International Immunology

This Article Abstract FREE Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (34) Request Permissions Google Scholar Articles by Boccaccio, G. L. Articles by Steinman, L. Search for Related Content PubMed PubMed Citation Articles by Boccaccio, G. L. Articles by Steinman, L. Social Bookmarking          What's this?

International Immunology, Vol. 11, No. 2, 289-296, February 1999
© 1999 Japanese Society for Immunology

Non-coding plasmid DNA induces IFN- in vivo and suppresses autoimmune encephalomyelitis

Graciela L. Boccaccio¹, Felix Mor¹ and Lawrence Steinman^1,2

¹ The Weizmann Institute of Science, Department of Immunology, Rehovot 76100, Israel
² Department of Neurology and Neurological Sciences, Stanford University School of Medicine, Stanford, CA 94305–5429, USA

Correspondence to: L. Steinman, Department of Neurology and Neurological Sciences, Beckman B002, Stanford University School of Medicine, Stanford, CA 94305-5429, USA

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Regulatory sequences used in plasmids for naked DNA vaccination can modulate cytokine production in vivo. We demonstrate here that injection of plasmid DNA can suppress the prototypic T cell-mediated autoimmune disease, experimental autoimmune encephalomyelitis, by inducing IFN-.

Keywords: autoimmunity, cytokines, experimental autoimmune encephalomyelitis, gene therapy, multiple sclerosis, vaccination

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
DNA vaccination has been successful for immunization against infectious disease, for cancer immunotherapy and for treatment of autoimmune disease (1–3). DNA vaccination to TCR V_ß genes prevented the development of experimental autoimmune encephalomyelitis (EAE), which serves as a prototype for animal models of T cell-mediated autoimmunity. EAE serves as a model for human multiple sclerosis (MS), a demyelinating disease mediated by CD4⁺ T cells targeted to various myelin components.

The cellular and molecular mechanisms involved in immunization with naked DNA are not well understood. DNA vaccination allows targeting of the encoded antigen to distinct cytoplasmic domains, like the proteasome, the endoplasmic reticulum and the cytosol. Intracellular targeting may affect antigen processing and presentation of antigen. Therefore, the immunization by naked DNA offers a variety of possibilities to induce both MHC I- and MHC II-restricted responses, and to control the T_h1/T_h2 balance (3–5). Muscle cells and more conventional antigen-presenting cells like B cells and dendritic cells can be transfected in vivo by injected DNA (5). The immune response can be modulated by co-injection of cDNAs encoding cytokines or co-stimulatory molecules.

It was assumed that the critical factor in DNA vaccination would be the degree of expression of the foreign DNA; the more DNA-encoded antigen made by the body's cells, the greater the immune response to the antigen. This idea led to the design of vaccines composed of the DNA for the antigen attached to `promoter' DNA sequences that would enhance the degree of antigen expression by the cells taking up the vaccine. Surprisingly, however, it was found that stronger immune responses could be obtained by using bacterial DNA promoter sequences that actually stimulated less expression of the DNA-encoded antigen. Indeed, immunostimulatory sequences (ISS) containing CpG motifs have been reported to greatly increase the immunogenicity of DNA vaccines (4,6,7), providing that they are hypomethlylated (7). The molecular mechanism underlying this phenomena likely involves the stimulation of cytokine expression. In vitro analyses have shown that oligonucleotides carrying the motif 5'-PuPuCGPyPy-3' directly induce the expression of inflammatory cytokines, i.e. IFN-, -ß and -, and IL-12, IL-18 and IL-6 (4,7–11).

The CpG motif is critical for DNA vaccination because it is immunostimulatory. The six-membered sequence PuPuCpGPyPy has been shown to stimulate B cells to proliferate, to secrete IL-6 and IL-12, and to produce antibodies. This bacterial DNA motif activates macrophages to produce IL-12 and IFN-, -ß and -. These cytokines stimulate T cells and NK cells in a cascade of activity that augments the immune response to specific antigens and enhances the production of certain cytokines. In other words, the bacterial CpG sequence promotes and enhances the immune response to the foreign protein antigen encoded by the expressed portion of the DNA vaccine. We have exploited in these experiments the use of the CpG motif in the naked DNA vaccine, to enhance production of IFN-, which then suppresses EAE.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Animals and induction of EAE
Female Lewis rats between 4 and 8 weeks old were used. EAE was induced by injecting both hind foot pads with 50 µl containing 200 µg of the myelin basic protein (MBP) peptide 87–99 (VVHFFKNIVTPRT) and 100 µg Mycobacterium tuberculosis H37RA (Difco, Detroit, MI) emulsified in equal volumes of incomplete Freund's adjuvant and PBS. Severity of disease was graded as follows: 0, no clinical signs, +0.25, loss of the tip-of-tail reflex; +0.5, paralysis of posterior half of the tail; +1, complete paralysis of the tail; +1.5, incomplete paralysis of hind legs; +2, paralysis of hind legs; +3, paralysis extending to the thoracic spine.

T cell proliferation assay
Cell suspensions were prepared from lymph nodes and spleens by pressing the organs trough a fine wire mesh. Lymphocytes and splenocytes (2x10⁵/well) were cultured in 200 µl of DMEM supplemented with 100 U/ml penicillin, 100 mg/ml streptomycin, 0.25 mg/ml Fungizone (BioLab, Jerusalem, Israel), 1 mM sodium pyruvate, 2 mM glutamine and non-essential amino acids, 50 µM ß-mercaptoethanol (Fluka, Buchs, Switzerland), and 1% syngeneic normal serum (complete medium). After 3 days of culture in round-bottom 96-well plates (Nunc, Roskilde, Denmark) in the presence of variable amounts of MBP 87–99 or 1.25 µg/ml concanavalin A (Sigma Israel, Holon, Israel), cells were then pulsed during 16 h with 10 µCi [methyl-³H]thymidine (sp. act. 50 Ci/mmol; ICN Pharmaceuticals, Costa Mesa, CA), harvested and radioactivity was counted. Quadruplicates were performed for each antigen dilution.

Anti-MBP antibody levels
Rats were bled at different time points and sera was analyzed by ELISA. MaxiSorp immuno-plates (Nunc) were treated overnight at 4°C with PBS containing either 10 µg/ml of MBP 87–99 or 5 µg/ml of rat MBP or guinea pig MBP. After blocking with 1% skim milk in PBS, diluted sera were added. Plates were washed with 0.1% Tween in PBS and incubated with rabbit anti-rat antibody conjugated with peroxidase. After repeated washing, H₂O₂ and 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (Kirkegaard & Perry, Gaithersburg, MD) were added to develop the reaction. Absorbance at 405 nm was measured at different time points (5 min to 4 h) to obtain a linear response with sera dilution. Normal Lewis rat serum was used to measure the background signal.

Adoptive transfer of EAE
Splenocytes isolated at peak disease were incubated 48 h at a density of 4x10⁶ cell/ml in the presence of 1.25 µg/ml concanavalin A in complete DMEM. Thereafter cells were washed with PBS. Cells (5x10⁷) were injected i.p. into naive rats. Between two and three rats were injected with the suspension from a single spleen.

DNA preparation and injection
The plasmids pECE (12), MBPpECE (13), pcDNA3 (Invitrogen, San Diego, CA) and pBKNS were amplified in Escherichia coli XL-Blue or XL1-Blue MRF' strain. pBKNS was obtained by deletion of the NheI–SpeI fragment from the plasmid pBK-CMV (Stratagene, La Jolla, CA).

Large-scale plasmid preparation of plasmid DNA was performed using Qiagen Plasmid Mega Prep (Qiagen, Hilden, Germany) or Wizard Maxi or Mega Preps (Promega, Madison, WI). When indicated, DNA was treated with Triton X-114 (14). DNA was always ethanol-precipitated and redissolved in sterile PBS. Five days before DNA treatment, animals were injected under pentathol anesthesia into the tibialis anterior muscle with 100 µl of 10 µM snake cardiotoxin (Sigma, St Louis, MO) in PBS. Between 50 and 100 µl containing 25–50 µg of DNA was then injected in each leg at 7–10 day intervals. Three or four DNA injections were performed and 1 week afterwards, EAE was induced.

Phosphorothioaete oligonucleotides were obtained from PAN facility Beckman Center for Molecular and Genetic Medicine, Stanford University; 50 µg of each one was injected as above, on days –4, 0, +9 and +13 relative to induction of EAE. The oligonucleotide CG contains two 9mer segments from the pECE ß-lactamase gene including a CpG motif, and the oligonucleotide GC displays the same sequence with inverted motifs. Oligonucleotide CG: 5'-TCCATAACGTTGCAAACGTTCTG-3'. Oligonucleotide GC: 5'-TCCATAAGCTTGCAAAGCTTCTG-3'.

RNA extraction and cDNA synthesis
Lymphocytes were obtained as before and 5x10⁶ cells/ml were incubated in 24-well plates with complete medium in the presence of 10 µg/ml MBP 87–99 during 16–24 h. After washing in PBS, RNA was extracted with Tri Reagent (Molecular Research Center, Cincinnati, OH). RNA from 10⁷ lymph node cells (LNC) was resuspended in 20 µl of diethylpirocarbonate-treated water. Spinal cord was dissected at peak disease and the distal 3 cm used for RNA isolation. Spinal cord RNA was resuspended in a final volume of 100 µl. RNA quality and yield were tested in non-denaturing agarose gel electrophoresis.

RNA (2 µl) was mixed with 500 ng oligo-dT (Promega) and heated at 65°C during 10 min in a volume of 6 µl. Then 6 µl of 2xRT mix containing 2xRT buffer; 1 mM each dNTP; 2 U/µl RNasin and 20 U/µl reverse transcriptase M-MLV H^– (Promega) were added, and the reaction was performed at 42°C during 90 min followed by denaturation at 100°C during 10 min.

Semiquantitative RT-PCR
Specific primers for cytokines and housekeeping mRNAs were used to amplify cDNAs. Sequence and size were as follow: tumor necrosis factor (TNF)-, AGGAGGCGCTCCCCAAAAAGATGGG, GTACATGGGCTCATACCAGGGCTTG, 551 bp; IFN-, ATGAGTGCTACACGCCGCGTCTTGG, GAGTTCATTGACTTTGTGCTGG, 405 bp; transforming growth factor (TGF)-ß, GTGCCGTGAGCTGTGCAGGTGCTGG, CGACCCAGAGCCGGAGCCCGAAGCG, 549 bp; IL-10, GAGTGAAGCCAGCAAAGGC, TCGCAGCTGTATCCAGAGG, 329 bp, CD3, AGAGCAGCTGGCAAAGGTGGTGTC, TATGGCACTTTGAGAAACCTCCAT, 320 bp; GAPDH, CCCACGGCAAGTTCAACGG, CTTTCCAGAGGGGCCATCCA, 408 bp. All PCR reactions were as follow: denaturation during 10 min at 94°C followed by a variable number of cycles of 1 min at 94°C; 1 min at 65°C and 1 min at 72°C. An additional extension of 10 min at 72°C was performed. the number of cycles was 32 for IL-10 and TNF-, 34 for IFN-, 35 for TGF-ß, 30 for CD3, and 25 for GAPDH when analyzing LNC cDNAs. PCR reactions were performed in 20 µl containing 0.2 mM each dNTP; 1 µM each primer, 1xbuffer and 2 U of DynaZyme (Finnzymes, Espoo, Finland). For double PCR, 30 cycles were used. The concentration of IFN--specific oligonucleotides was adjusted to 2 µM.

PCR samples were analyzed in 2.5% agarose gels (1.5% NuSieve agarose, FMC BioProducts, Rockland, ME; 1% agarose, Talron, Rehovot, Israel), in Tris–acetate–EDTA (TAE) buffer containing ethidium bromide.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Bacterial plasmids prevent EAE
T cells specific for MBP 87–99 can be found in the brains of patients with MS (15–17). Injection of MBP 87–99 induces EAE in Lewis rats, with T cells found in rat brain bearing the same TCR V_ß CDR3 sequences as those found in humans with MS (15). We chose this model of EAE, because of the similarities with MS and asked whether cDNA vaccination with a gene encoding MBP could modulate EAE.

A plasmid carrying the cDNA for the murine 14 kDa MBP inserted into the plasmid pECE was used. The expression of MBP from this construct has been shown previously in distinct cell types, including oligodendrocytes (13) and was further confirmed in murine antigen-presenting cells (data not shown). This construct was used to perform DNA vaccination in Lewis rats, followed by induction of EAE with the MBP 87–99. Figure 1 shows that the incidence and the intensity of the disease on the vaccinated animals were significantly lower than in the control group. Surprisingly, a group of animals treated with the plasmid vector pECE, carrying no insert, also strongly protected from the disease (Fig. 1).

View larger version (20K): [in this window] [in a new window]   Fig. 1. pECE DNA protects from EAE. Lewis rats were induced with MBP 87–99 after four weekly injections of PBS (control), MBPpECE or pECE.

 
Table 1 shows the protective action of both pECE and MBPpECE in five different experiments. In all cases, treatment with those plasmids ameliorated the disease (experiments A–E in Table 1). The effect of other plasmids was likewise analyzed. pcDNA3 and pcDNA3 constructs carrying cDNAs for the rat V_ß8.2 and V_ß14, two non-relevant TCR in this model of EAE, conferred almost complete protection (experiments A and F in Table 1). A non-related plasmid, pBKNS, was protective to a lesser extent (experiment F in Table 1). A cumulative effect from multiple injections is likely to occur, since animals with four DNA injections at 10-day intervals (experiment B in Table 1) were protected to a larger extent than animals with three injections at weekly intervals (experiments A, C, D and E in Table 1). Furthermore, the protective effect of pECE and control plasmids was tested in animals that received only single doses of DNA, administered together with MBP 87–99 in complete Freund's adjuvant. In all cases, disease was comparable to that of control animals (not shown).

View this table: [in this window] [in a new window]   Table 1. Bacterial plasmids protect from MBP 87-99-induced EAE

 
The preventive action was also observed with plasmid DNA that was further purified by extraction with Triton X-114 (experiment H in Table 1). This detergent eliminates lipopolysaccharide from aqueous solutions (14). Furthermore, a mock preparation of plasmid DNA was prepared. This material containing a high proportion of E. coli DNA, and a small amount of both RNA and protein was tested as before. No protective effect was observed using this preparation (experiment G in Table 1) nor was protection achieved with a highly purified E. coli DNA (not shown). Finally, mammalian DNA was also analyzed. Calf thymus DNA did not influence the incidence of EAE (experiment H in Table 1). All these data strongly suggested that bacterial plasmids influence the immune response to MBP, thus preventing clinical manifestations of EAE. We therefore sought to analyze the mechanisms underlying this observation.

Immune response to MBP in DNA-treated animals
To analyze whether the capacity to mount an immune response against MBP peptides was altered in the protected animals, both the presence of T cells anti-MBP and the antibodies levels were evaluated at several time points during the disease. Similar levels of anti-MBP antibodies were detected in control and protected animals at both peak disease and after recovery (Fig. 2). The differences between the two groups observed at peak disease was comparable to the variation among individuals. Antibody levels were less variable at day 28, shortly after recovery from EAE. Those data indicate that the B cell response to the encephalitogen was normal.

View larger version (29K): [in this window] [in a new window]   Fig. 2. Protected animals showed normal levels of anti MBP-antibodies. Sera were analyzed at disease peak (15 days post-induction) or 1 week after recovery (28 days post-induction) by ELISA using MBP 87–99.

 
The proliferative response induced by MBP 87–99 in both LNC and splenocytes was analyzed at peak disease (day 15 post-induction) as shown in Fig. 3. LNC from pECE-treated rats (disease score 0) proliferated as strongly as LNC from sick animals (disease score 1–2). A strong proliferative response was also observed in splenocytes from protected animals (Fig. 3), where the stimulation appeared even higher than in the control group.

View larger version (21K): [in this window] [in a new window]   Fig. 3. Proliferation of LNC and splenocytes. Proliferative response was analyzed in LNC and splenocytes from three control animals (disease score 1, 1.5 and 1.5) and three pECE-treated rats (disease score 0). Animals were analyzed individually as indicated in Methods. Concanavalin A stimulation indexes ranged from 50 to 160 for LNC and from 50 to 200 for splenocytes.

 
Table 2 shows that the T cell reaction in the protected animals was detectable at latter stages. In contrast, very low T cell proliferation was observed in the control animals at the same time, when they were recovering. All these results indicate that strong B and T cell responses are elicited in the pECE-treated animals. However, no clinical manifestation of EAE occurred. Furthermore, the extent of the spinal cord infiltrate correlates with the intensity of the disease, being largely reduced in the protected animals (not shown).

View this table: [in this window] [in a new window]   Table 2. The LNC proliferative response against MBP remains elevated at later stages in pECE-treated animals

 
Passive transfer of EAE with cells from protected animals
The encephalitogenic capacity of T cell anti-MBP from protected animals was compared to that of sick animals. Naive Lewis rats injected with splenocytes from control, sick animals (score 1) developed a similar disease (score 1). In contrast, when naive rats were injected with splenocytes from pECE- or MBP-pECE-treated animals, the incidence of EAE was lower. Only one out of nine animals showed clinical manifestation of the disease (Fig. 4).

View larger version (14K): [in this window] [in a new window]   Fig. 4. Splenocytes from protected animals showed a reduced encephalitogenicity. Transference of splenocytes to naive animals was performed at day 16. Four or five rats per group were injected with cells from three or four donor animals.

 
Cytokine expression in LNC of protected rats
RT-PCR was performed in pooled samples of control (disease score 1 to 2) and pECE-treated animals (disease score 0) using CD3-specific primers for normalization. Levels of two anti-inflammatory cytokines, IL-10 and TGF-ß, were almost 5-fold higher in LNC from the protected rats (Fig. 5). In contrast, TNF- expression was slightly elevated in the sick animals. Surprisingly, IFN- appeared up-regulated in the protected animals. This was also observed in additional experiments where the analysis was performed at different times during disease (not shown). In addition, it was further confirmed by double-PCR analysis where the amount of IFN- mRNA relative to either CD3 or TGF-ß mRNA was assessed. Figure 6 shows a double PCR for both IFN- and CD3 in LNC from two protected animals (score 0) and two sick animals at peak disease (score 1 and 2.5). The level of IFN- mRNA relative to CD3 mRNA was higher in the pECE-treated rats. Moreover, the IFN-/TGF-ß balance is altered in the protected animals. Double PCR analysis of these cytokines performed in two separate experiments indicated that the IFN-/TGF-ß ratio in LNC from non-treated animals (disease score 2.5) was lower than in pECE-treated rats (disease score 0) (Fig. 7).

View larger version (31K): [in this window] [in a new window]   Fig. 5. The cytokine profile of protected animals differs from the control. LNC from three control and four protected animals were stimulated with MBP 87–99. RNAs from samples of similar proliferation index were pooled and submitted to RT-PCR.

 

View larger version (22K): [in this window] [in a new window]   Fig. 6. IFN- is elevated in LNC of protected animals. Double PCR for IFN- and CD3 was performed in LNC from two control (disease score 1 and 2.5) and two protected animals (score 0).

 

View larger version (21K): [in this window] [in a new window]   Fig. 7. The IFN-/TGF-ß balance is altered. Double PCR for IFN- and TGF-ß. LNC cDNAs pooled from control (C) and pECE-treated animals (P) were analyzed in two separate experiments.

 
Cytokine levels were analyzed in the central nervous system, using GAPDH specific primers for normalization (Fig. 8). The presence or absence of cytokine mRNAs in the spinal cord correlated with the abundance of T cells as judged by the intensity of the CD3 and the extent of the infiltrate (not shown). Indeed, IFN- (Fig. 8) and TGF-ß mRNAs and TNF- mRNA were readily detected in the spinal cord of sick animals, together with high levels of CD3 mRNA (not shown). In contrast, almost no signal for messengers encoding those cytokines was observed in five protected rats (Fig. 8) and, concomitantly, the level of CD3 mRNA was lower.

View larger version (51K): [in this window] [in a new window]   Fig. 8. IFN- is elevated in the CNS of sick animals. RT-PCR of RNAs from spinal cord of three control (disease score 2, 1 and 1) and five protected animals (score 0).

 
Synthetic oligonucleotides with ISS protect from EAE
All plasmids which demonstrated a significant protective capacity carry an ampicillin-resistance gene, where an ISS has been described to be present. Therefore, the effect of a phosphorothioate oligonucleotide carrying those ISS was analyzed. A control oligonucleotide was designed carrying the same sequence with an inverted CpG motif. Figure 9 shows that the animals injected with the oligonucleotide CG on days –4, 0, +9 and +13 relative to induction of EAE showed a milder disease than the group treated with the control oligonucleotide (P < 0.01). Furthermore, a pBKNS plasmid carrying a small insert with the sequence of the oligonucleotide CG had a mild protective effect (not shown).

View larger version (17K): [in this window] [in a new window]   Fig. 9. Aliquots of 50 µg of the relevant oligonucleotides were injected on days –4, 0, +9 and +13 relative to induction of EAE.

 

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
In the course of our studies on DNA vaccination on EAE in the Lewis rat we found that treatment with plasmid DNA carrying no insert abrogated the disease. The observation that non-coding plasmid DNA can influence the normal immune response to MBP to the extent that no autoimmune disease develops is remarkable. When looking at possible alterations of the immune response to the encephalitogen MBP 87–99, we found that vigorous B and T cell reactions occurred. Unlike the case of EAE, where the T cells decline after reaching a maximum during the disease period, the proliferative response of anti-MBP T cells remained elevated at later times in the protected rats. This probably suggests that the down-regulation of anti-MBP T cells is somehow impaired in the animals that did not develop EAE. In spite of the strong anti-MBP reaction mounted, no clinical manifestation of disease nor infiltration were observed. Furthermore, the encephalitogenic capacity of splenocytes from protected animals was largely reduced.

These results suggest a protective mechanism involving changes in the cytokine profile. Indeed, significant differences were observed when the expression of both anti-inflammatory and pro-inflammatory cytokines was analyzed in LNC. Both TGF-ß and IL-10 mRNAs appeared 5-fold elevated in the pECE-treated animals. The importance of those cytokines in recovery and treatment of EAE has been reported previously. In contrast, the expression of TNF-, a cytokine involved in the pathogenesis, was slightly reduced. Surprisingly, the levels of IFN- were augmented in anti-MBP T cells from protected animals.

IFN- is a pro-inflammatory cytokine whose role in EAE and MS is somehow contradictory. IFN- has both an inflammatory and a regulatory action. It activates macrophages and astrocytes, stimulating the expression of IL-1, TNF- and MHC II, thus inducing a cascade of inflammatory molecules (18). Indeed, the tissue-specific expression of IFN- promotes inflammation in several organs (19,20). Clinical trials have shown that IFN- has a deleterious effect in relapsing-remitting MS patients (21). The fact that IFN- is elevated in sick spinal cord points to its action as a pro-inflammatory cytokine, when acting locally and thus this agrees with the results of other authors [particularly Panitch et al. (21)]. Despite the fact that systemic administration of IFN- is protective in EAE, IFN- can induce MHC class II on astrocytes (33) and allow these glial cells to present myelin antigens to encephalitogenic T cells. While in EAE systemic administration of IFN- is protective, in MS administration of IFN- provokes exacerbations of disease (21).

Evidence that this cytokine may also exert beneficial effects is mainly derived from two lines of research: manipulation of IFN- levels by administration of the cytokine or specific mAb and studies on IFN- knockout animals. Heremans et al. (22) have shown that EAE is enhanced by systemic administration of anti-IFN- antibodies and that treatment with IFN- reduces morbidity and mortality in mice. Likewise, Voorthuis et al. (23) reported that intraventricular injection of IFN- inhibits EAE in rats and systemic anti-IFN- exacerbates the disease. In addition, administration of encephalitogenic T cells together with anti-IFN- antibodies greatly exacerbates disease, whereas antibodies against other pro-inflammatory cytokines like IL-2 have the opposite effect (24).

A second line of evidence of the beneficial regulatory action of IFN- derives from the work done with knockout mice. We have shown (25) that EAE develops with higher mortality in animals carrying a disrupted IFN- gene. Moreover, recent reports indicate that the IFN- and the IFN- receptor genes confer resistance to EAE. Indeed, the BALB/c mouse strain is normally refractory to the disease, but it is converted to a susceptible phenotype when the IFN- gene is disrupted (26). Likewise, the 129/Sv mice are resistant to myelin oligodendrocyte glycoprotein-induced EAE, but they develop a disease with high morbidity and mortality when lacking the gene coding for the ligand-binding chain of the IFN- receptor (27).

Our data strongly suggest that the protection provoked by plasmid DNA is likely mediated by IFN-. In the repeated analysis by RT-PCR that we performed, we found that the elevation of IFN- was consistently associated with suppression of EAE. However, the participation of the elevated levels of the anti-inflammatory cytokines IL-10 and TGF-ß in protection may be important, and may synergize with IFN-. Anti-IFN- worsens EAE in our laboratory [see fig. 1A and table 1 in (34), and in a number of cited studies (22–24)].

It has been reported that certain DNA sequences can stimulate the secretion of this and others cytokines. In vitro experiments have shown that either single-strand or double-strand oligonucleotides carrying the motifs AACGTT (I), AGCGCT (II), GACGTC (III), AACGCT (IV) or GACGTT (V) induce the expression of IL-12, IL-6, and IFN-, -ß and - in macrophages, T cells and B cells (7,11,28,29). Those hypomethylated CpG motifs present in plasmids or in short oligonucleotides have a potent adjuvant effect in vivo (6,7,30).

Two copies of the motif I and a single copy of motifs II and V are present in pECE. Likewise, pCDNA3 contains 11 copies of those CpG motifs. Therefore, it is likely that those plasmid sequences up-regulate IFN-, thus triggering a protective mechanism. Indeed, a synthetic oligonucleotide carrying the motifs AACGTT protected from the disease, whereas a similar oligonucleotide with the sequence AAGCTT did not (Fig. 9). The fact that bacterial DNA affects autoimmunity is not unexpected. Segal et al. (31) have recently shown that quiescent T cells specific for MBP are converted to an encephalitogenic phenotype, when exposed to bacterial DNA or oligonucleotides containing CpG motifs in vitro. In contrast, the present data show that the outcome of the immunomodulatory capacity of bacterial DNA can be quite the opposite, with suppression of EAE, when assessed in vivo. Similarly, a recent report by Gilkeson et al. (32) shows that bacterial DNA ameliorates autoimmunity in NZB/NZW mice.

	Acknowledgments

 
We thank Edgar Stibbe for technical assistance, and Drs David Colman and Susan Staugaitis for providing the plasmids used in this work. This work was supported by the National Institutes of Health. This work was supported by grants from the National Institutes of Health and by the National Multiple Sclerosis Society. G. L. B. was supported by a Weizmann-Campomar Cooperation Program Fellowship.

	Abbreviations

 

EAE	experimental autoimmune encephalomyelitis
ISS	immunostimulatory sequences
MS	multiple sclerosis
MBP	myelin basic protein
LNC	lymph node cells
TGF	transforming growth factor
TNF	tumor necrosis factor

	Notes

 
Transmitting editor: R. Hardy

Received 8 May 1998, accepted 22 October 1998.

	References

Top Abstract Introduction Methods Results Discussion References

 

1. Ulmer, J. B., Donnelly, J. J., Parker, S. E., Rhodes, G. H., Felgner, P. L., Dwarki, V. J., Gromkowski, S. H., Deck, R. R., DeWitt, C. M. and Friedman, A. 1993. Heterologous protection against influenza by injection of DNA encoding a viral protein. Science 259:1745.[Abstract/Free Full Text]
2. Donnelly, J. J., Ulmer, J. B., Shiver, J. W. and Liu, M. A. 1997. DNA vaccines. Annu. Rev. Immunol. 15:617.[Web of Science][Medline]
3. Waisman, A., Ruiz, P. J., Hirschberg, D. L., Gelman, A., Oksenberg, J. R., Brocke, S., Mor, F., Cohen, I. R. and Steinman, L. 1996. Suppressive vaccination with DNA encoding a variable region gene of the T cell receptor prevents autoimmune encephalomyelitis and activates T_h2 immunity. Nature Med. 2:899.[Web of Science][Medline]
4. Raz, E., Tighe, H., Sato, Y., Corr, M., Dudler, J. A., Roman, M., Swain, S. L., Spiegelberg, H. L. and Carson, D. A. 1996. Preferential induction of a T_h1 immune response and inhibition of specific IgE antibody formation by plasmid DNA immunization. Proc. Natl Acad. Sci. USA. 93:5141.[Abstract/Free Full Text]
5. Cohen, I. R. and Steinman, L. 1997. The potential of DNA vaccination. Hospital Practice 32:169.
6. Sato, Y., Roman, M., Tighe, H., Lee, D., Corr, M., Nguyen, M. D., Silverman, G. J., Lotz, M., Carson, D. A. and Raz, E. 1996. Immunostimulatory DNA sequences necessary for effective intradermal gene immunization. Science 273:352.[Abstract]
7. Klinman, D. M., Yamshchikov, G. and Ishigatsubo, Y. 1997. Contribution of CpG motifs to the immunogenicity of DNA vaccines. J. Immunol. 158:3635.[Abstract]
8. Pisetsky, D. S. 1996. Immune activation by bacterial DNA: a new genetic code. Immunity 5:303.[Web of Science][Medline]
9. Halpern, M. D., Kurlander, R. J. and Pisetsky, D. S. 1996. Bacterial DNA induces murine interferon- production by stimulation of interleukine 12 and tumor necrosis factor-. Cell. Immunol. 167:72.[Web of Science][Medline]
10. Yi, A. K., Klinman, D. M., Martin, T. L., Matson, S. and Krieg, A. M. 1996. Rapid immune activation by CpG motifs in bacterial DNA. Systemic induction of IL-6 transcription through an antioxidant-sensitive pathway. J. Immunol. 157:5394.[Abstract]
11. Roman, M., Martin-Orozco, E., Goodman, J. S., Nguyen, M. D., Sato, Y., Ronaghy, A., Kornbluth, R. S., Richman, D. D., Carson, D. A. and Raz, E. 1997. Immunostimulatory sequences function as T helper-1-promoting adjuvants. Nature Med. 3:849.[Web of Science][Medline]
12. Ellis, L., Clauser, E., Morgan, D. O., Edery, M., Roth, R. A. and Rutter, W. J. 1986. Replacement of the insulin receptor tyrosine 1162 and 1163 compromises insulin stimulated kinase activity and uptake of 2-deoxiglucose. Cell 45:721.[Web of Science][Medline]
13. Pedraza, L., Fidler, L., Staugaitis S. M. and Colman, D. 1997. The active transport of myelin basic protein into the nucleus suggests a regulatory role in myelination. Neuron 18:579.[Web of Science][Medline]
14. Aida, Y. and Pabst, M. J. 1990. Removal of endotoxin from protein solutions by phase separation using Triton X-114. J. Immunol. Methods 132:191.[Web of Science][Medline]
15. Oksenberg, J. R., Stuart, S., Begovich, A. B., Bell, R. B., Erlich, H. A., Steinman, L. and Bernard, C. C. 1990. Limited heterogeneity of rearranged T-cell receptor V alpha transcripts in brains of multiple sclerosis patients. Nature 345:344.[Medline]
16. Brocke, S., Gijbels, K., Allegretta, M., Ferber, I., Piercy, C., Blankenstein, T., Martin, R., Utz, U., Karin, N., Mitchell, D., Veromaa, T., Waisman, A., Gaur, A., Conlon, P., Ling, N., Fairchild, P. J., Wraith, D. C., O'Garra, A., Fathman, C. G. and Steinman, L. 1996. Treatment of experimental encephalomyelitis with a peptide analogue of myelin basic protein. Nature 379:343.[Medline]
17. Steinman, L. 1996. Multiple sclerosis: a coordinated immunological attack against myelin in the central nervous system. Cell 85:299.[Web of Science][Medline]
18. Renno, T., Krakowski, M., Piccirillo, C., Lin, J. Y. and Owens, T. 1995. TNF-alpha expression by resident microglia and infiltrating leukocytes in the central nervous system of mice with experimental allergic encephalomyelitis. Regulation by Th1 cytokines. J. Immunol. 154:944.[Abstract]
19. Horwitz, M. S., Evans, C. F., McGavern, D. B., Rodriguez, M. and Oldstone, M. B. A. 1997. Primary demyelination in transgenic mice expressing interferon-. Nature Med. 3:1037.[Web of Science][Medline]
20. Sethna, M. P. and Lampson, L. A. 1991. Immune modulation within the brain: recruitment of inflammatory cells and increased major histocompatibility antigen expression following intracerebral injection of interferon-gamma. J. Neuroimmunol. 34:121.[Web of Science][Medline]
21. Panitch, H. S., Hirsch, R. L., Schindler, J. and Johnson, K. P. 1987. Treatment of multiple sclerosis with gamma-interferon: exacerbations associated with activation of the immune system. Neurology 37:1097.[Abstract/Free Full Text]
22. Heremans, H., Dillen, C., Groenen, M., Marten, E. and Billau, A. 1996. Chronic relapsing experimental autoimmune encephalomyelitis (CREAE) in mice: enhancement by monoclonal antibodies against IFN-gamma. Eur. J. Immunol. 26:2393.[Web of Science][Medline]
23. Voorthuis, J. A., Uitdehaag, B. M., De Groot, C. J., Goede, P. H., van der Meide, P. H. and Dijkstra, C. J. 1990. Suppression of experimental allergic encephalomyelitis by intraventricular administration of interferon-gamma in Lewis rats. Clin. Exp. Immunol. 81:183.[Web of Science][Medline]
24. Duong, T. T., Finkelman, F., Singh, B. and Strejan, G. H. 1992. Effect of anti-interferon-gamma monoclonal antibody treatment on the development of experimental allergic encephalomyelitis in resistant mouse strains. J. Neuroimmunol. 53:101.
25. Ferber, I., Brocke, S., Taylor-Edwards, C., Ridgway, W., Dinisco, C., Steinman, L., Dalton, D. and Fathman, C. G. 1996. Mice with a disrupted IFN- gene are susceptible to the induction of experimental autoimmune encephalomyelitis (EAE). J. Immunol. 156:5.[Abstract]
26. Krakowski, M. and Owens, T. 1996. Interferon- confers resistance to experimental allergic encephalomyelitis. Eur. J. Immunol. 26:1641.[Web of Science][Medline]
27. Willenborg, D. O., Fordham, S., Bernard, C. C. A., Cowden, W. A. and Ramshaw, I. A. 1996. IFN- plays a critical down-regulatory role in the induction and effector phase of myelin oligodendrocyte glycoprotein-induced autoimmune encephalomyelitis. J. Immunol. 157:3223.[Abstract]
28. Yamamoto, S., Yamamoto, T., Kataoka, T., Kuramoto, E., Yano, O. and Tokunaga, T. 1992. Unique palindromic sequences in synthetic oligonucleotides are required to induce IFN (correction of INF) and augment IFN-mediated (correction of INF) natural killer activity. J. Immunol. 148:4072.[Abstract]
29. Krieg, A. M., Yi, A.-K., Matson, S., Waldschmidt, T. J., Bishop, G. A., Teasdale, R., Koretzky, G. A. and Klinman, D. 1995. CpG motifs in bacterial DNA trigger direct B cell activation. Nature 374:546.[Medline]
30. Chu, R. S., Targoni, O. S., Krieg, A. M., Lehmann, P. V. and Harding, C. V. 1997. CpG oligodeoxynucleotides act as adjuvants that switch on T helper 1 (T_h1) Immunity. J. Exp. Med. 186:1623.[Abstract/Free Full Text]
31. Segal, B. M., Klinman, D. M. and Shevach, D. M. 1997. Microbial products induce autoimmune disease by an IL-12-dependent pathway. J. Immunol. 158:5087.[Abstract]
32. Gilkeson, G. S., Ruiz, P., Pippen, A. M. M., Alexander, A. L., Lefkowith, J. B. and Pisetsky, D. S. 1996. Modulation of renal disease in autoimmune NZB/NZW mice by immunization with bacterial DNA. J. Exp. Med. 183:1389.[Abstract/Free Full Text]
33. Fierz, W., Endler, B., Reske, K., et al. 1985. Astrocytes as antigen-presenting cells. I. Induction of Ia antigen expression in astrocytes by T cells via immune interferon and its effect on antigen presentation. J. Immunol. 134:3785.[Abstract]
33. Gijbels, K., Brocke, S., Abrams, J. and Steinman, L. 1995. Administration of neutralizing antibodies to IL-6 reduces EAE and is associated with elevated levels of IL-6 bioactivity in central nervous system and circulation. Mol. Med. 1:795.[Web of Science][Medline]

CiteULike    Connotea    Del.icio.us    What's this?

This article has been cited by other articles:

				J. T. Tigno-Aranjuez, R. Jaini, V. K. Tuohy, P. V. Lehmann, and M. Tary-Lehmann Encephalitogenicity of Complete Freund's Adjuvant Relative to CpG Is Linked to Induction of Th17 Cells J. Immunol., November 1, 2009; 183(9): 5654 - 5661. [Abstract] [Full Text] [PDF]

				B. J. Marsh, S. L. Stevens, B. Hunter, and M. P. Stenzel-Poore Inflammation and the Emerging Role of the Toll-Like Receptor System in Acute Brain Ischemia Stroke, March 1, 2009; 40(3_suppl_1): S34 - S37. [Abstract] [Full Text] [PDF]

				A. M. Krieg Antiinfective Applications of Toll-like Receptor 9 Agonists Proceedings of the ATS, July 1, 2007; 4(3): 289 - 294. [Abstract] [Full Text] [PDF]

				Y. Okura, A. Miyakoshi, K. Kohyama, I.-K. Park, M. Staufenbiel, and Y. Matsumoto Nonviral Abeta DNA vaccine therapy against Alzheimer's disease: Long-term effects and safety PNAS, June 20, 2006; 103(25): 9619 - 9624. [Abstract] [Full Text] [PDF]

				P. P. Ho, P. Fontoura, P. J. Ruiz, L. Steinman, and H. Garren An Immunomodulatory GpG Oligonucleotide for the Treatment of Autoimmunity via the Innate and Adaptive Immune Systems J. Immunol., November 1, 2003; 171(9): 4920 - 4926. [Abstract] [Full Text] [PDF]

				F. J. Quintana, A. Rotem, P. Carmi, and I. R. Cohen Vaccination with Empty Plasmid DNA or CpG Oligonucleotide Inhibits Diabetes in Nonobese Diabetic Mice: Modulation of Spontaneous 60-kDa Heat Shock Protein Autoimmunity J. Immunol., December 1, 2000; 165(11): 6148 - 6155. [Abstract] [Full Text] [PDF]

				A. Lobell, R. Weissert, S. Eltayeb, C. Svanholm, T. Olsson, and H. Wigzell Presence of CpG DNA and the Local Cytokine Milieu Determine the Efficacy of Suppressive DNA Vaccination in Experimental Autoimmune Encephalomyelitis J. Immunol., November 1, 1999; 163(9): 4754 - 4762. [Abstract] [Full Text] [PDF]

This Article Abstract FREE Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (34) Request Permissions Google Scholar Articles by Boccaccio, G. L. Articles by Steinman, L. Search for Related Content PubMed PubMed Citation Articles by Boccaccio, G. L. Articles by Steinman, L. Social Bookmarking          What's this?

Online ISSN 1460-2377 - Print ISSN 0953-8178

Copyright © 2010 Japanese Society for Immunology

Oxford Journals Oxford University Press

• Site Map
• Privacy Policy
• Frequently Asked Questions

Other Oxford University Press sites: Oxford University Press Oxford Journals China Oxford Journals Japan American National Biography Booksellers' Information Service Children's Fiction and Poetry Children's Reference Corporate & Special Sales Dictionaries Dictionary of National Biography Digital Reference English Language Teaching Higher Education Textbooks Humanities International Education Unit Law Medicine Music Online Products Oxford English Dictionary Reference Rights and Permissions Science School Books Social Sciences Very Short Introductions World's Classics