antibody. Secondary antibody staining was carried out at 4°C for 15 min using microbeads conjugated with anti-rat {kappa} mAb (Miltenyi Biotec, Auburn, CA). The labeled cell suspension was then passed through a magnetic column (VS+ column; Miltenyi Biotec). Cortical thymocytes, which are HSAhi, were labeled with microbeads and bound to the column, while mature thymocytes, which are HSAlo, were not labeled with microbeads and eluted out from the column. The bound cortical cells were released from the column after the column was removed from the magnet.

Flow cytometric analysis was routinely used to confirm the phenotype of the fractions, as we have recently described in detail (22). All fractionated cells were cultured in RPMI 1640 supplemented with selected lots of 6% fetal bovine serum (Gemini, Calabasas, CA or HyClone, Logan, UT), 2 mM L-glutamine, 50 µM 2-mercaptoethanol and antibiotics. Cells were stimulated with 10 ng/ml TPA and 200 nM calcium ionophore A23187. In experiments to test the response to stimuli that promote in vitro thymocyte maturation (23,24), ionomycin and TPA were used at the various concentrations indicated in the text.

Antibodies
All anti-Fos and anti-Jun antibodies and control peptides were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). The specific antibodies used were: Sp1 (PEP2), # sc-59X; c-Fos[4], # sc-52X; c-Fos (K-25), # sc-253X; Fra-2 (PEP 2), # sc-57X; FosB (102), # sc-48X; c-Jun/AP-1 (D), # sc-44X; and JunB (N-17), # sc-46X. Antibodies used for diagnostic flow cytometry were from PharMingen (San Diego, CA) and Becton Dickinson (San Jose, CA), as previously described in detail (20,25,26). Anti-HSA antibody used in cell fractionation was M1/69 hybridoma supernatant prepared in our own laboratory. Mouse anti-rat {kappa} microbeads were from Miltenyi Biotec.

Gel mobility shift assay
Nuclear protein extraction and gel mobility shift assays were performed by a modification of the method described previously (2). Briefly, 107 thymocytes were used for each nuclear protein extraction. A consensus AP-1-binding sequence (coding strand sequence, GTCGACGTGAGTCAGCGCGC) was used as a probe. Double-stranded radiolabeled oligonucleotide probes were prepared in the presence of [32P]dATP by end-filling and were purified using an Elutip-D column. The binding reactions were carried out using 2–5 µg of protein and 5x104 c.p.m. of 32P-end-labeled oligonucleotides. Nuclear extracts were preincubated with 500 ng of poly(dI–dC) at room temperature for 10 min, followed by another 10 min incubation with the labeled specific oligonucleotide. Reaction mixtures were electrophoresed in a 6% polyacrylamide gel. For antibody supershifting experiments, 1 µl of antibody was added to the 20 µl binding reaction at the beginning of the preincubation.

RT-PCR
Total cellular RNA was prepared from samples of 107 thymocytes using the method of Chomczynski and Sacchi (27). Total RNA (1–5 µg) was transcribed with Superscript II RNase H reverse transcriptase (Gibco/BRL). PCR amplification (usually for 27 cycles) was done for 45 s at 94°C, 45 s at 52°C and 45 s at 72°C. PCR products were run on a 2% agarose gel and visualized by ethidium bromide staining. For quantification, [32P]dCTP was added in the PCR reaction mix. PCR products were run on a 2% agarose gel, then transfered to Hybond-N+ membrane and exposed to a phosphorimager screen. Fos, Jun and GAPDH product yields were determined by a phosphorimager. Although the amounts of product generated with different primer sets are not directly comparable (e.g. c-Fos units != FosB units), all the results for a given Fos or Jun family product in different cell types were adjusted to allow direct comparison, using the GAPDH signals for normalization to correct for differences in RNA content. The primers used in the PCR analysis are: cfos 1, 5'-GATGTTCTCGGGTTTCAACG-3', cfos 2, 5'-GTCTCCGCTTGGAGTGTATC-3'; fosB 1, 5'-TGCGCCGGTCTCGGGGAAATG-3', fosB 2, 5'-CCCTCTTCGTAGGGGATCTT-3'; fra-2 1, 5'-CGGGAACTTTGACACCTCGT-3', fra-2 2, 5'-TGCAGCTCAGCAATCTCTTT-3'; cjun 1, 5'-ACCTTCTACGACGATGCCCTC-3', cjun 2, 5'-GTGACACTGGGAAGCGTGTT-3'; junB 1, 5'-ATGGAACAGCCTTTCTATCAC-3', junB 2, 5'-GGGGGGCGTCACGTGGTTCAT-3'; junD 1, 5'-TGCTGGCTTCGCCGGATCTT-3', junD 2, 5'-TGCGTGTCCATGTCGATGGG-3'; Elk-1 1, 5'-AGACCGCCTCCAAATCCCTTA-3', Elk-1 2, 5'-CCTGAGAAGCCATTCCTTTGT-3'; Erp 1, 5'-AGGCCATCAAGACGGAGAAGCT-3', Erp 2, 5'-GCTCCAGAGAATCCGACTCATG-3'; SRF 1, 5'-CCACCCCCAGTGTAGAGATGAT-3', SRF 2, 5'-AGAGGGAACCCCTGAATGGATG-3'.

Protein analysis by Western blotting
Nuclear extracts were electrophoresed on 12% SDS–polyacrylamide gels and transferred to PVDF membranes (Millipore, Bedford, MA) by electroblotting. The filters were blocked with 5% non-fat milk in Tris-buffered saline (TBS) plus 0.05% Tween-20 (TBS-T), followed by primary antibody incubation for 2 h at room temperature. The membrane was washed in TBS-T (3x5 min), then incubated with horseradish peroxidase-conjugated secondary antibody for 1 h. After 3x15 min washing in TBS-T, the antibody detection reaction was performed using the ECL enhanced chemiluminescence system (Amersham, Piscataway, NJ). When necessary, the blot was stripped with stripping buffer (100 mM 2-mercaptoethanol, 2% SDS, 62.5 mM Tris–HCl, pH 6.7) at 50°C for 30 min and then blotted with a different antibody.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Three stages of thymocyte development with different expression of AP-1 binding activity
Previous studies from our group indicated that AP-1 DNA-binding activity is a target of intrathymic developmental change in the transition from immature to cortical-type cells, as well as in the later transition from cortical-type to mature-type cells (2). To examine the basis of this phenomenon, we made two modifications to improve detection of the affected events. First, the consensus AP-1 site found in the human collagenase gene was used for binding assays in place of the weak AP-1 site from the IL-2 gene. The use of the consensus AP-1 site not only made it possible to measure AP-1 binding activity with greater sensitivity, but also minimized cross-reactive binding by CREB (2,3). Second, to provide a better model for normal immature thymocytes, RAG2–/– thymocytes were used in place of the scid/scid thymocytes used previously. scid/scid thymocytes are spontaneously more activated and more readily responsive to stimulation than normal CD4CD8 TCR cells, and they include IL-1-expressing cells that partially obscure a key feature of immature thymocytes, i.e. that they have a strict requirement for IL-1 co-stimulation in IL-2 induction (28,29). RAG2–/– cells provide a developmentally arrested, immature cell population that resemble normal immature cells much more closely in both of these respects (26). For comparison with the immature cells, we prepared cortical and mature-type thymocytes from normal mice by two different methods, to control for any perturbation in cell physiology that might be caused by a particular method of fractionation. To obtain unperturbed populations of cortical cells completely devoid of mature cells, we also used thymocytes from MHC-deficient (class II0, ß2-microglobulin–/–) mice.

Typical flow cytometry profiles of the cell populations used in these studies are shown in Fig. 1Go(A and B). In unfractionated thymocytes, >80% cells are CD4+CD8+. Immature CD4CD8 and mature SP cells are only 3 and 13% respectively. After fractionation, the purity for mature SP cells is >85% and for cortical DP cells is ~90%. Immature DN cells from RAG2–/– mice are >95% pure and cortical thymocytes from MHC-deficient mice are completely free of any cells that could have undergone positive selection. To measure AP-1 binding activity, nuclear extracts for gel mobility shift assays were isolated from thymocyte subpopulations after 3 h of culture with or without stimulation. As shown in Fig. 1Go(C), AP-1 binding activity could be induced in both immature DN cells and in mature SP cells, but not in cortical DP cells. In general, AP-1 binding activity is low or undetectable in unstimulated cells and induced only in response to stimulation. The results confirm that AP-1 binding activity is subject to developmental inhibition at the DN -> DP transition and developmental restoration at the DP -> SP transition.




View larger version (85K):
[in this window]
[in a new window]
 
Fig. 1. Different populations of thymocytes and their AP-1 DNA-binding activities. (A) Cytograms of different thymocyte populations used in these studies, stained for expression of CD4 and CD8. The percentages of DN cells (CD4CD8), DP cells (CD4+CD8+) and SP cells (CD4+CD8 and CD4CD8+) in the following populations are shown in the corresponding quadrants above each of the cytograms. Thymocytes used in this study are: unfractionated thymocytes from C57BL/6 mice (UT); thymocytes from RAG2–/– mice (RAG2–/–); PNA+ fraction of C57BL/6 thymocytes (PNA+); thymocytes from cortisone-treated C57BL/6 mice (CRT); HSA+ fraction of C57BL/6 mice (HSA+); and HSA fraction of C57BL/6 thymocytes (HSA). (B) Comparison of thymocytes from normal C57BL/6 mice with thymocytes from MHC–/– mice, as in (A). The 3.3% of cells falling into the CD8+CD4 quadrant are immature intermediates between DN and DP cells, not mature CD8+ cells. (C) AP-1 binding activity in unstimulated (U) and stimulated (S) RAG2–/– (DN), MHC–/– (DP) and cortisone-resistant (SP) thymocytes. Stimulation was for 3 h with TPA + A23187 and IL-1 was added for the stimulation of the DN cells. Sp-1 binding activities in the same samples were also determined to monitor sample loading variation.

 
The decreased AP-1 binding activity is associated with the selectively decreased inducibility of c-fos and fosB transcription in cortical thymocytes
To determine whether changes in specific subunit expression could explain the lack of AP-1 binding activity in cortical thymocytes, the mRNA levels of different AP-1 components in stimulated cells were determined by RT-PCR. Each population of cells was stimulated with TPA plus A23187 for 30 min to 1 h. Because immature cells need IL-1 for IL-2 expression (3032), IL-1 (50 U/ml) was also routinely added to the TPA and A23187 treatment for DN cells (no effect of IL-1 was found in any other cell population, data not shown). Total cellular RNAs were extracted from stimulated and unstimulated thymocytes, and the jun and fos family RNA levels in each sample were compared as shown in Figs 2 and 3GoGo. The mRNA levels of GAPDH in each sample were also determined and used as a recovery control. The results from these broad RT-PCR analyses were confirmed by more limited comparisons using Northern blotting and RNase protection assays in multiple independent experiments (data not shown and 33).



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 2. Fos family mRNA induction in fractionated thymocytes. (A) RAG2–/– thymocytes (DN), MHC–/– thymocytes (DP) and cortisone-resistant thymocytes (SP) were cultured without stimulation (U, unstimulated), stimulated for 30 min (30') or stimulated for 60 min (60'). Total cellular RNA was used for RT-PCR analysis to determine the Fos mRNA levels in each sample. GAPDH mRNA levels in each sample were also determined and used to normalize sample variation. (B) Summary of studies of Fos mRNA inducibility in different thymocyte preparations. Averages and SD are shown for three experiments in which total thymocytes were fractionated using different methods as described in Methods. Lanes 1–3: RAG2–/– DN thymocytes; lanes 4–6: PNA+ DP thymocytes; and lanes 7–9: cortisone-resistant (n = 2) and HSA (n = 1) SP thymocytes. Lanes 1, 4 and 7 were unstimulated, lanes 2, 5 and 8 were stimulated for 30 min, and lanes 3, 6 and 9 were stimulated for 60 min. Fos family mRNA levels and control GAPDH levels were determined by RT-PCR with [32P]CTP in the reaction mix. PCR products were run on a 2% agarose gel, transferred to a Hybond-N+ membrane, and the levels of Fos family and GAPDH product in each sample were determined by a phosphorimager. The vertical axis shows the levels of each Fos family gene product normalized by the GAPDH signal from the same sample, with error bars to indicate the SD. Comparison of the 30 min-induced samples (lanes 2, 5 and 8) by a one-tailed t-test shows that the DP thymocytes express significantly less c-fos RNA than the SP (P <0.01) and significantly less fosB RNA than the SP or DN cells (P < 0.025 for each).

 



View larger version (66K):
[in this window]
[in a new window]
 
Fig. 3. Summary of Jun family mRNA levels inducible in fractionated thymocytes. Jun family mRNA levels in immature thymocytes, cortical thymocytes and mature thymocytes were assayed by RT-PCR with [32P]dCTP in the reaction mix. The sample variations were normalized by GAPDH mRNA level. Averages and SD are shown for results using the same panel of samples as shown in Fig. 2Go(B). junD was expressed in all samples at a lower level than c-jun and was quantitated by RNase protection (data not shown) as indicated in the text.

 
Figure 2Go shows that c-fos mRNA is highly inducible in mature SP cells upon stimulation. It also can be induced, although at a much lower level, in immature RAG2–/–, but not in DP (MHC-deficient) cortical cells. Similar results were obtained using HSA+ and PNA+ normal cells as enriched sources of cortical thymocytes, and with HSA cells as the source of mature SP cells (Fig. 2BGo). fosB mRNA is similarly regulated in these three cell populations. As with c-fos mRNA, fosB mRNA is significantly induced in the mature SP cells and somewhat less in RAG2–/– cells, but not significantly at all in cortical cells (Fig. 2Go). Although both c-fos mRNA and fosB mRNA are inducible in immature DN cells, c-fos mRNA reaches only ~30% of the level in mature SP cells and fosB mRNA reaches only ~70%. This agrees with the lower level of AP-1 DNA binding activity in nuclear extracts of immature cells as compared to mature cells (Fig. 1BGo).

Although IL-1 was routinely used to stimulate the RAG2–/– immature cells in this study, it was not essential. IL-1 has no effect on the inducibility of c-fos and fosB mRNA in cortical DP cells or mature SP cells (data not shown). Also, in some cases, RAG2–/– cells were stimulated with TPA + A23187 alone and IL-1 could not further increase the level of induction in those cells.

Expression of other Fos family RNAs, fra-1 and fra-2, was similarly analyzed by this method. fra-1 mRNA was not detected in any of the thymocyte subpopulations at any time point even up to 6 h of stimulation (data not shown). fra-2 mRNA, however, was detectable at similar levels in stimulated and unstimulated RAG2–/– and cortisone-resistant cells, yet not in purified cortical cells even after stimulation (Fig. 2Go). The expression of fra-2, at different levels in different thymocyte populations but apparently unresponsive to stimulation, defines a pattern that is unique among the AP-1 components studied here.

The induction of the Jun family mRNAs showed a very different developmental pattern. Unlike the Fos genes, the Jun family genes could be induced in all three stages of cells. Figure 3Go shows that c-jun and junB RNA are as inducible in cortical thymocytes as in immature DN thymocytes and in mature SP cells. These results were confirmed and similar results were obtained for junD, using RNase protection analysis (data not shown and 33). Thus distinct activation pathways are required for Jun family and Fos family mRNA induction, and it is expression of c-fos and fosB mRNA, not the Jun family mRNAs, that is correlated with AP-1 DNA-binding activity in T cell development.

The induction of Fos family proteins is also decreased in cortical cells
To determine whether the inhibition of c-fos and fosB mRNA accumulation in cortical cells is correlated with a decrease in Fos protein expression, the induction of Fos family proteins in nuclear extracts of thymocytes was monitored by Western blot analysis (Fig. 4Go). Nuclear extracts of RAG2–/– immature (DN), PNA+ cortical (DP) and cortisone-resistant mature (SP) thymocytes were examined after 3 h of stimulation with TPA + A23187. IL-1 was also routinely added to the RAG2–/– cell stimulation as before. Fos family proteins were detected with an antiserum that has broad reactivity to all Fos family proteins (K25). After stripping the blot, levels of the constitutive transcription factor Sp1 (see Fig. 1CGo) were determined as a control to normalize the loading variation (Fig. 4AGo). In agreement with the RNA expression data (Fig. 2Go) and in parallel with the DNA-binding activity (Fig. 1BGo), the appearance of Fos family proteins was stimulation dependent, and detected only in the immature and mature cells (Fig. 4AGo). The induction was significantly decreased in the cortical cells.





View larger version (140K):
[in this window]
[in a new window]
 
Fig. 4. (A) Fos family protein levels in RAG2–/– (DN), PNA+ (DP), cortisone-resistant (SP) and unfractionated (UT) thymocytes. Cells were either unstimulated (U) or stimulated with TPA + A23187 (S) for 3 h, except that for DN cells, IL-1 was also added to the stimulation (I). Nuclear extracts from the different populations of thymocytes were prepared and Fos family protein levels in each sample were compared by Western blotting using anti-Fos family protein antibody (cFos K25). The same blot was then stripped and reprobed with anti-Sp-1 antibody to monitor loading variation. The positions of the major Fos family and Sp-1 protein bands are indicated. (B) Fra-2 protein levels in RAG2–/– (DN), MHC–/– (DP) and cortisone-resistant (SP) thymocytes. Cells were either unstimulated (U) or stimulated with TPA + A23187 (S), except that for DN cells, IL-1 was also added to the stimulation. Fra-2 levels in each sample were determined by Western analysis using anti-Fra-2 antibody (Fra-2 PEP2). The same blot was also stripped and reprobed with anti-Sp-1 antibody. (C) Jun protein levels in RAG2–/– (DN), MHC–/– (DP) and cortisone-resistant (SP) thymocytes. The blot used to determine Fra-2 protein level was also stripped and reprobed with anti-Jun family protein antibody (cJun/AP-1D) and anti-JunB antibody (JunB N17) to compare the expression of Jun family proteins and JunB protein in three thymocyte populations.

 
The overall pattern of Fra-2 expression clearly diverges from that of Fos family proteins overall. Representative data using the antibody anti-Fra-2(PEP-2) are shown in Fig. 4Go(B) with Sp1 analysis to normalize sample loading. This antibody generally detects Fra-2 as a pair of bands of varying intensity at ~53–57 kDa, both of which could be competed by the specific immunizing peptide (data not shown). As for fra-2 RNA, the steady-state availability of these Fra-2 proteins is higher in the DN and SP populations, and lower in the cortical DP population. Fra-2 protein levels in mature and immature thymocytes, relative to Sp1 protein levels, are comparable to those in activated EL4 tissue culture cells (data not shown). Also in agreement with the RNA data, Fra-2 protein levels are as high in unstimulated cells as in cells activated for 3 h. This shows that Fra-2 is unlikely to be a major component of the pattern detected by Fos family antibody K-25 (cf. Fig. 4A and BGo).

By contrast, the pattern of expression of proteins detected by a c-Fos-specific antibody [designated anti-c-Fos(4)] generally followed the pattern shown in Fig. 4Go(A) (data not shown). While the quality of the c-Fos and FosB antibodies did not support more detailed analysis, these data, taken together with the Fra-2 data, indicate that the restrictions on c-fos and fosB mRNA induction severely limit the Fos family proteins available in cortical thymocytes.

Cortical thymocytes are not devoid of all AP-1 component proteins, however, because Western blotting of nuclear extracts clearly revealed comparable expression of JunB and Jun family proteins generally in all thymocyte subsets (Fig. 4CGo). The relative amounts of different immunoreactive species showed some variation among cell populations, suggestive of differential phosphorylation (cf. JunB results in Fig. 4CGo). However, this has not yet been confirmed. While it is possible that post-translational modification of Jun family components is altered in different thymocyte subsets, these results show that cortical thymocytes do express Jun family factors at the protein level.

c-Fos and FosB are major components of the AP-1 complexes present after stimulation in DN and SP cells
To test whether the decreased expression of c-Fos and FosB could contribute to the loss of AP-1 binding activity, gel mobility supershift assays using antibodies specific for c-Fos and FosB as well as the Fos family-reactive antibody were used to determine to what extent these proteins actually participate in thymocyte AP-1 DNA-binding complexes. The composition of the AP-1 complexes in nuclear extracts from mature cells, stimulated with TPA + A23187, compared with those from RAG2–/– cells, stimulated with the addition of IL-1. As shown in Fig. 5Go(A and B, lane 2), virtually all the AP-1 complexes formed include some Fos family member, since anti-Fos family antibody supershifts the entire AP-1 band in both cell types. A supershifted band was also detected in both cell samples using c-Fos-specific antibody, indicating that c-Fos participates in the complexes in mature and immature cells alike (Fig. 5A and BGo, lanes 3). However, in each case some AP-1 complexes appeared to remain unshifted, raising the possibility that some other Fos family protein might be present in a fraction of the complexes instead of c-Fos. FosB was present in at least some of the mature cell complexes, as indicated by the fact that anti-FosB diminished the intensity of the AP-1 band in mature cells (Fig. 5BGo, lane 4). Although an effect of the weak FosB antibody alone could not be detected in the RAG2–/– samples (data not shown), in both cell samples the mixture of FosB and c-Fos-specific antibodies further diminished the intensity of the AP-1 band, and increased the intensity of the supershifted band, more than antibodies to c-Fos alone (Fig. 5AGo, lane 4 and B, lane 6). These effects were specific, as they were reversed by the addition of the corresponding specific peptides. Furthermore, they were not mimicked by the addition of antibody against Fra-2 (lane 5 in Fig. 5BGo, and data not shown), which showed no inhibition or supershifting of any AP-1 site-binding complexes in these thymocytes. Thus, c-Fos and FosB are preferentially used in the AP-1 complexes induced in both immature and mature cells.



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 5. Presence of c-Fos and FosB in AP-1 binding proteins from stimulated thymocytes, analyzed by antibody inhibition and supershifting of electrophoretic mobility shift complexes. (A) Reactivity of AP-1 site binding factors in RAG2–/– thymocytes with different antibodies. Lane 1, no antibody; lane 2, anti-Fos family antibody; lane 3, anti-c-Fos-specific antibody; lane 4, anti-c-Fos plus anti-FosB-specific antibodies; lane 5, anti-c-Fos plus anti-Fra2-specific antibodies. (B) Reactivity of AP-1 site binding factors in cortisone-resistant mature thymocytes with different antibodies. Lane 1, no antibody; lane 2, anti-Fos family antibody; lane 3, anti-c-Fos-specific antibody; lane 4, anti-FosB-specific antibody; lane 5, anti-Fra-2-specific antibody; and lane 6, anti-c-Fos plus anti-FosB-specific antibodies. The positions of the unbound and antibody-supershifted complexes in each panel are indicated by arrows.

 
Regulation of c-Fos and FosB in cortical thymocytes: upstream transcription factors and response to low-dose activation signals
To explore the basis for the lack of c-Fos and FosB inducibility in cortical thymocytes, we took advantage of the conserved promoter structures of the two genes and the extensive work done by others to elucidate c-fos regulation. Both promoters contain sites for the positively acting transcription factors CREB, SRF, and the ternary complex factors of the Ets family, Elk-1 and Sap-1 (13,17,34,35). An alternative ternary complex factor, ERP (NET/Sap-2), has also been implicated as a positive or negative regulator of Fos expression (3638). While CREB, Elk-1, Sap-1 and ERP can all be regulated by post-translational phosphorylation, it was possible that the profound activation defect in cortical thymocytes might be caused by the complete loss of expression of one of the positive factors or by constitutive overexpression of a negative factor. CREB is definitely present in cortical thymocytes, since it is clearly detected binding to the IL-2 AP-1p site as previously described (2). Therefore, we sought evidence for the expression of SRF, Elk-1 and ERP (murine Sap-1 sequences were not available), using RT-PCR for analysis of RNAs from immature, cortical and mature thymocytes. As shown in Fig. 6Go, mRNAs encoding all three of these factors are clearly expressed at similar levels in all three stages of thymocyte development. Thus if these factors are collectively incapable of turning on c-fos and fosB expression, the block to their activity is likely to be post-transcriptional.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 6. Elk-1, ERP and SRF mRNA levels in fractionated thymocytes. Rag2–/– (DN), MHC–/– (DP) and cortisone-resistant (SP) thymocytes were cultured without stimulation (U) or with stimulation for 30 min (30') and for 60 min (60'). Total cellular RNA was used for RT-PCR analysis with the indicated primers. PCR amplification was done for 45 s at 94°C, 45 s at 55°C and 45 s at 72°C. Amplifications of 35 cycles were used to measure ERP and amplifications of 40 cycles were used to measure Elk-1 or SRF.

 
One mechanism that could explain the failure of these transcription factors to turn on the c-fos and fosB genes would be alteration in the behavior of the kinases needed to activate these factors (12,17), e.g. a shift in the dose-response to Ras-activating signals. This possibility required a re-evaluation of the stimulation conditions used to assay AP-1 induction. Cortical thymocytes can generally respond to lower doses of TCR ligands than mature T cells with the same TCR (39) and may need to do this in positive selection (4042). Indeed, TPA/ionomycin stimulation of cortical thymocytes has been reported to elicit a form of in vitro positive selection instead of cell death, if the concentration of phorbol ester is greatly reduced below the concentration that is optimally mitogenic for mature cells (23,24,43). Therefore, we tested whether stimulation under conditions of low phorbol ester concentration might unmask some ability of cortical thymocytes to turn on c-fos or fosB.

Figure 7Go shows, however, that the difference between cortical and mature thymocytes remains, even when stimulation conditions are used that can induce in vitro positive selection. Thymocytes from MHC–/– mice (cortical cells with no possibility of having experienced selection signals) and cortisone-resistant normal thymocytes (mature cells) were activated with ionomycin (200 ng/ml) and different doses of TPA, from 10 to 0.2 ng/ml. In the case induction kinetics were slower under low-TPA conditions, Fos family RNAs were monitored at both 30 min and 2 h of stimulation. As shown in Fig. 7Go(lane 3, SP), results with the CRT sample confirmed that 0.2 ng/ml TPA is suboptimal for c-fos RNA induction in mature thymocytes. c-fos is shut off in these cells by 2 h under all conditions tested (data not shown). None of these conditions, however, revealed any cryptic ability of DP thymocytes to express a comparable level of c-fos RNA (Fig. 7Go, lanes 3–5, DP). The results for fosB expression were similar to c-fos in each case but with lower levels seen in the mature cells (Fig. 7Go). Again DP thymocytes showed little or no detectable fosB induction.



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 7. Phorbol ester dose-responses for Fos family gene induction in cortical and mature thymocytes. MHC–/– (DP) and cortisone-resistant (SP) thymocytes were cultured without stimulation or with stimulation for 30 min with ionomycin (200 ng/ml) and different doses of TPA. Levels of c-fos, fosB and c-jun mRNAs were determined by RT-PCR. The GAPDH mRNA level was used to normalize sample variation. For each group: lane 1, unstimulated cells without culture; lane 2, unstimulated cells cultured for 30 min; lane 3, stimulated with 0.2 ng/ml TPA; lane 4, stimulated with 1 ng/ml TPA; lane 5, stimulated with 10 ng/ml TPA.

 
These results show that DP thymocytes are not simply shifted in their stimulation dose-response optima for Fos induction. If the cells regain the ability to express these RNAs during positive selection, it is not because positive selection signals themselves induce c-fos and fosB expression, but because they induce a change in the cells' physiological state that restores Fos family gene inducibility.


    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
In this study, we have shown that the availability of AP-1 is regulated in thymocyte development by changes in the ability of cells to express c-fos and fosB mRNA in response to stimulation. RNA transcription from Jun family genes is also sensitive to induction, but is not a target of such severe developmental regulation. This result points directly to specific components of the c-fos and fosB regulatory apparatus as targets of developmental modification, first at the transition from DN -> DP and then at the transition from DP -> SP, i.e. at positive selection. Cells that can initially be induced to express c-fos and fosB are transformed into cells that cannot, and then back again into cells that can.

Is the lack of c-Fos and FosB expression really sufficient to explain the loss of AP-1 DNA binding activity in the cortical thymocytes? None of the data presented here rule out the operation of additional mechanisms, such as alterations in the phosphorylation of a C-terminal site of the Jun family proteins that affects DNA binding (4446). However, there is strong reason to believe that differences in Fos expression of the magnitude shown here could be sufficient to account for the differences in AP-1 DNA binding activity. Fos–Jun heterodimers as a rule have substantially higher affinity for their sites than do Jun–Jun heterodimers (14,15), and both transgenic and transfection studies provide evidence that in T cells normally the levels of Fos expression are not saturating (47,48). Fos–Jun complexes can also exhibit qualitatively different regulatory activities than complexes of Jun with itself or other bZIP proteins (49). Although c-Fos per se is not essential for T cell development or activation (19), this is apparently due to the ability of FosB and Fra-2 to participate in AP-1 complexes in its place. In the thymocytes studied here, the majority of AP-1 complexes formed contained either c-Fos or FosB, with little if any contribution from Fra-2. Hence, a combined inhibition of c-Fos and FosB expression should have a substantial impact on the DNA-binding affinity of the residual AP-1 complexes.

Our data showing that cortical cells cannot express Fos and mobilize AP-1 activity appear to conflict with aspects of three reports which have appeared since our initial work (2). In each case, though, the conflict may be more a matter of emphasis than a matter of fact. First, Sen et al. (50) found that freshly isolated cortical cells indeed contain protein complexes that bind to the AP-1 site DNA sequence, but that these are lost upon incubation in culture. These complexes, however, are not typical of AP-1 in electrophoretic mobility and their subunit composition remains uncertain. Our own results certainly would support the possibility that Jun- and/or CREB/ATF-containing complexes are present in those cells, though according to Rincon and Flavell (3), such complexes could not be sufficient to provide AP-1 transcriptional activity. Second, Ivanov and Nikolic-Zugic have shown that some apoptosis-inducing stimuli can induce c-Fos expression and AP-1 DNA binding activity in enriched populations of cortical thymocytes (11). In their studies, however, there was no comparison with the inducibility of Fos in other subsets, which in our hands show a much greater response, and the absolute magnitude of the induction they detected was quite low. In fact, their conclusion that c-fos induction is part of a protective response is in excellent agreement with our own finding of higher inducibility in immature cells and CRT. Finally, Simon et al. (51) have shown that the relative inducibility of AP-1 and NF-{kappa}B in cortical thymocytes differs markedly depending on the stimulus used, with NF-{kappa}B predominating in response to TPA + Ca2+ ionophore but with AP-1 predominating in response to TCR ligands. This provocative result suggests several possible mechanisms, but it is important to note that the two kinds of response are not seen over the same time course. The response to TCR ligands is slow (8–12 h) and induces an apoptotic pathway (as in 11). Because of the long time course, it is quite possible that these ligands are activating a differentiation process in surviving cells before they mobilize AP-1 complexes. This interpretation would agree with evidence suggesting that by the time DP thymocytes are signaled to become CD69+, probably over a 1 day period, they already regain some AP-1 inducibility (3). Alternatively, commitment to undergo apoptosis might over-ride the block to Fos induction (12).

An interesting question remains as to the role of Fra-2 expression, which appears to undergo developmental inflection without responding to Ca2+/protein kinase C signals and without perceptibly contributing to most of the AP-1 DNA-binding complexes. Attempts to detect a distinctive intrathymic location for Fra-2-expressing cells by immunohistochemistry have remained inconclusive thus far (I. Nangiana et al., unpublished results). Therefore some question remains as to the identity of these cells. In many cases, however, the transcriptional activation properties of Jun–Fra complexes are reported to be distinct from, or antagonistic to, those of Jun–Fos complexes (13,52,53). It is conceivable therefore that the baseline Fra-2 expression is involved in establishing an activation threshold.

Our results indicate that passage through ß-selection and positive selection have a direct impact on the mediators controlling fos gene expression. All the affected components are likely to be within the set of transcription factors and modifying enzymes that have been implicated in c-fos activation (13,17,35,54). These include CREB, Ets family ternary complex factors and SRF. However, we have already demonstrated that cortical thymocytes are richly supplied with CREB (2) and the cAMP accumulation which should activate it is, if anything, unusually strong in cortical thymocytes (20). We considered SRF and the ternary complex factors Elk-1 and ERP as potential rate-limiting factors, but similar expression of RNAs encoding these factors was found in all thymocyte subsets. This raises the possibility that control could be exerted at the level of the MAP kinases which have been shown to play a key role in enhancing the transcriptional activity of the ternary complex factors, through phosphorylation of several known C-terminal sites (12,17). Dephosphorylation of these sites is implicated in the down-regulation of c-fos after its induction, for the protein phosphatase inhibitor okadaic acid sustains both the expression of c-fos and the ternary complex factor phosphorylation (55). Ternary complex factor may be dephosphorylated by constitutively expressed phosphatases such as protein phosphatase 2A or by an inducible phosphatase. This would imply that a net phosphorylation of ternary complex factor is only feasible when MAP kinases are more active than those phosphatases. In other words, the induction of c-fos could be regulated by both MAP kinases and protein phosphatases. While at least some MAP kinase activity is present in thymocytes and essential for positive selection (5658), the phosphatases are less studied and much remains to be learned about these pathways in thymocyte subsets.

In a variety of cell types in vivo and in vitro, AP-1 plays an important role controlling cell growth and differentiation. An inability to express AP-1 components, for example, underlies the functional paralysis of anergized mature T cells (8). One of the results of developmental restrictions on AP-1 inducibility in thymocytes may be to control their capacity to proliferate or survive stress. Although c-fos–/– bone marrow cells appear to develop normally into T and B cells when transplanted into irradiated normal recipients (59), there is evidence that c-fos–/– thymocytes are more sensitive to apoptotic stimuli than wild-type (11). This may account for the severe effects on thymus cellularity seen in some but not all colonies of c-Fos-deficient mice (59,60). We have also obtained recent evidence (F. Chen et al., in preparation) that other Fos family components play a role in thymocyte population expansion at a distinct, early stage. Fos family components may also participate in the bidirectional communication between developing lymphocytes and their environment. Overexpression of c-Fos in the stroma of lymphoid organs (61) causes severe inhibition of thymocyte development, with an abnormal proliferation of the thymic epithelium. Notably, this phenotype is very similar to that caused by the complete blockade of Fos family transactivation in the lymphoid cells themselves, by the overexpression of a transgene encoding the natural dominant negative FosB2 gene product (62). This suggests that Fos is involved in the production of some factors which are important for the bidirectional molecular communication between stromal epithelial cells and developing thymocytes. In this context, the low level of Fos expression in DP cortical thymocytes may help to ensure that these factors are turned on only in the right developmental stages.

In summary, we have found that thymocytes gain and lose Fos family gene inducibility at two critical checkpoints for their fate determination. These differences may be due to alterations in the activities of post-translational modifying enzymes that regulate the transcription factors driving Fos expression or due to translational regulation of the factors themselves at these points. In either case, the reduction in capacity to express c-Fos and FosB is a robust characteristic of cortical thymocytes, implying that this alteration is stable. The reversal of this alteration, which appears to occur within the first day of response to positive selection signals, identifies the factors and modifying enzymes that control expression of Fos family proteins as primary targets of the positive selection process.


    Acknowledgments
 
We are very grateful to Drs Donna Cohen (Australia National University), Ellen Robey (University of California, Berkeley), Yoichi Shinkai and Fred Alt (Columbia University and Harvard Medical School), and Axel Schönthal (University of Southern California), who generously donated cDNAs and mutant mice for these studies. We also thank Rochelle Diamond, for continuing advice and assistance with cell fractionation, and Inderjit Nangiana, for supporting immunohistochemical studies. Finally, we also thank Dana Miller and Ray Hotz, for excellent care of the mutant mice, and Patrick Koen and Rochelle Diamond, for excellent flow cytometry. These studies were supported by a grant from the USPHS, AI34041. The Caltech Flow Cytometry Facility and the Caltech Biopolymer Synthesis Facility were supported in part by funds from the Beckman Institute at Caltech.


    Abbreviations
 
TPA12-O-tetradecanoyl phorbol 13-acetate
DNdouble negative
DPdouble positive
HSAheat-stable antigen
PNApeanut agglutinin
SPsingle positive

    Notes
 
1 Present address: SyStemix, Inc., 3155 Porter Drive, Palo Alto, CA 94304, USA Back

Transmitting editor: A. Singer

Received 7 December 1998, accepted 19 January 1999.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Rothenberg, E. V., Diamond, R. A. and Chen, D. 1994. Programming for recognition and programming for response: separate developmental subroutines in the murine thymus. Thymus 22:215.[Web of Science][Medline]
  2. Chen, D. and Rothenberg, E. V. 1993. Molecular basis for developmental changes in interleukin-2 gene inducibility. Mol. Cell. Biol. 13:228.[Abstract/Free Full Text]
  3. Rincon, M. and Flavell, R. A. 1996. Regulation of AP-1 and NFAT transcription factors during thymic selection of T cells. Mol. Cell. Biol. 16:1074.[Abstract]
  4. Jain, J., Valge-Archer, V. E. and Rao, A. 1992. Analysis of the AP-1 sites in the IL-2 promoter. J. Immunol. 148:1240.[Abstract]
  5. Masuda, E. S., Tokumitsu, H., Tsuboi, A., Shlomai, J., Hung, P., Arai, K.-I. and Arai, N. 1993. The granulocyte-macrophage colony-stimulating factor promoter cis-acting element CLE0 mediates induction signals in T cells and is recognized by factors related to AP1 and NFAT. Mol. Cell. Biol. 13:7399.[Abstract/Free Full Text]
  6. Cippitelli, M., Sica, A., Viggiano, V., Ye, J. P., Ghosh, P., Birrer, M. J. and Young, H. A. 1995. Negative transcriptional regulation of the interferon-gamma promoter by glucocorticoids and dominant-negative mutants of c-Jun. J. Biol. Chem. 270:12548.[Abstract/Free Full Text]
  7. Rooney, J. W., Sun, Y.-L., Glimcher, L. H. and Hoey, T. 1995. Novel NFAT sites that mediate activation of the interleukin-2 promoter in response to T cell receptor stimulation. Mol. Cell. Biol. 15:6299.[Abstract]
  8. Mondino, A., Whaley, C. D., DeSilva, D. R., Li, W., Jenkins, M. K. and Mueller, D. L. 1996. Defective transcription of the IL-2 gene is associated with impaired expression of c-Fos, FosB, and JunB in anergic T helper 1 cells. J. Immunol. 157:2048.[Abstract]
  9. Chen, J., Stewart, V., Spyrou, G., Hilberg, F., Wagner, E. F. and Alt, F. W. 1994. Generation of normal T and B lymphocytes by c-jun deficient embryonic stem cells. Immunity 1:65.[Web of Science][Medline]
  10. Barton, K., Muthusamy, N., Chanyangam, M., Fischer, C., Clendenin, C. and Leiden, J. M. 1996. Defective thymocyte proliferation and IL-2 production in transgenic mice expressing a dominant-negative form of CREB. Nature 379:81.[Medline]
  11. Ivanov, V. N. and Nikolic-Zugic, J. 1997. Transcription factor activation during signal-induced apoptosis in immature CD4+CD8+ thymocytes. A protective role of c-Fos. J. Biol. Chem. 272:8558.[Abstract/Free Full Text]
  12. Karin, M., Liu, Z.-G. and Zandi, E. 1997. AP-1 function and regulation. Curr. Opin. Cell. Biol. 9:240.[Web of Science][Medline]
  13. Foletta, V. C. 1996. Transcription factor AP-1, and the role of Fra-2. Immunol. Cell Biol. 74:121.[Medline]
  14. Halazonetis, T. D., Georgopoulos, K., Greenberg, M. E. and Leder, P. 1988. c-Jun dimerizes with itself and with c-Fos, forming complexes of different DNA-binding affinities. Cell 55:917.[Web of Science][Medline]
  15. Ryseck, R. and Bravo, R. 1991. c-JUN, JUN B, and JUN D differ in their binding affinities to AP-1 and CRE consensus sequences: effect of FOS proteins. Oncogene 6:533.[Web of Science][Medline]
  16. Kim, J. and Struhl, K. 1995. Determinants of half-site spacing preferences that distinguish AP-1 and ATF/CREB bZIP domains. Nucleic Acids Res. 23:2531.[Abstract/Free Full Text]
  17. Davis, R. J. 1995. Transcriptional regulation by MAP kinases. Mol. Rep. Dev. 42:459.[Web of Science][Medline]
  18. Hunter, T. and Karin, M. 1992. The regulation of transcription by phosphorylation. Cell 70:375.[Web of Science][Medline]
  19. Jain, J., Nalefski, E. A., McCaffrey, G., Johnson, R. S., Spiegelman, B. M., Papaioannou, V. and Rao, A. 1994. Normal peripheral T cell function in c-Fos-deficient mice. Mol. Cell. Biol. 14:1566.[Abstract/Free Full Text]
  20. Scherer, L. J., Diamond, R. A. and Rothenberg, E. V. 1995. Developmental regulation of cAMP signaling pathways in thymocyte development. Thymus 23:231.
  21. Novak, T. J., Yoshimura, F. K. and Rothenberg, E. V. 1992. In vitro transfection of fresh thymocytes and T cells shows subset-specific expression of viral promoters. Mol. Cell. Biol. 12:1515.[Abstract/Free Full Text]
  22. Wang, H., Diamond, R. A., Yang-Snyder, J. A. and Rothenberg, E. V. 1998. Precocious expression of T cell functional response genes in vivo in primitive thymocytes before T-lineage commitment. Int. Immunol. 10:1623.[Abstract/Free Full Text]
  23. Ohoka, Y., Kuwata, T., Tozawa, Y., Zhao, Y., Mukai, M., Motegi, Y., Suzuki, R., Yokoyama, M. and Iwata, M. 1996. In vitro differentiation and commitment of CD4+ CD8+ thymocytes to the CD4 lineage without TCR engagement. Int. Immunol. 8:297.[Abstract/Free Full Text]
  24. Iwata, M., Kuwata, T., Mukai, M., Tozawa, Y. and Yokoyama, M. 1996. Differential induction of helper and killer T cells from isolated CD4+ CD8+ thymocytes in suspension culture. Eur. J. Immunol. 26:2081.[Web of Science][Medline]
  25. Wang, H., Diamond, R. A. and Rothenberg, E. V. 1998. Cross-lineage expression of Ig-ß (B29) in thymocytes: positive and negative gene regulation to establish T cell identity. Proc. Natl Acad. Sci. USA 95:6831.[Abstract/Free Full Text]
  26. Diamond, R. A., Ward, S. B., Owada-Makabe, K., Wang, H. and Rothenberg, E. V. 1997. Different developmental arrest points in RAG2–/– and scid thymocytes on two genetic backgrounds: developmental choices and cell death mechanisms before TCR gene rearrangement. J. Immunol. 158:4052.[Abstract]
  27. Chomczynski, P. and Sacchi, N. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal. Biochem. 162:156.[Web of Science][Medline]
  28. Rothenberg, E. V., Chen, D. and Diamond, R. A. 1993. Functional and phenotypic analysis of thymocytes in SCID mice: evidence for functional response transitions before and after the SCID arrest point. J. Immunol. 151:3530.[Abstract]
  29. Rothenberg, E. V. and Diamond, R. A. 1994. Costimulation by interleukin-1 of multiple activation responses in a developmentally restricted subset of immature thymocytes. Eur. J. Immunol. 24:24.[Web of Science][Medline]
  30. Howe, R. C. and MacDonald, H. R. 1988. Heterogeneity of immature (Lyt-2/L3T4) thymocytes—identification of 4 major phenotypically distinct subsets differing in cell-cycle status and in vitro activation requirements. J. Immunol. 140:1047.[Abstract]
  31. Rothenberg, E. V., Diamond, R. A., Pepper, K. A. and Yang, J. A. 1990. Interleukin-2 gene inducibility in T cells prior to T cell receptor expression: changes in signaling pathways and gene expression requirements during intrathymic maturation. J. Immunol. 144:1614.[Abstract]
  32. Fischer, M., MacNeil, I., Suda, T., Cupp, J. E., Shortman, K. and Zlotnik, A. 1991. Cytokine production by mature and immature thymocytes. J. Immunol. 146:3452.[Abstract]
  33. Chen, D. 1994. Molecular mechanisms of interleukin-2 gene inducibility: developmental control and combinatorial action of transcription factors. PhD thesis, California Institute of Technology.
  34. Lazo, P. S., Dorfman, K., Noguchi, T., Mattei, M. G. and Bravo, R. 1992. Structure and mapping of the FosB gene—FosB down-regulates the activity of the FosB promoter. Nucleic Acids Res. 20:343.[Abstract/Free Full Text]
  35. Janknecht, R. 1995. Regulation of the c-fos promoter. Immunobiology 193:137.[Web of Science][Medline]
  36. Price, M. A., Rogers, A. E. and Treisman, R. 1995. Comparative analysis of the ternary complex factors Elk-1, SAP-1a and SAP-2 (ERP/NET). EMBO J. 14:2589.[Web of Science][Medline]
  37. Maira, S. M., Wurtz, J. M. and Wasylyk, B. 1996. Net (ERP/SAP2), one of the Ras-inducible TCFs, has a novel inhibitory domain with resemblance to the helix-loop-helix motif. EMBO J. 15:5849.[Web of Science][Medline]
  38. Giovane, A., Pintzas, A., Maira, S. M., Sobieszcuk, P. and Wasylyk, B. 1994. Net, a new ets transcription factor that is activated by Ras. Genes Dev. 8:1502.[Abstract/Free Full Text]
  39. Vasquez, N. J., Kane, L. P. and Hedrick, S. M. 1994. Intracellular signals that mediate thymic negative selection. Immunity 1:45.[Web of Science][Medline]
  40. Ashton-Rickardt, P. G., Bandeira, A., Delaney, J. R., Van Kaer, L., Pircher, H.-P., Zinkernagel, R. M. and Tonegawa, S. 1994. Evidence for a differential avidity model of T cell selection in the thymus. Cell 76:651.[Web of Science][Medline]
  41. Sebzda, E., Wallace, V. A., Mayer, J., Yeung, R. S. M., Mak, T. W. and Ohashi, P. S. 1994. Positive and negative thymocyte selection induced by different concentrations of a single peptide. Science 263:1615.[Abstract/Free Full Text]
  42. Alam, S. M., Travers, P. J., Wung, J. L., Nasholds, W., Redpath, S., Jameson, S. C. and Gascoigne, N. R. 1996. T cell receptor affinity and thymocyte positive selection. Nature 381:616.[Medline]
  43. Ohoka, Y., Kuwata, T., Asada, A., Zhao, Y., Mukai, M. and Iwata, M. 1997. Regulation of thymocyte lineage commitment by the level of classical protein kinase C activity. J. Immunol. 158:5707.[Abstract]
  44. de Groot, R. P., Auwerx, J., Bourois, M. and Sassone-Corsi, P. 1993. Negative regulation of Jun/AP-1: conserved function of glycogen synthase kinase 3 and the Drosophila kinase shaggy. Oncogene 8:841.[Web of Science][Medline]
  45. Lin, A. N., Frost, J., Deng, T. L., Smeal, T., Alalawi, N., Kikkawa, U., Hunter, T., Brenner, D. and Karin, M. 1992. Casein kinase-II is a negative regulator of c-jun DNA-binding and AP-1 activity. Cell 70:777.[Web of Science][Medline]
  46. Boyle, W. J., Smeal, T., Defize, L. H. K., Angel, P., Woodgett, J. R., Karin, M. and Hunter, T. 1991. Activation of protein kinase C decreases phosphorylation of c-Jun at sites that negatively regulate its DNA-binding activity. Cell 64:573.[Web of Science][Medline]
  47. Ochi, Y., Koizumi, T., Kobayashi, S., Phuchareon, J., Hatano, M., Takada, M., Tomita, Y. and Tokuhisa, T. 1994. Analysis of IL-2 gene regulation in c-fos transgenic mice. Evidence for an enhancement of IL-2 expression in splenic T cells stimulated via TCR/CD3 complex. J. Immunol. 153:3485.[Abstract]
  48. Northrop, J. P., Ullman, K. S. and Crabtree, G. R. 1993. Characterization of the nuclear and cytoplasmic components of the lymphoid-specific nuclear factor of activated T cells (NF-AT) complex. J. Biol. Chem. 268:2917.[Abstract/Free Full Text]
  49. De Cesare, D., Vallone, D., Caracciolo, A., Sassone-Corsi, P., Nerlov, C. and Verde, P. 1995. Heterodimerization of c-Jun with ATF-2 and c-Fos is required for positive and negative regulation of the human urokinase enhancer. Oncogene 11:365.[Web of Science][Medline]
  50. Sen, J., Shinkai, Y., Alt, F. W., Sen, R. and Burakoff, S. J. 1994. Nuclear factors that mediate intrathymic signals are developmentally regulated. J. Exp. Med. 180:2321.[Abstract/Free Full Text]
  51. Simon, A. K., Auphan, N. and Schmitt-Verhulst, A. M. 1996. Developmental control of antigen-induced thymic transcription factors. Int. Immunol. 8:1421.[Abstract/Free Full Text]
  52. Suzuki, T., Okuno, H., Yoshida, T., Endo, T., Nishina, H. and Iba, H. 1991. Difference in transcriptional regulatory function between c-Fos and Fra-2. Nucleic Acids Res. 19:5537.[Abstract/Free Full Text]
  53. Yoshioka, K., Deng, T., Cavigelli, M. and Karin, M. 1995. Antitumor promotion by phenolic antioxidants: inhibition of AP-1 activity through induction of Fra expression. Proc. Natl Acad. Sci. USA 92:4972.[Abstract/Free Full Text]
  54. Robertson, L. M., Kerppola, T. K., Vendrell, M., Luk, D., Smeyne, R. J., Bocchiaro, C., Morgan, J. I. and Curran, T. 1995. Regulation of c-fos expression in transgenic mice requires multiple interdependent transcription control elements. Neuron 14:241.[Web of Science][Medline]
  55. Zinck, R., Hipskind, R. A., Pingoud, V. and Nordheim, A. 1993. c-fos transcriptional activation and repression correlate temporally with the phosphorylation status of TCF. EMBO J. 12:2377.[Web of Science][Medline]
  56. Sen, J., Kapeller, R., Fragoso, R., Sen, R., Zon, L. I. and Burakoff, S. J. 1996. Intrathymic signals in thymocytes are mediated by p38 mitogen-activated protein kinase. J. Immunol. 156:4535.[Abstract]
  57. Alberola-Ila, J., Forbush, K. A., Seger, R., Krebs, E. G. and Perlmutter, R. M. 1995. Selective requirement for MAP kinase activation in thymocyte differentiation. Nature 373:620.[Medline]
  58. Alberola-Ila, J., Hogquist, K. A., Swan, K. A., Bevan, M. J. and Perlmutter, R. M. 1996. Positive and negative selection invoke distinct signaling pathways. J. Exp. Med. 184:9.[Abstract/Free Full Text]
  59. Okada, S., Wang, Z. Q., Grigoriadis, A. E., Wagner, E. F. and von Ruden, T. 1994. Mice lacking c-fos have normal hematopoietic stem cells but exhibit altered B-cell differentiation due to an impaired bone marrow environment. Mol. Cell. Biol. 14:382.[Abstract/Free Full Text]
  60. Wang, Z.-Q., Ovitt, C., Grigoriadis, A. E., Möhle-Steinlein, U., Rüther, U. and Wagner, E. F. 1992. Bone and haematopoietic defects in mice lacking c-fos. Nature 360:741.[Medline]
  61. Rüther, R., Müller, W., Sumida, T., Tokuhisa, T., Rajewsky, K. and Wagner, E. F. 1988. c-fos expression interferes with thymus development in transgenic mice. Cell 53:847.[Web of Science][Medline]
  62. Carrozza, M. L., Jacobs, H., Acton, D., Verma, I. and Berns, A. 1997. Overexpression of the FosB2 gene in thymocytes causes aberrant development of T cells and thymic epithelial cells. Oncogene 14:1083.[Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
R. J. Lund, M. Loytomaki, T. Naumanen, C. Dixon, Z. Chen, H. Ahlfors, S. Tuomela, J. Tahvanainen, J. Scheinin, T. Henttinen, et al.
Genome-Wide Identification of Novel Genes Involved in Early Th1 and Th2 Cell Differentiation
J. Immunol., March 15, 2007; 178(6): 3648 - 3660.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Y. H. Huang, D. Li, A. Winoto, and E. A. Robey
Distinct transcriptional programs in thymocytes responding to T cell receptor, Notch, and positive selection signals
PNAS, April 6, 2004; 101(14): 4936 - 4941.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. L. Williams, A. J. Zullo, M. H. Kaplan, R. R. Brutkiewicz, C. D. Deppmann, C. Vinson, and E. J. Taparowsky
BATF Transgenic Mice Reveal a Role for Activator Protein-1 in NKT Cell Development
J. Immunol., March 1, 2003; 170(5): 2417 - 2426.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Nunomura, T. Sato, and S. Habu
Molecular Basis for Functional Maturation of Thymocytes: Increase in c-fos Translation with Positive Selection
J. Immunol., June 1, 2000; 164(11): 5590 - 5595.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Adachi, Y. Amasaki, S. Miyatake, N. Arai, and M. Iwata
Successive Expression and Activation of NFAT Family Members during Thymocyte Differentiation
J. Biol. Chem., May 5, 2000; 275(19): 14708 - 14716.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. K. Teague, D. Hildeman, R. M. Kedl, T. Mitchell, W. Rees, B. C. Schaefer, J. Bender, J. Kappler, and P. Marrack
Activation changes the spectrum but not the diversity of genes expressed by T cells
PNAS, October 26, 1999; 96(22): 12691 - 12696.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (15)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Chen, F.
Right arrow Articles by Rothenberg, E. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, F.
Right arrow Articles by Rothenberg, E. V.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?