Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (105)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Yoshida, H.
Right arrow Articles by Nishikawa, S.-I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yoshida, H.
Right arrow Articles by Nishikawa, S.-I.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 11, No. 5, 643-655, May 1999
© 1999 Japanese Society for Immunology

IL-7 receptor {alpha}+ CD3 cells in the embryonic intestine induces the organizing center of Peyer's patches

Hisahiro Yoshida, Kenya Honda, Reiko Shinkura1, Satoko Adachi, Satomi Nishikawa, Kazushige Maki2, Koichi Ikuta2 and Shin-Ichi Nishikawa

Department of Molecular Genetics, Faculty of Medicine,
1 Department of Molecular Biology, Institute of Genetics and
2 Department of Medical Chemistry, Faculty of Medicine, Kyoto University, Syogoin-Kawaharacho 53, Sakyoku, Kyoto 606-8507, Japan

Correspondence to: H. Yoshida


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Peyer's patch (PP) organogenesis proceeds through three histologically distinct steps: formation of organizing centers expressing VCAM-1 and ICAM-1 in segregated regions of the intestine at 15.5 days post-coitus (d.p.c.) (step I), accumulation of blood cells expressing different sets of surface markers to this region at 16.5–17.0 d.p.c. (step II), and entry of CD3+ and B220+ lymphocytes just before birth (step III). PP formation of both Il7ra–/– and Lta–/– mice is impaired from step I, suggesting involvement of the two molecules at the same timing in PP organogenesis. Expression of lymphotoxin (LT) {alpha} and LTß in IL-7 receptor (IL-7R) {alpha}+ cells in the intestine indicates that defects of Il7ra–/– and Lta–/– mice are due to functional inability of IL-7R{alpha}+ cells in the induction of PP anlage. Blocking of IL-7R{alpha} function by a single injection of the antagonistic mAb in 15.5 d.p.c. embryos suppressed appearance of VCAM-1+ spots and expression of LT{alpha} and LTß in the intestine, which eventually resulted in mice without PP but are otherwise normal. Intestinal IL-7R{alpha}+ cells are lymphoid in morphology but CD3 and functional in both nu/nu and Rag2–/ mice. These results implicate IL-7R{alpha}+ CD3 cells as the direct inducer of the organizing center of PP.

Keywords: development, IL-7R{alpha}, lymphotoxin, organizing center, Peyer's patch


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Peyer's patch (PP) is a peripheral lymphatic tissue distributed along the intestinal tract. In adult, 6–12 and 180–240 PP are present in the intestine of mouse and human respectively (1). Histological organization of PP is similar to other peripheral lymphatic organs elsewhere, as T and B lymphocytes are major components of this tissue, but other hematopoietic cells such as macrophages and dendritic cells are also present (2). Moreover, specialized structures like the high endothelial venule (HEV) and germinal center are found in PP as well as the lymph node (LN) and spleen. It was also suggested that antigenic stimulation in PP induces preferentially Ig class switch to IgA, an Ig class which can be exported through the epithelial sheet (35). Based upon these observations and its anatomical location, PP is thought to form the first front in the mucosal immunity of the intestine.

Recently, similarity and differences in PP and LN organogenesis were demonstrated in mice which bear null mutation in the genes encoding lymphotoxins (LT) and their receptors (LTR). In Lta–/– mice, formation of all PP and LN is inhibited (6,7). Moreover, it was reported that Ltbr–/– mice display no PP nor LN (8). As LT{alpha} and LTß form a heterotrimer which binds LTßR (9), these results support the idea that this heterotrimer plays an essential role in the induction of LN and PP. However, LTß null mutant mouse lacks peripheral LN and PP but mesenteric LN remain intact (8,10). These results suggest a diversity in the role of LT in the formation of these peripheral lymphoid organs.

Despite clear evidence for involvement of LT in the formation of PP, little is known about temporal expression of LT in embryogenesis, which cells in the intestine produce them, or which cells are affected by LT. In an attempt to elucidate the cellular process by which PP is constructed, we have demonstrated that PP organogenesis in mouse proceeds with at least three histologically distinct steps (11). The first step can be defined by expression of VCAM-1 in the mesenchymal cell component of segregated regions of the intestine at 15–16 day post-coitus (d.p.c.). Round cells including IL-7R{alpha}+, CD4+ and Ia+ cells accumulate in this VCAM-1+ region during the next step at ~16–17 d.p.c. CD3+ and B220+ mature lymphocytes, which are the major components of PP in later life, are found in this region just before birth. These observations indicate a chronological sequence of PP formation and molecules potentially involved in this process. Moreover, absence of VCAM-1+ spots in Il7ra–/– or Jak3–/ embryos provides direct evidence for the involvement of IL-7R{alpha} signaling in the early process of PP organogenesis (12). Since the PP development of nu/nu, scid/scid or Rag2–/ develops normally to the second step (11,12), this IL-7R{alpha} signaling step is independent of thymus-derived or mature lymphocyte development.

In this report, we investigated how IL-7R{alpha}+ cells are involved in PP anlage formation. The results suggest that the IL-7R{alpha}+ CD3 subset in the embryonic intestine expresses both LT{alpha} and LTß upon IL-7 stimulation, and acts on surrounding mesenchymal components to form organization centers of PP.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Mice
Pregnant C57BL/6J mice were purchased from Japan SLC (Shizuoka, Japan). Rag2–/ mutant mice were purchased from Taconic Farms (New York, NY) and Lta–/– mice were purchased from Jackson Laboratories (Bar Harbor, ME). Female and male mice were mated overnight, and those with a vaginal plug were judged pregnant. Noon of the day when the vaginal plug was identified was calculated as 0.5 d.p.c. Aliquots of 3 mg of antibodies dissolved in PBS were injected i.v. into pregnant mice at 6:00 p.m. of each gestational day.

Antibodies
Names of clones and sources of mAb used in this study are listed below. Anti-TCR-{delta} (3A10) was a kind gift from Dr Itohara. Anti-IL-7R{alpha} antibody (A7R34), anti-Flk-1 antibody (AVAS12), anti-c-fms antibody (AFS98), anti-Flk-2 antibody (A2F10) and anti-c-Kit antibody (ACK2) were established in our laboratory and prepared as previously described (1317). Anti-B220 antibody (RA3-6B2), anti-CD11b antibody (Mac-1), anti-CD8a (53-6.7) and anti-F4/80 (F4/80) were purified from hybridoma culture supernatant as described (11). Anti-CD4 (GK1.5; PharMingen, San Diego, CA), anti-Thy-1.2 (Caltag, San Francisco, CA), anti-CD3 (Y65.135; Seikagakukogyo, Tokyo, Japan; 2C11; PharMingen), anti-CD11c (HL3; PharMingen), anti-VCAM-1 (429 MVCAM.A; PharMingen), anti-ICAM-1 (3E2; PharMingen), anti-TCR-{alpha}ß (H57-597; PharMingen), anti-TCR-{gamma}{delta} (GL3; PharMingen), anti-CD45 (30F11.1; PharMingen), anti-NK1.1 (NKR-P1C; PharMingen), anti-CD44 (IM7; PharMingen) and anti-CD25 (7D4; PharMingen) were purchased.

Immunohistochemistry
Whole-mount immunohistostaining was performed as described previously (11,12,18). In order to immunostain the mAb-injected embryos, we used biotin-labeled mAb followed by horseradish peroxidase-conjugated streptavidin (Wako, Osaka, Japan). Briefly, the specimens were dissected and pre-fixed in 2% paraformaldehyde (pH 7.4) with microwave irradiation (30 s at 600 W) and fixed for 30–90 min in the same fixative on ice. After washing with PBS and dehydration by methanol, intrinsic peroxidase activities in the specimens was blocked by 0.3% of H2O2. Non-specific binding was blocked by incubation with PBSMT (1% skim milk/0.3% Triton X-100 in PBS) twice for 1 h each and then incubating with biotinylated antibodies for overnight. After washing the specimen in PBSMT 3 times for 1 h each and once in PBST (0.3% Triton X in PBS) for 30 min, the tissue was incubated with horseradish peroxidase–streptavidin for 1 h in PBST. After washing the specimen in PBST twice for 30 min each, the antigens were detected by the color reaction with diaminobenzidine and nickel chloride.

Preparation of single-cell suspension for flow cytometry and cell sorting.
All organs of embryos were dissected under a binocular stereomicroscope with fine forceps and then dissociated by incubating with dispase (Boehringer, Mannheim, Germany) for 10–25 min at 37°C. The whole gut of adult mice was chopped to small pieces with dissecting scissors and digested by type IV collagenase (Sigma, St Louis, MA) for 1 h at 37°C. After pipetting with a 21 gauge needle and syringe, dissociated cells were washed with HBSS containing 20% FCS and DNase (Sigma). Cells were filtered through nylon mesh to remove large clumps, washed and surface stained as described (13). Stained cells were analyzed or sorted by a FACS Vantage (Becton Dickinson).

RNA isolation and RT-PCR analysis
Total RNA was isolated from 20,000 cells that were directly sorted to the vial containing Isogen LS (Nippon Gene, Tokyo, Japan). cDNA was prepared from the total RNAs by reverse transcriptase using oligo-dT primers (Superscript; Gibco, LOCATION??). In each PCR reaction for detecting the expression of LT{alpha}, LTß and hprt genes, cDNA corresponding to an amount from 1000 cells was incubated with 100 pg of each primer set, 0.4 mM of each dNTP and 2.5 U of ExTaq polymerase (Takara, Kyoto, Japan). PCR conditions were determined for each primer set and control reactions were carried out in tubes without cDNA. The following oligonucleotides were used for PCR: LT-{alpha}: TCACCTTGTTGGGTACCCCAGCAA, ATACACAGACTTCTGCGCAC; LT-ß: TTGTTGGCAGTGCCTATCACTGTCC, CTCGTGTACCATAACGACCCGTAC; hprt: GAGCTACTGTAATGATCAGTCAACGG, GATTCAACTTGCGCTCATCTTAGGC.

For semiquantative RT-PCR analysis, the amount of the template cDNA from the each specimens was equalized by comparing the concentration of RT-PCR products with hprt primer sets at various amplifying cycles. The minimum number of amplifying cycles those detect the PCR products was determined for each specimen by each primer sets.

Cell culture
The cells sorted by FACS were co-cultured with stromal cell line OP-9, which support hematopoiesis from variable sources (19), in the presence of IL-7 (20 U/ml) and stem cell factor (SCF; 100 ng/ml). To block the function of IL-7R{alpha}, A7R34 was added at the concentration of 20 µg/ml. All cells were harvested 24 h later and the mRNA expression of each sample were examined by RT-PCR.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Process of PP formation in the mouse embryo
PP organogenesis develops in three distinctive steps designated as steps I, II and III distinguished by several lineage-specific marker-expressing cells distributions (11,12). In addition, we detected ICAM-1 expression in step I, and CD11c-, F4/80- or c-fms-expressing cells accumulation in step II in this study (Figs 1 and 3BGoGo). The distribution pattern of ICAM-1-expressing cells in developing PP was similar to VCAM-1-expressing cells. In contrast, the distribution patterns of various lineage marker-expressing blood cells at step II was different from each others (cf. the distribution patterns of IL-7R{alpha}+, CD11c+, F4/80+ and c-fms+ cells in Figs 1 and 3BGoGo). This result indicates the various lineages of blood cells accumulate independently into developing PP at step II.



View larger version (109K):
[in this window]
[in a new window]
 
Fig. 1. Histological events during PP organogenesis of various strains of mouse. Expression of VCAM-1, ICAM-1, IL-7R{alpha}, and CD45 in intestines of wild-type (WT) (A, B, C and H), Il7ra–/– (D) and Lta–/– (E, F and G) mice. Strains of mouse, stages of embryos and antibodies used for staining are indicated in the figure. VCAM-1+ or IL-7R{alpha}+ spots have never been detected in the intestine of Lta–/– embryos (E, F and G) or neonates (data not shown). Although cluster formation of IL-7R{alpha}+ cells could not be detected, they are widespread over the entire intestine of the 17.5 d.p.c. Lta–/– mouse (G) like those of the 15 d.p.c. wild-type embryo (H).

 




View larger version (256K):
[in this window]
[in a new window]
 
Fig. 3. Surface phenotypes of intestinal IL-7R{alpha}+ cells in 16.5 d.p.c. embryos. (A) Single-cell suspension was prepared from intestines of 16.5 d.p.c. C57BL/6 embryos by collagenase treatment. Cells were three-color stained by phycoerythrin–anti-CD4, allophycocyanin–A7R34 and FITC-labeled mAb against various surface molecules indicated. Expression of CD8, CD3, {delta}-chain, Mac1, NK1.1 and Thy1.2 of IL-7R{alpha}+ CD4+ and IL-7R{alpha}+ CD4 cells were presented. The negative threshold was determined by using FITC-labeled anti-rat IgG. (B) Whole-mount immunostaining patterns of CD11c-, F4/80- and c-fms-expressing cells in developing intestine. Wild-type mouse embryonic intestine was whole-mount immunostained by anti-CD11c, anti-F4/80 and anti-c-fms antibody. Note the distribution patterns of immunoreactive cells are different from each other. (C) Morphology of sorted IL-7R{alpha}+ CD4 and IL-7R{alpha}+ CD4+ cells stained with May–Grünwald–Giemsa solution.

 
We have previously shown that the Il7ra–/– mouse does not have PP and all three steps were undetectable (12). As accumulation of blood cells in developing intestine was not detected in the Il7ra–/– mouse by using anti-CD45 mAb recognizing all leukocyte cell lineages (Fig. 1Go), we confirmed that step II is completely absent in the Il7ra–/– mouse. Since IL-7R{alpha}+ cells were already found in embryonic gut as early as 13.5 d.p.c. and distributed mainly to the ante mesenteric region of the whole intestine by 15.0 d.p.c. (data not shown), the PP defect of the Il7ra–/– mouse must be an outcome of a failure in step I or more early step rather than involvement of IL-7R{alpha} signaling when IL-7R{alpha}+ cells accumulate to PP as a part of step II event.

We also investigated the Lta–/– mouse to specify the stage in which LT{alpha} plays a role in PP organogenesis. It displayed no VCAM-1+ (Fig. 1EGo) nor ICAM-1+ spots (data not shown) in the intestine, indicating the involvement of LT{alpha} in step I. Likewise, no cluster formation of CD45+ cells was observed (data not shown). Interestingly, IL-7R{alpha}+ cells remained widespread, but not in cluster, neither in the intestine of 17 d.p.c. Lta–/– mice (Fig. 1F and GGo) nor in neonatal Lta–/– mice (data not shown), just as seen in 15 d.p.c. wild-type embryos (Fig. 1HGo).

Involvement of IL-7R{alpha} signal in a short time-window during the initial step of PP formation
In order to specify the timing of IL-7R{alpha}+ cell function, we carried out an experiment to block the IL-7R{alpha} signal at various stages of embryogenesis. A single i.v. injection of an antagonistic mAb to IL-7R{alpha} (13) was given to pregnant mice on one of the days from 14.5 to 18.5 d.p.c. and the presence of PP in the offspring was examined at 2 months of age. As a class-matched control mAb, we used non-antagonistic anti-Flk1 mAb (14).

PP could not be detected in any of the offspring from mice treated with mAb to IL-7R{alpha} (A7R34) on 14.5–15.5 d.p.c. (Table 1Go). To confirm that the effect of A7R34 injection was restricted to PP, we collected each lymphoid tissue separately, and examined cell recovery and surface phenotype from 2-month-old animals treated with A7R34 at 14.5–15.5 d.p.c. Comparable numbers of cells were recovered from bone marrow, thymus, spleen, inguinal LN and mesenteric LN of control and A7R34-injected groups. Moreover, percentages of IL-7R{alpha}+, CD4+, CD8+ and B220+ cells in each organ were nearly the same between two groups (data not shown).


View this table:
[in this window]
[in a new window]
 
Table 1. Effect of single shot injection of anti-IL-7R{alpha} mAb on PP organogenesis
 
Interestingly, mice that were treated later than 16.5 d.p.c. generated PP, though only in the upper intestine (Table 1Go and Fig. 2Go). It is intriguing that all offspring of the 16.5 d.p.c. injected group generated only one PP in the upper intestine. In the 17.5 d.p.c. injected group, the number of organized PP was variable, but their localization was also restricted to the upper intestine. The injection on 18.5 d.p.c. had no effect on the PP development. It is of note that the lymphoid follicles in the cecum, which is absent in the Lta–/– or aly/aly but present in the Il7ra–/– mouse (Yoshida, unpublished observation), were unaffected by this treatment (Fig. 2Go, asterisk), suggesting the specificity of A7R34 treatment and involvement of other signals in the formation of the cecal follicle.



View larger version (72K):
[in this window]
[in a new window]
 
Fig. 2. Discordance of the effect of anti-IL-7R{alpha} mAb injection at 17.5 d.p.c. on the upper and lower region of intestine. Pregnant mice were given an i.v. injection of either AVAS12 or A7R34 at 17.5 d.p.c. Intestines of representative offspring are displayed in the pictures. Arrows indicate the position where organized PP were detected. In the control intestine, 12 PP plus one cecal nodule were detected (A). On the other hand, in this particular intestine from the A7R34-treated mouse, four PP and one cecal nodule were present (B). A cecal nodule is present also in the Il7ra–/– mouse, indicating that its organogenesis is independent from IL-7.

 
Phenotypes of IL-7R{alpha}+ cells in the intestine
To determine the lineage of IL-7R{alpha}+ cells in the intestine, we investigated the surface phenotypes of IL-7R{alpha}+ cells in the intestine. Figure 3Go(A) displays an example of FACS analysis of the IL-7R{alpha}+ cells present in the gut of C57BL/6 embryos at 16.5 d.p.c. when the IL-7R{alpha} signaling system is necessary for PP development. They were further subdivided to CD4+ and CD4 populations, whereas all are CD3 at this embryonic stage. None of other lymphoid cell markers except Thy1 were detectable in this population (Fig. 3AGo). Thy1 expression was detectable both in CD4+ and CD4 populations.

In addition to the markers presented in Fig. 3Go(A), we analyzed the expression of a panel of surface markers for various cell lineages. The IL-7R{alpha}+ cells expressed CD44, CD45, c-Kit, integrin {alpha}4 (100% of IL-7R{alpha}+ cells) and Mac-1 at low level (<10% of IL-7R{alpha}+ cells). IL-7R{alpha}+ cells in the gut at this embryonic stage did not express the surface markers for T cells: CD25, CD3, CD8, TCR{delta}, TCR{alpha}ß, TCR{gamma}{delta}; B cells, B220, CD19; NK cells, NK1.1; IEL, integrin {alpha}E; macrophages, c-fms, F4/80; dendritic cells, CD11c, Flk2/Flt3; erythrocytes, ter119; endothelial cells, Flk1; mesenchymal cells, PDGFR{alpha}, VCAM-1; epithelial cells, EC CD2 (Fig. 3AGo and Table 2Go). The mRNA expression analysis by means of RT-PCR of FACS-sorted cells detected lck and Ikaros mRNA, in both IL-7R{alpha}+ and IL-7R{alpha} CD45+ populations (data not shown). Interestingly, chemokine receptor BLR1 mRNA expression was found only in IL-7R{alpha}+ cells but not in IL-7R{alpha} populations (data not shown). Whole-mount immunostaining of 17.5 d.p.c. embryos showed that c-fms+ cells had a dendritic shape and were clustering in developing PP, F4/80+ cells were also dendritic, rather bigger than c-fms+ cells and distributed in the PP rather sparsely than IL-7R{alpha}+ cells, and CD11c+ cells were also dendritic but distributed only in the periphery of developing PP (Fig. 3BGo). In contrast, IL-7R{alpha}+ cells accumulating in the developing PP showed a round shape and diffuse distribution in the whole PP (11) (Fig. 1Go), indicating they are different from macrophages or dendritic cell lineages at this embryonic stage. Sorted CD4IL-7R{alpha}+ and CD4+ IL-7R{alpha}+ cells were small in size and showed a spherical shape, dark nucleus and scanty cytoplasm, which is consistent with the phenotyope of cells in the lymphoid lineage (Fig. 3CGo). Taken collectively, the surface marker expression, mRNA expression, morphology of in situ or sorted cells and the distribution patterns in the developing intestine indicated that IL-7R{alpha}+ cells present in the embryonic intestine are different from mature T cells, B cells, NK cells, macrophages, dendritic cells and non-blood cells.


View this table:
[in this window]
[in a new window]
 
Table 2. Surface markers expression of IL-7R{alpha}+ CD3 cells at 16.5 d.p.c.
 
Since all the gut IL-7R{alpha}+ cells express c-Kit, we examined the PP development in c-Kit the defective mutant KitW/KitW mice (20) to investigate the importance of this receptor tyrosine kinase in PP formation. Although this strain lacks the function of c-Kit, all three steps were detected during embryogenesis (data not shown).

Intestinal IL-7R{alpha}+ cells represent a subset specific to the abdominal cavity of embryos
In order to gain an insight into the origin of the IL-7R{alpha}+ cells in the embryonic intestine, we compared the surface phenotype of IL-7R{alpha}+ cells in various organs from embryos. Although, the number of IL-7R{alpha}+ cells in fetal liver is quite few, <1%, they are present in fetal liver, thymus, intestine, mesentery and spleen of the embryo at 14.5 d.p.c. Interestingly, however, CD4+ IL-7R{alpha}+ double-positive cells are only present in the intestine, mesentery and spleen (Fig. 4Go). This result suggests that the co-existence of CD4+ IL-7R{alpha}+ and CD4 IL-7R{alpha}+ cells is a common feature of tissues in the abdominal cavity of early embryos. IL-7R{alpha}+ cells disappeared rapidly from the spleen, while they were maintained in the intestine and mesentery before birth. When compared to mesenteric cells which have only a few CD3+ cells at 18.5 d.p.c., those in the intestine of the same embryos already contained many CD3+ cells.



View larger version (57K):
[in this window]
[in a new window]
 
Fig. 4. IL-7R{alpha}+ CD3 cells in the abdominal cavity of embryos. Single-cell suspensions of liver, thymus, intestine, mesentery and spleen of 14.5, 16.5 and 18.5 d.p.c. embryos were prepared, and three-color stained by FITC–anti-CD3, phycoerythrin–anti-CD4 and allophycocyanin–anti-IL-7R{alpha}. Presence of both IL-7R{alpha}+ CD4+ CD3 and IL-7R{alpha}+ CD4CD3 cells is a common feature of intestine, mesentery and spleen of 14.5 d.p.c. embryo. The presence of the CD3+ population in these tissues became detectable from 18.5 d.p.c.

 
Production of LT by IL-7R{alpha}+ cells
To test whether LT are involved in PP anlage formation as effector molecules expressed in IL-7R{alpha}+ cells or not, we sorted CD4 IL-7R{alpha}+, CD4+ IL-7R{alpha}+ and CD45+ IL-7R{alpha} cells from 15.5 and 16.5 d.p.c. intestine, and analyzed for expression of LT by RT-PCR. LT{alpha} and LTß mRNA were detected both in CD4+ and CD4 IL-7R{alpha}+ cells but not in CD45+ IL-7R{alpha} cells in the same intestine (Fig. 5AGo). Similarly, IL-7R{alpha}+ cells in spleen or mesentery also expressed LT{alpha} or LTß mRNA but CD45+ IL-7R{alpha} cells in these organs did not. In contrast, LT{alpha} and LTß mRNA were not detected in the IL-7R{alpha}+ cells of fetal liver (Fig. 5BGo). These results are representative of three independent examination.




View larger version (97K):
[in this window]
[in a new window]
 
Fig. 5. Expression of LT{alpha} and LTß in intestinal IL-7R{alpha}+ cells. Single-cell suspensions prepared from either 15.5 or 16.5 d.p.c. embryos were three-color stained by FITC–anti-CD45, phycoerythrin–anti-CD4 and allophycocyanin–anti-IL-7R{alpha}, and IL-7R{alpha}+ CD4+, IL-7R{alpha}+ CD4 and IL-7R{alpha} CD45+ fractions were sorted. (A) Total RNA was prepared from each fraction collected from intestine, and expression of LT{alpha}, LT and hprt was analyzed qualitatively by RT-PCR. Spleen cells from normal mice were used as a control. Lanes from the left are: 1, size markers; 2, CD4+ IL-7R{alpha}+ CD45+ (15.5 d.p.c.); 3, CD4 IL-7R{alpha}+ CD45+ (15.5 d.p.c.); 4, IL-7R{alpha} CD45+ (15.5 d.p.c.); 5, CD4+ IL-7R{alpha}+ CD45+ (16.5 d.p.c.); 6, CD4 IL-7R{alpha}+ CD45+ (16.5 d.p.c.); 7, IL-7R{alpha} CD45+ (16.5 d.p.c.); 8, adult spleen cells. (B) Total RNA was prepared from each fraction collected from spleen, mesentery or liver. Lanes from the left are: 1, CD4+ IL-7R{alpha}+ CD45+ (spleen); 2, CD4 IL-7R{alpha}+ CD45+ (spleen); 3, IL-7R{alpha} CD45+ (spleen); 4, CD4+ IL-7R{alpha}+ CD45+ (mesentery); 5, CD4 IL-7R{alpha}+ CD45+ (mesentery); 6, IL-7R{alpha} CD45+ (mesentery); 7, IL-7R{alpha}+ CD45+ (liver); 8, IL-7R{alpha} CD45+ (liver). Arrows indicated the size of target bands.

 
IL-7R{alpha}+ cells are activated within the intestine to induce PP anlage
Next, we investigated an immediate effect of A7R34 injection on the formation of PP anlage and also on the expression of LT in the intestine. Mice were given a single injection of A7R34 on 15.5 d.p.c., and the appearance of VCAM-1+ and ICAM-1+ segregated spots in the intestine was examined 24 h later. AVAS12 mAb was injected as the class-matched control mAb. Consistent with the result that the same treatment blocked PP organogenesis, generation of VCAM-1+ and ICAM-1+ spots was inhibited completely by A7R34 injection, whereas AVAS12 injection had no effect on this process (Fig. 6Go). We next prepared mRNA from intestines from A7R34- or AVAS12-injected mice and analyzed expression of LT semiquantitatively by RT-PCR. As compared with the control embryos, A7R34 injection suppressed LT{alpha} and LTß expression of the intestine.



View larger version (123K):
[in this window]
[in a new window]
 
Fig. 6. Immediate effect of anti-IL-7R{alpha} mAb injection on induction of the organizing center of PP and LT expression in the intestine. Pregnant mice were given an i.v. injection of either AVAS12 or A7R34 on 15.5 d.p.c. and sacrificed 24 h later. Intestines were dissected and whole-mount stained by biotinylated anti-VCAM-1 or -ICAM-1, followed by horseradish peroxidase–avidin. Appearance of segregated spots expressing (A) ICAM-1 and (C) VCAM-1 in the intestine of an AVAS12-treated mouse was absent (B and D) in the intestine of an A7R34-treated mouse. (E) Expression of LT{alpha} and LTß of intestines treated either with A7R34 or control AVAS12 mAb was semiquantitatively analyzed by RT-PCR. Lanes from the left are: 1, normal spleen; 2, AVAS12-treated intestine; 3, A7R34-treated intestine.

 
To further confirm that the IL-7R{alpha} signal is involved in LT production of IL-7R{alpha}+ cells, we investigated in vitro whether or not the IL-7R{alpha} signal is required for production of LT. IL-7R{alpha}+ CD45+ and IL-7R{alpha} CD45+ cells were sorted from 15.5–16.5 d.p.c. intestine, and cultured with OP9 feeder layer for 24 h in the presence of IL-7 and SCF. As shown in Fig. 7Go, IL-7R{alpha}+ cells but not IL-7R{alpha} cells expressed LT{alpha} and LTß under these culture conditions. Consistent with our in vivo result, addition of A7R34 blocked the production of LT, although the recovery of blood cell numbers was not different between the two cultures (data not shown). These results indicate that IL-7R{alpha} is required for the production of LT in IL-7R{alpha}+ cells.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 7. Induction of LT expression by sorted IL-7R{alpha}+ cells with IL-7. Expression of LT{alpha} and LTß in FACS-sorted IL-7R{alpha}+ cells cultured on stromal cell OP-9 (19) with IL-7 and SCF for 24 h with A7R34 (an antagonistic anti-IL-7R{alpha}) or AVAS12 (a class-matched control antibody against Flk1). Lanes from the left are the products from: 1, normal thymus; 2, IL-7R{alpha}+ cells with AVAS12; 3, IL-7R{alpha}+ cells with A7R34; 4, IL-7R{alpha} CD45+cells with AVAS12; 5, IL-7R{alpha} CD45+ cells with A7R34; 6, the feeder layer alone with AVAS12.

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
A molecular and cellular scenario for PP anlage formation
Molecular genetics have identified a number of molecules that play an essential role in PP organogenesis (68,10,2131). However, as yet little is understood about how these molecules are involved in PP formation. One impediment to our understanding has been lack of knowledge about the histological events during PP organogenesis; clarification of the PP bauplan allows the consequence of disparate mutations to be defined.

Previously, we presented a scenario in which three distinct steps were histologically defined in the embryonic process of PP organogenesis (11). Additionally, we showed that PP development of the Il7ra–/– mouse is impaired from step I (12). This finding implied that IL-7R{alpha}+ cells are crucial to the induction of the VCAM-1/ICAM-1-expressing organizing center for PP organogenesis. In the study presented here, we demonstrated that (i) the IL-7R{alpha}-mediated events for PP organogenesis are restricted to a short time-window in step I; (ii) PP organogenesis of the Lta–/– mouse is defective from step I; (iii) only IL-7R{alpha}+ cells are the producer of LT{alpha} and LTß in the intestine; and (iv) LT expression in the intestine is IL-7R{alpha} dependent.

Although we detected the expression of IL-7 mRNA in developing gut by the RT-PCR method (data not shown), we could not identify cellular localization of the IL-7 in the intestine, despite extensive attempts using immunohistochemistry or in situ hybridization. Interestingly, by careful inspection of the intestinal surface as well as histological examination, we found the Il7–/ mouse has normal numbers of PP in its intestine (Honda, unpublished observation), although previously the mutant was reported to have no PP (22). This discordance in PP organogenesis of Il7–/ and Il7ra–/– mice implicates the role for another ligand for IL-7R{alpha}, thymic stromal-derived lymphopoietin (32), stimulating IL-7R{alpha}+ cells in the developing intestine.

That A7R34 injection on 14.5–15.5 d.p.c. completely blocks expression of VCAM-1 and ICAM-1 in the PP anlage strongly suggests an order of events: ligand-induced stimulation of IL-7R{alpha}+ cells, expression of LT, and induction of VCAM-1 and ICAM-1. Alternatively, IL-7 may support survival of IL-7R{alpha}+ cells, which respond to other unidentified signals to induce expression of LT. However, we could not detect organized PP in the Il7ra–/– mice harboring the bcl-2 gene under the control of the H-2 promoter (Yoshida et al., unpublished observation), in which IL-7R{alpha}+ cells may survive in the absence of IL-7 (33). Hence, persistence of IL-7R{alpha}+ cells in the intestine is not sufficient to induce PP organogenesis. We demonstrated here that LT{alpha} expression in the intestine is suppressed by A7R34 injection and also that in vitro production of LT by IL-7R{alpha}+ cells is dependent upon IL-7R{alpha} signal. Taken together, it is likely that IL-7R{alpha} stimulation by specific ligands is directly involved in the production of LT for PP development. Whether or not LT are sufficient effectors for the induction of PP anlage is not clear, but it is implied by a recent study showing that ectopic expression of LT{alpha} induces formation of lymphoid follicles (34).

Once the organizing center of PP is formed, other molecules such as chemokines may also be expressed in the PP anlagen, thereby attracting various blood cell lineages to this center in step II. In fact, many cell types including IL-7R{alpha}+ cells, c-fms+ or F4/80+ macrophages and CD11c+ dendritic cells accumulate to this region at the same time, although the staining pattern for each antibody was different. Thus, although we initially defined step II as the formation of segregated clusters of IL-7R{alpha}+ and CD4+ cells, this should be a part of the secondary events induced after the formation of the organizing center of PP.

These findings indicate a molecular and cellular basis not only for IL-7R{alpha}-dependent but also LT-mediated processes of PP organogenesis. Based upon this, we propose a model for PP organogenesis in which IL-7R{alpha}+ CD3 cells play a pivotal role in the induction of PP anlage (Fig. 8Go).



View larger version (70K):
[in this window]
[in a new window]
 
Fig. 8. A model for PP organogenesis. In this model, the significance of three steps defined histologically previously (11,12) was considered as steps for (i) induction of the organizing center for PP organogenesis, (ii) architecture formation of PP and (iii) homing of mature lymphocytes. As shown in the text, step I is essential for triggering subsequent steps. We presented evidence for involvement of two signal pathways in the induction of PP anlage. One is the IL-7R{alpha} ligand/IL-7R{alpha}/Jak3 pathway and the other is LT{alpha}. We also confirmed that no organized PP are formed in the {gamma}c gene null mutation (Yoshida et al., unpublished observation). As IL-7R{alpha}+ CD3 cells are the producers of LT{alpha} and LTß, IL-7R{alpha}+ cells in the intestine are the direct inducers of the organizing center of PP. Indirect evidence supports a sequence of events: (i) IL-7R{alpha} ligand stimulation of IL-7R{alpha}+ CD3 inducer of the organizing center, (ii) production of LT by the inducer, (iii) LT-mediated activation of the organizing center of PP, and (iv) expression of VCAM-1 and ICAM-1 in the organizing center. A recent study by Alimzhanov et al. (8) indicated the involvement of both LTß and LTßR in the final step. In this model, an IL-7R{alpha} ligand-producing cell is the initiator of this cascade, but has not yet been identified.

 
Transient requirement of IL-7R{alpha} stimulation for PP development
IL-7R{alpha}+ cells are widespread in the intestine of the 14–16 d.p.c. embryo, whereas the organizing center of PP expressing VCAM-1 and ICAM-1 are segregated (11). Thus, the position of the PP anlage should be determined either by segregated expression of IL-7R{alpha} ligands or receptors for LT. In either case, the positional signals for PP should be placed prior to the stimulation of IL-7R{alpha}+ cells, while its molecular or cellular nature is totally obscure at present.

Histological analysis of VCAM-1+ cells showed that they are either fibroblastic or dendritic in shape (11). These findings agree with previous findings that constitutive expression of LT{alpha} in a non-lymphoid organ induces VCAM-1 and ICAM-1 in mesenchymal cells (35). At present it is not clear whether VCAM-1/ICAM-1-expressing cells in developing PP are the only cells that respond to the LT signal and are different from other mesenchymal fibroblastic cells or not. However, if so, presumptive VCAM-1/ICAM-1-expressing cells themselves may regulate this positional signal, because they should be accumulated in the presumptive PP region before being stimulated by IL-7R{alpha}+ cells. Hence, isolation and characterization of these VCAM-1/ICAM-1-expressing mesenchymal cells in 14.5–15.5 d.p.c. embryo intestine is very important, and may clarify the cellular and molecular nature of the positional signals for PP organization.

The present results indicate that IL-7R{alpha} is required in a very short time-window of PP organogenesis from 14.5 to 17.5 d.p.c. In contrast, Rennert et al. (36) reported that a single shot of LTßR–Fc chimera as late as 18 d.p.c. completely blocked PP organogenesis. This discrepancy may indicate that LT{alpha}ß is required even after the induction of PP anlage, while IL-7R{alpha} functions transiently during the placement of the anlage, and the molecule which directs the transient positional signal of PP may be IL-7R{alpha} ligands but not LTßR. We found IL-7R{alpha}+ cells are the only source for LT production even in spleen or mesentery. Spleen or LN development was disrupted in Lta–/– mice (6,7) but not in Il7ra–/– or A7R-treated mice (data not shown). These results imply involvement of multiple signals in the initiation phase of the organogenesis of peripheral lymphoid tissues, though LT{alpha}ß may be functioning in all processes as the effector molecule.

A unique lymphocyte subset in the abdominal cavity.
As IL-7R{alpha}+ cells in the PP are present in nu/nu, scid/scid and Rag2–/ mice (11,12), it is not thymus dependent nor does it express antigen receptor genes. Indeed, IL-7R{alpha}+ cells in the intestine are negative for various lymphoid markers and widespread in the intestine as early as 14 d.p.c. Although these surface phenotypes or distributions cast doubt on their lymphoid lineage, they appeared lymphocytic in morphology and are negative in expression of surface markers for other blood cell lineage markers.

Recent studies of Mebius et al. (37,38) identified in the developing LN a similar subset CD3CD4+ IL-7R{alpha}+, and demonstrated their potential to differentiate to NK cells and dendritic cells in response to various cytokines. It is likely that IL-7R{alpha}+ CD3 cells described in this study represent the same population of them. However, all IL-7R{alpha}+ cells in the embryonic intestine were c-Kit+ and CD25 (IL-2R{alpha}), whereas Mebius reported that CD4+CD3 IL-7R{alpha}+ cells in the developing LN were c-Kit–/dull and CD25+ (75%). Thus, they may represent distinct subsets or alternatively they are derived from the same precursor but those colonized LN lose c-Kit and gain CD25 expression. Moreover, Kanamori et al. (39) described a new intestinal lymphoid tissue, cryptic patch, that consists of IL-7R{alpha}+ CD3 cells that have a potential to give rise to {gamma}{delta}T cells. We also found that some IL-7R{alpha}+ in the intestine of 18 d.p.c. embryos express CD3, although their numbers were very low in the mesentery. This may suggest that IL-7R{alpha}+ CD3 cells differentiate to T cells in the intestine, although T cell entry through a non-mesenteric route can not be ruled out. Nevertheless, the results of ours and others suggest that the presence of IL-7R{alpha}+ CD3CD4+/– cells is a characteristic feature of the developing peripheral lymphoid tissues. It is intriguing that this subset is found in the intestine, mesentery and spleen of embryos. Moreover, it is found also in the stomach and colon, though absent in the liver. This suggests that these organs in the abdominal cavity can provide a micro environment that can support survival, proliferation and/or differentiation of this subset.

In conclusion, this line of evidence suggests that the CD3 IL-7R{alpha}+ subset in the embryonic intestine, mesentery and spleen represents a novel lymphoid subset. Altough they may have potential to undergo further differentiation, we speculate the major function of this subset is to control organogenesis of the PP anlagen. This is the first comprehensive model for the molecular and cellular basis for secondary lymphoid tissue organogenesis; however, it can only be proven by an experiment in which PP of the Lta–/– or Il7ra–/– mouse are reconstructed by transferring the wild-type CD3 IL-7R{alpha}+ population. As shown in this study, the cell transfer should be performed at an appropriate timing during the initial stage of PP formation. To address this question, methods to transfer the cells to embryos and deliver them to the site of organogenesis of PP need to be developed.


    Acknowledgments
 
We are grateful to Dr Itohara for providing anti TCR{delta} mAb, Dr Akashi for providing il7ra–/–xH2-Bcl-2 transgenic mice, and Dr Yokota for providing PCR primers for LT{alpha} and LTß. We also thank to Drs R. Mebius, S. Fraser and D. Opstelten for reading our manuscript and many valuable comments. This work was supported by grants from Japanese Ministry of Education, Science and Culture (nos 07CE2005, 07457085 and 06277102), and a grant for Pediatric Research (9C-5) from the Ministry of Health and Welfare of Japan.


    Abbreviations
 
d.p.c.day post-coitus
HEVhigh endothelial venule
IL-7RIL-7 receptor
LNlymph node
LTlymphotoxin
LTRlymphotoxin receptor
PPPeyer's patch
SCFstem cell factor

    Notes
 
Transmitting editor: D. Kitamura

Received 26 July 1998, accepted 14 January 1999.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Griebel, P. J. and Hein, W. R. 1996. Expanding the role of Peyer's patches in B-cell ontogeny. Immunol. Today 17;30.[Web of Science][Medline]
  2. Abe, K. and Ito, T. 1977. A qualitative and quantitative morphologic study of Peyer's patches of the mouse. Arch. Histol. Jpn. 40:407.
  3. Knight, K. L. 1994. Developmental aspects of mucosal immunoglobulin genes: organization and expression of IgA heavy-chain, polymeric immunoglobulin receptor, and J-chain genes. In Ogra, P. L., Mestecky, J., Lamm, M. E., Strober, W., McGheeJ. R. and Bienenstock, J., eds, Handbook of Mucosal Immunology, p. 105. Academic Press, New York.
  4. Cebra, J. J. and Shroff, K. E. 1994. Peyer's patches as inductive sites for IgA commitment. In Ogra, P. L., Mestecky, J., Lamm, M. E., Strober, W., McGheeJ. R. and Bienenstock, J., eds, Handbook of Mucosal Immunology, p. 151. Academic Press, New York.
  5. Strober, W. Ehrhardt, R. O. 1994. Regulation of IgA B cell development In Ogra, P. L., Mestecky, J., Lamm, M. E., Strober, W., McGheeJ. R. and Bienenstock, J., eds, Handbook of Mucosal Immunology, p. 159. Academic Press, New York.
  6. De Togni, P., Goellner, J., Ruddle, N. H., Streeter, P. R., Fick, A., Mariathasan, S., Smith, S. C., Carlson, R., Shornick, L. P. and Schoenberger, S. 1994. Abnormal development of peripheral lymphoid organs in mice deficient in lymphotoxin. Science 264:703.[Abstract/Free Full Text]
  7. Banks, T. A., Rouse, B. T., Kerley, M. K., Blair, P. J., Godfrey, V. L., Kuklin, N. A., Bouley, D. M., Thomas, J., Kanangat, S. and Mucenski, M. L. 1995. Lymphotoxin-{alpha}-deficient mice: effects on secondary lymphoid organ development and humoral immune responsiveness. J. Immunol. 155:1685.[Abstract]
  8. Alimzhanov, M. B., Kuprashi, D. V., Kosco-Vilbois, M.-H., Luz, A., Turetskaya, R. L., Tarakhovsky, A., Rajewsky, K., Nedospasov, S. A. and Pfeffer, K. 1997. Abnormal development of secondary lymphoid tissues in lymphotoxin ß-deficient mice. Proc. Natl Acad. Sci. USA 94:9302.[Abstract/Free Full Text]
  9. Browning, J. L., Ngam-ek, A., Lawton, P., DeMarinis, J., Tizard, R., Chow, E. P., Hession, C., O'Brine-Greco, B., Foley, S. F. and Ware, C. F. 1993. Lymphotoxin-ß, a novel member of the TNF family that forms a heteromeric complex with lymphotoxin on the cell surface. Cell 72:847.[Web of Science][Medline]
  10. Koni, P. A., Sacca, R., Lawton, P., Browning, J. L., Ruddle, R. H. and Flavell, R. A. 1997. Distinct roles in lymphoid organogenesis for lymphotoxins {alpha} and ß revealed in lymphotoxin ß-deficient mice. Immunity 6:491.[Web of Science][Medline]
  11. Adachi, S., Yoshida, H., Kataoka, H. and Nishikawa, S.-I. 1997. Three distinctive steps in Peyer's patch formation of murine embryo. Int. Immunol. 9:507.[Abstract/Free Full Text]
  12. Adachi, S., Yoshida, H., Honda, K., Maki, K., Saijo, K., Ikuta, K., Saito, T., Nishikawa, S. and Nishikawa, S.-I. 1998. Essential role of IL-7 receptor a in the formation of Peyer's patch anlage. Int. Immunol. 10:1.[Abstract/Free Full Text]
  13. Sudo, T., Nishikawa, S., Ohno, N., Akiyama, N., Tamakoshi, M., Yoshida, H. and Nishikawa, S.-I. 1993. Expression and function of the interleukin 7 receptor in murine lymphocytes. Proc. Natl Acad. Sci. USA. 90:9125.[Abstract/Free Full Text]
  14. Kataoka, H., Takakura, N., Nishikawa, S., Tsuchida, K., Kodama, H., Kunisada, T., Risau, W., Kita, T. and Nishikawa, S.-I. 1997. Expressions of PDGF receptor alpha, c-Kit and flk1 genes clustering in mouse chromosome 5 define distinct subsets of nascent mesodermal cells. Dev. Growth Different. 39:729.[Web of Science][Medline]
  15. Sudo, T., Nishikawa, S., Ogawa, M., Kataoka, H., Ohno, N., Izawa, A., Hayashi, S. and Nishikawa, S.-I. 1995. Functional hierarchy of c-Kit and c-fms in intramarrow production of CFU-M. Oncogene 11:2469.[Web of Science][Medline]
  16. Ogawa, M., Sugawara, S., Kunisada, T., Sudo, T., Hayashi, S., Nishikawa, S., Kodama, H. and Nishikawa, S.-I. 1998. Flt3/Flk-2 and c-Kit are not essential for the proliferation of B lymphoid progenitor cells in the bone marrow of the adult mouse. Exp. Hematol., in press.
  17. Nishikawa, S., Kusakabe, M., Yoshinaga, K., Ogawa, M., Hayashi, S., Kunisada, T., Era, T., Sakakura, T. and Nishikawa, S.-I. 1991. In utero manipulation of coat color formation by a monoclonal anti-c-Kit antibody: two distinct waves of c-Kit-dependency during melanocyte development. EMBO J. 10:2111.[Web of Science][Medline]
  18. Yoshida, H., Kunisada, T., Kusakabe, M., Nishikawa, S. and Nishikawa, S.-I. 1996. Distinct stages of melanocyte differentiation revealed by analysis of nonuniform pigmentation patterns. Development. 122:1207.[Abstract]
  19. Nishikawa, S.-I., Nishikawa, S., Hirashima, M., Matsuyoshi, N. and Kodama, H. 1998. Progressive lineage analysis by cell sorting and culture identifies FLK1+VEcadherin+ cells at a diverging point of endothelial and hemopoietic lineages. Development 125:1747.[Abstract]
  20. Hayashi, S., Kunisada, T., Ogawa, M., Yamaguchi, K. and Nishikawa, S.-I. 1991. Exon skipping by mutation of an authentic splice site of c-Kit gene in W/W mouse. Nucleic Acids Res. 19:1267.[Abstract/Free Full Text]
  21. Pasparakis, M., Alexopoulou, L., Grell, M., Pfizenmaier, K., Bluethman, H. and Kollias, G. 1997. Peyer's patch organogenesis is intact yet formation of B lymphocyte follicles is defective in peripheral lymphoid organs of mice deficient for tumor necrosis factor and its 55-kDa receptor. Proc. Natl Acad. Sci. USA 94:6319.[Abstract/Free Full Text]
  22. von-Freeden-Jeffry, U., Vieira, P., Lucian, L. A., McNeil, T., Burdach, S. E. G. and Murray, R. 1995. Lymphopenia in Interleukin (IL)-7 gene deleted mice identifies IL-7 as a nonredundant cytokine. J. Exp. Med. 181:1519.[Abstract/Free Full Text]
  23. Peschon, J. J., Morrissey, P. J., Grabstein, K. H., Ramsdell, F. J., Maraskovsky, E., Gliniak, B. C., Park, L. S., Ziegler, S. F., Williams, D. E., Ware, C. B., Meyer, J. D. and Davison, B. L. 1994. Early lymphocyte expansion is severely impaired in interleukin-7 receptor deficient mice. J. Exp. Med. 180:1955.[Abstract/Free Full Text]
  24. Georgopoulos, K., Bigby, M., Wang, J.-H., Molnar, A., Wu, P., Winandy, S. and Sharpe, A. 1994. The Ikaros gene is required for the development of all lymphoid lineages. Cell 79:143.[Web of Science][Medline]
  25. Park, S. Y., Saijo, K., Takahashi, T., Osawa, M., Arase, H., Hirayama, N., Miyake, K., Nakauchi, H., Shirasawa, T. and Saito, T. 1995. Developmental defects of lymphoid cells in Jak3 kinase-deficient mice. Immunity 3;771.
  26. Nosaka, T., van-Deursen, J. M., Tripp, R. A., Thierfelder, W. E., Witthuhn, B. A., McMickle, A. P., Doherty, P. C., Grosveld, G. C. and Ihle, J. N. 1995. Defective lymphoid development in mice lacking Jak3. Science 270:800.[Abstract/Free Full Text]
  27. Cao, X., Shores, E. W., Hu-Li, J., Anver, M. R., Kelshall, B. L., Russell, S. M., Drago, J., Noguchi, M., Grinberg, A., Bloom, E. T., Paul, W. E., Katz, S. I., Love, P. E. and Leonard, W. J. 1995. Defective lymphoid development in mice lacking expression of the common cytokine receptor {gamma} chain. Immunity 2:223.[Web of Science][Medline]
  28. DiSanto, J. P., Muller, W., Guy-Grand, D., Fischer, A. and Rajewsky, K. 1995. Lymphoid development in mice with a targetted deletion of the interleukin 2 receptor gamma chain. Proc. Natl Acad. Sci. USA 92:377.[Abstract/Free Full Text]
  29. Ohbo, K., Suda, T., Hashiyama, M., Mantani, A., Ikebe, M., Miyakawa, K., Moriyama, M., Nakamura, M., Katsuki, M., Takahashi, K., Yamamura, K. and Sugamura, K. 1996. Modulation of hematopoiesis in mice with a truncated mutant of the interleukin-2 receptor gamma chain. Blood 87:956.[Abstract/Free Full Text]
  30. Maki, K., Sunaga, S., Komagata, Y., Kodaira, Y., Mabuchi, A., Karasuyama, H., Yokomuro, K., Miyazaki, J.-I. and Ikuta, K. 1996. Interleukin 7 receptor-deficient mice lack gammadelta T cells. Proc. Natl Acad. Sci. USA 93:7172.[Abstract/Free Full Text]
  31. Förster, R., Mattis, A. E., Kremmer, E., Wolf, E., Brem, G. and Lipp, M. 1996. A putative chemokine receptor, BLR1, directs B cell migration to defined lymphoid organs and specific anatomic compartments of the spleen. Cell 87:1037.[Web of Science][Medline]
  32. Ray, R. J., Furlonger, C., Williams, D. E. and Paige, C. J. 1996. Characterization of thymic stromal-derived lymphopoietin (TSLP) in murine B cell development in vitro. Eur. J. Immunol. 26:10.[Web of Science][Medline]
  33. Akashi, K., Kondo, M., von Freeden Jeffry, U. and Weissman, I. L. 1997. Bcl-2 rescues T lymphopoiesis in Interleukin-7 receptor deficient mice. Cell 89:1033.[Web of Science][Medline]
  34. Kratz, A., Campos-Neto, A., Hanson, M. S. and Ruddle, N. H. 1996. Chronic inflammation caused by lymphotoxin is lymphoid neogenesis. J. Exp. Med. 183:1461.[Abstract/Free Full Text]
  35. Picarella, D. E., Kratz, A., Li, C. B., Ruddle, N. H. and Flavell, R. A. 1993. Transgenic tumor necrosis factor (TNF)-alpha production in pancreatic islets leads to insulitis, not diabetes. Distinct patterns of Inflammation in TNF-{alpha} and TNF-ß transgenic mouse. J. Immunol. 150:4136.[Abstract]
  36. Rennert, P. D., Browning, J. L., Mebius, R., Mackay, F. and Hochman, P. S. 1996. Surface lymphotoxin {alpha}/ß complex is required for the development of peripheral lymphoid organs. J. Exp. Med. 184:1999.[Abstract/Free Full Text]
  37. Mebius, R. E., Streeter, P. R., Michie, S. Butcher, E. C. and Weissman, I. L. 1996. A developmental switch in lymphocyte homing receptor and endothelial vascular addressin expression regulates lymphocyte homing and permits CD4+CD3 cells to colonize lymph nodes. Proc. Natl Acad. Sci. USA 93:11019.[Abstract/Free Full Text]
  38. Mebius, R. E., Rennert, P. and Weissman, I. L. 1997. Developing lymph nodes collect CD4+CD3 LTß+ cells that can differentiate to APC, NK, and follicular cells, but not T- or B-cells. Immunity 7:493.[Web of Science][Medline]
  39. Kanamori, Y., Ishimaru, K., Nanno, M., Maki, K., Ikuta, K., Nariuchi, H. and Ishikawa, H. 1996. Identification of novel lymphoid tissues in murine intestinal mucosa where clusters of c-Kit+ IL-7R+ Thy-1+ lympho-hemopoietic progenitors develop. J. Exp. Med. 184:1449.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
M. F. Vondenhoff, M. Greuter, G. Goverse, D. Elewaut, P. Dewint, C. F. Ware, K. Hoorweg, G. Kraal, and R. E. Mebius
LT{beta}R Signaling Induces Cytokine Expression and Up-Regulates Lymphangiogenic Factors in Lymph Node Anlagen
J. Immunol., May 1, 2009; 182(9): 5439 - 5445.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Peduto, S. Dulauroy, M. Lochner, G. F. Spath, M. A. Morales, A. Cumano, and G. Eberl
Inflammation Recapitulates the Ontogeny of Lymphoid Stromal Cells
J. Immunol., May 1, 2009; 182(9): 5789 - 5799.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H.-J. Ko, J.-Y. Yang, D.-H. Shim, H. Yang, S.-M. Park, R. Curtiss III, and M.-N. Kweon
Innate Immunity Mediated by MyD88 Signal Is Not Essential for Induction of Lipopolysaccharide-Specific B Cell Responses but Is Indispensable for Protection against Salmonella enterica serovar Typhimurium infection
J. Immunol., February 15, 2009; 182(4): 2305 - 2312.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Katakai, H. Suto, M. Sugai, H. Gonda, A. Togawa, S. Suematsu, Y. Ebisuno, K. Katagiri, T. Kinashi, and A. Shimizu
Organizer-Like Reticular Stromal Cell Layer Common to Adult Secondary Lymphoid Organs
J. Immunol., November 1, 2008; 181(9): 6189 - 6200.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S.-M. Park, H.-J. Ko, D.-H. Shim, J.-Y. Yang, Y.-H. Park, R. Curtiss III, and M.-N. Kweon
MyD88 Signaling Is Not Essential for Induction of Antigen-Specific B Cell Responses but Is Indispensable for Protection against Streptococcus pneumoniae Infection following Oral Vaccination with Attenuated Salmonella Expressing PspA Antigen
J. Immunol., November 1, 2008; 181(9): 6447 - 6455.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. F. R. Vondenhoff, G. E. Desanti, T. Cupedo, J. Y. Bertrand, A. Cumano, G. Kraal, R. E. Mebius, and R. Golub
Separation of splenic red and white pulp occurs before birth in a LT{alpha}{beta}-independent manner
J. Leukoc. Biol., July 1, 2008; 84(1): 152 - 161.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S.-Y. Chang, H.-R. Cha, O. Igarashi, P. D. Rennert, A. Kissenpfennig, B. Malissen, M. Nanno, H. Kiyono, and M.-N. Kweon
Cutting Edge: Langerin+ Dendritic Cells in the Mesenteric Lymph Node Set the Stage for Skin and Gut Immune System Cross-Talk
J. Immunol., April 1, 2008; 180(7): 4361 - 4365.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
T. Hashizume, A. Togawa, T. Nochi, O. Igarashi, M.-N. Kweon, H. Kiyono, and M. Yamamoto
Peyer's Patches Are Required for Intestinal Immunoglobulin A Responses to Salmonella spp.
Infect. Immun., March 1, 2008; 76(3): 927 - 934.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S.-Y. Chang, H.-R. Cha, S. Uematsu, S. Akira, O. Igarashi, H. Kiyono, and M.-N. Kweon
Colonic Patches Direct the Cross-Talk Between Systemic Compartments and Large Intestine Independently of Innate Immunity
J. Immunol., February 1, 2008; 180(3): 1609 - 1618.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. White, D. Carragher, S. Parnell, A. Msaki, N. Perkins, P. Lane, E. Jenkinson, G. Anderson, and J. H. Caamano
Lymphotoxin a-dependent and -independent signals regulate stromal organizer cell homeostasis during lymph node organogenesis
Blood, September 15, 2007; 110(6): 1950 - 1959.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. P. Matson, L. Zhu, E. G. Lingenheld, C. M. Schramm, R. B. Clark, D. M. Selander, R. S. Thrall, E. Breen, and L. Puddington
Maternal Transmission of Resistance to Development of Allergic Airway Disease
J. Immunol., July 15, 2007; 179(2): 1282 - 1291.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Nagai, H. Mimuro, T. Yamada, Y. Baba, K. Moro, T. Nochi, H. Kiyono, T. Suzuki, C. Sasakawa, and S. Koyasu
Role of Peyer's patches in the induction of Helicobacter pylori-induced gastritis
PNAS, May 22, 2007; 104(21): 8971 - 8976.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
K. Kiriya, N. Watanabe, A. Nishio, K. Okazaki, M. Kido, K. Saga, J. Tanaka, T. Akamatsu, S. Ohashi, M. Asada, et al.
Essential role of Peyer's patches in the development of Helicobacter-induced gastritis
Int. Immunol., April 1, 2007; 19(4): 435 - 446.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S.-f. Kwa, P. Beverley, and A. L. Smith
Peyer's Patches Are Required for the Induction of Rapid Th1 Responses in the Gut and Mesenteric Lymph Nodes during an Enteric Infection.
J. Immunol., June 15, 2006; 176(12): 7533 - 7541.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Nonaka, T. Naito, H. Chen, M. Yamamoto, K. Moro, H. Kiyono, H. Hamada, and H. Ishikawa
Intestinal {gamma}{delta} T Cells Develop in Mice Lacking Thymus, All Lymph Nodes, Peyer's Patches, and Isolated Lymphoid Follicles
J. Immunol., February 15, 2005; 174(4): 1906 - 1912.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. T. Taylor, A. Lugering, K. A. Newell, and I. R. Williams
Intestinal Cryptopatch Formation in Mice Requires Lymphotoxin {alpha} and the Lymphotoxin {beta} Receptor
J. Immunol., December 15, 2004; 173(12): 7183 - 7189.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Cupedo, M. F. R. Vondenhoff, E. J. Heeregrave, A. E. de Weerd, W. Jansen, D. G. Jackson, G. Kraal, and R. E. Mebius
Presumptive Lymph Node Organizers are Differentially Represented in Developing Mesenteric and Peripheral Nodes
J. Immunol., September 1, 2004; 173(5): 2968 - 2975.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Kang, B. DiBenedetto, K. Narayan, H. Zhao, S. D. Der, and C. A. Chambers
STAT5 Is Required for Thymopoiesis in a Development Stage-Specific Manner
J. Immunol., August 15, 2004; 173(4): 2307 - 2314.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Yamamoto, M.-N. Kweon, P. D. Rennert, T. Hiroi, K. Fujihashi, J. R. McGhee, and H. Kiyono
Role of Gut-Associated Lymphoreticular Tissues in Antigen-Specific Intestinal IgA Immunity
J. Immunol., July 15, 2004; 173(2): 762 - 769.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
T W Spahn and T Kucharzik
Modulating the intestinal immune system: the role of lymphotoxin and GALT organs
Gut, March 1, 2004; 53(3): 456 - 465.
[Full Text] [PDF]


Home page
JEMHome page
S. A. Luther, K. M. Ansel, and J. G. Cyster
Overlapping Roles of CXCL13, Interleukin 7 Receptor {alpha}, and CCR7 Ligands in Lymph Node Development
J. Exp. Med., May 5, 2003; 197(9): 1191 - 1198.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
M. Prinz, G. Huber, A. J. S. Macpherson, F. L. Heppner, M. Glatzel, H.-P. Eugster, N. Wagner, and A. Aguzzi
Oral Prion Infection Requires Normal Numbers of Peyer's Patches but Not of Enteric Lymphocytes
Am. J. Pathol., April 1, 2003; 162(4): 1103 - 1111.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Hagiwara, J. R. McGhee, K. Fujihashi, R. Kobayashi, N. Yoshino, K. Kataoka, Y. Etani, M.-N. Kweon, S. Tamura, T. Kurata, et al.
Protective Mucosal Immunity in Aging Is Associated with Functional CD4+ T Cells in Nasopharyngeal-Associated Lymphoreticular Tissue
J. Immunol., February 15, 2003; 170(4): 1754 - 1762.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
Y.-W. He
Orphan nuclear receptors in T lymphocyte development
J. Leukoc. Biol., September 1, 2002; 72(3): 440 - 446.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
G. Muller, U. E. Hopken, H. Stein, and M. Lipp
Systemic immunoregulatory and pathogenic functions of homeostatic chemokine receptors
J. Leukoc. Biol., July 1, 2002; 72(1): 1 - 8.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
N. Onai, M. Kitabatake, Y.-y. Zhang, H. Ishikawa, S. Ishikawa, and K. Matsushima
Pivotal role of CCL25 (TECK)-CCR9 in the formation of gut cryptopatches and consequent appearance of intestinal intraepithelial T lymphocytes
Int. Immunol., July 1, 2002; 14(7): 687 - 694.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. L. Browning and L. E. French
Visualization of Lymphotoxin-{beta} and Lymphotoxin-{beta} Receptor Expression in Mouse Embryos
J. Immunol., May 15, 2002; 168(10): 5079 - 5087.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
E. Alcamo, N. Hacohen, L. C. Schulte, P. D. Rennert, R. O. Hynes, and D. Baltimore
Requirement for the NF-{kappa}B Family Member RelA in the Development of Secondary Lymphoid Organs
J. Exp. Med., January 22, 2002; 195(2): 233 - 244.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Hamada, T. Hiroi, Y. Nishiyama, H. Takahashi, Y. Masunaga, S. Hachimura, S. Kaminogawa, H. Takahashi-Iwanaga, T. Iwanaga, H. Kiyono, et al.
Identification of Multiple Isolated Lymphoid Follicles on the Antimesenteric Wall of the Mouse Small Intestine
J. Immunol., January 1, 2002; 168(1): 57 - 64.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Yoshida, H. Kawamoto, S. M. Santee, H. Hashi, K. Honda, S. Nishikawa, C. F. Ware, Y. Katsura, and S.-I. Nishikawa
Expression of {alpha}4{beta}7 Integrin Defines a Distinct Pathway of Lymphoid Progenitors Committed to T Cells, Fetal Intestinal Lymphotoxin Producer, NK, and Dendritic Cells
J. Immunol., September 1, 2001; 167(5): 2511 - 2521.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. E. Mebius, T. Miyamoto, J. Christensen, J. Domen, T. Cupedo, I. L. Weissman, and K. Akashi
The Fetal Liver Counterpart of Adult Common Lymphoid Progenitors Gives Rise to All Lymphoid Lineages, CD45+CD4+CD3- Cells, As Well As Macrophages
J. Immunol., June 1, 2001; 166(11): 6593 - 6601.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Hashi, H. Yoshida, K. Honda, S. Fraser, H. Kubo, M. Awane, A. Takabayashi, H. Nakano, Y. Yamaoka, and S.-I. Nishikawa
Compartmentalization of Peyer's Patch Anlagen Before Lymphocyte Entry
J. Immunol., March 15, 2001; 166(6): 3702 - 3709.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
K. Honda, H. Nakano, H. Yoshida, S. Nishikawa, P. Rennert, K. Ikuta, M. Tamechika, K. Yamaguchi, T. Fukumoto, T. Chiba, et al.
Molecular Basis for Hematopoietic/Mesenchymal Interaction during Initiation of Peyer's Patch Organogenesis
J. Exp. Med., March 5, 2001; 193(5): 621 - 630.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
P. Hjelmström
Lymphoid neogenesis: de novo formation of lymphoid tissue in chronic inflammation through expression of homing chemokines
J. Leukoc. Biol., March 1, 2001; 69(3): 331 - 339.
[Abstract] [Full Text]


Home page
JEMHome page
D. Kim, R. E. Mebius, J. D. MacMicking, S. Jung, T. Cupedo, Y. Castellanos, J. Rho, B. R. Wong, R. Josien, N. Kim, et al.
Regulation of Peripheral Lymph Node Genesis by the Tumor Necrosis Factor Family Member Trance
J. Exp. Med., November 20, 2000; 192(10): 1467 - 1478.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
K. Laky, L. Lefrancois, E. G. Lingenheld, H. Ishikawa, J. M. Lewis, S. Olson, K. Suzuki, R. E. Tigelaar, and L. Puddington
Enterocyte Expression of Interleukin 7 Induces Development of {gamma}{delta} T Cells and Peyer's Patches
J. Exp. Med., May 1, 2000; 191(9): 1569 - 1580.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
T. Ikawa, H. Kawamoto, S. Fujimoto, and Y. Katsura
Commitment of Common T/Natural Killer (Nk) Progenitors to Unipotent T and Nk Progenitors in the Murine Fetal Thymus Revealed by a Single Progenitor Assay
J. Exp. Med., December 6, 1999; 190(11): 1617 - 1626.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
T. V. Golovkina, M. Shlomchik, L. Hannum, and A. Chervonsky
Organogenic Role of B Lymphocytes in Mucosal Immunity
Science, December 3, 1999; 286(5446): 1965 - 1968.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (105)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Yoshida, H.
Right arrow Articles by Nishikawa, S.-I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yoshida, H.
Right arrow Articles by Nishikawa, S.-I.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?