Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (16)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Toyo-oka, K.
Right arrow Articles by Fujiwara, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Toyo-oka, K.
Right arrow Articles by Fujiwara, H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 11, No. 12, 2043-2052, December 1999
© 1999 Japanese Society for Immunology

Association of a tetraspanin CD9 with CD5 on the T cell surface: role of particular transmembrane domains in the association

Kazuhito Toyo-oka, Yumi Yashiro-Ohtani, Cheung-Seog Park, Xu-Guang Tai, Kensuke Miyake1, Toshiyuki Hamaoka and Hiromi Fujiwara

Department of Oncology, Biomedical Research Center, Osaka University Graduate School of Medicine 2-2, Yamada-oka, Suita, Osaka 565-0871, Japan
1 Saga Medical College, Saga 849-0937, Japan

Correspondence to: H. Fujiwara


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
CD9 is a member of the tetraspanin superfamily which is characterized by four transmembrane (TM) domains and associates with other surface molecules. This tetraspanin was recently found to be expressed on mature T cells. Here, we investigated which molecules associate with CD9 on T cells and which CD9 domains are required for the association. Immunoprecipitation of T cell lysates with anti-CD9 mAb followed by immunoblotting with mAb against various T cell molecules showed the association of CD9 with CD3, CD4, CD5, CD2, CD29 and CD44. Because association with CD5 was most prominent, we determined the role of CD9 TM or extracellular (EC) domains in the association with CD5. CD9 mutant genes lacking each domain were constructed and introduced into EL4 thymoma cells deficient in CD9 but expressing CD5. Among various types of stable EL4 transfectants, EL4 transfected with the mutant gene lacking TM domains (TM2/TM3) between two EC domains expressed a small amount of the relevant protein without showing association with CD5. CD9CD5 monkey COS-7 cells transfected with this mutant gene and the CD5 gene expressed both transfected gene products, but the association of these was not detected. EL4 cells transfected with a CD9/CD81 chimera gene (the CD9 gene containing TM2/TM3 of CD81) expressed the chimeric protein on the cell surface and showed association with CD5. These results suggest an essential role of particular CD9 TM domains in the surface expression of the CD9 molecule as well as the association with CD5.

Keywords: CD5, CD9, transmembrane region


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Molecules in the tetraspanin superfamily are characterized by four transmembrane (TM) domains that delimit two extracellular (EC) and three short cytoplasmic regions (reviewed in 1,2). Another feature of the tetraspanins is that most of the members exhibit a flair for promiscuous associations with various surface molecules. In lymphoid cells, the tetraspanin-associated molecules include CD2 (3), CD4/CD8 (4), CD19/CD21 (5,6), integrins (7,8), MHC antigens (8) and other tetraspanins (8). Tetraspanins have been considered to be involved in diverse cell events such as cell activation, differentiation, adhesion and mobility (1,2). Considering that short cytoplasmic domains of tetraspanin members are insufficient to deliver a signal, their association with the above molecules is predicted to have biological significance.

CD81 and CD82 are the functionally well-analyzed tetraspanins among those expressed on B and T cells, and they have been described to deliver a co-stimulatory signal (911). Regarding the association with other molecules, CD81 on B cells forms a functional complex with CD19 and CD21 which potentiates the activation of B cells by surface Ig receptor (5,6). Recently, we have shown that on the T cell there exists a tetraspanin co-stimulatory molecule other than CD81 and CD82 (12). We developed a mAb capable of reacting with CD9 (12). Whereas CD9 was not previously detected on the T cell, our study demonstrated that this anti-CD9 mAb reacts with almost all mature T cells and that ligation with the anti-CD9 mAb results in the generation of a potent CD28-independent co-stimulatory signal (12). It is, however, unknown which molecules associate with CD9 to mediate the capacity of CD9 to co-stimulate T cells.

The present study investigated whether CD9 associates with any T cell molecules capable of exhibiting biological functions and, if so, which domains of CD9 are required for the association. The results show that CD9 associates with various T cell functional molecules including a co-stimulatory molecule CD5. By constructing mutant CD9 genes lacking various domains and introducing these into CD9 cell lines, TM domains existing between two EC domains of CD9 were shown to have an essential role in the surface expression of the CD9 molecule and its association with CD5. This study suggests a mechanism by which CD9 without functional cytoplasmic domains exhibits its biological functions in the T cell.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
A purified T cell population and cell lines
A mouse T cell population was prepared from C57BL/6 (B6) mouse lymph node cells by depleting B cells and Ia+ antigen-presenting cells as previously described (12). A mouse thymoma cell line EL4, a mouse thymic stromal cell line MRL104.8a (13) and a monkey kidney cell line COS-7 were used. EL4, MRL104.8a and COS-7 cells were maintained by culturing in RPMI 1640 (EL4) or DMEM (MRL104.8a and COS-7) supplemented with 10% FBS.

Reagents
Anti-CD9 (9D3) (12), anti-CD9 (KMC8) (14), anti-CD5 (53-7-313) (15), anti-CD3 (145-2C11) (16) and anti-CD4 (GK1.5) (ATCC, Rockville, MD) mAb were purified from ascitic fluids or culture supernatants of the relevant hybridoma cells. Anti-influenza hemagglutinin (HA) (12CA5) and anti-CD81 (2F7) mAb were purchased from Boehringer Mannheim (Mannheim, Germany) and PharMingen (San Diego, CA) respectively.

Plasmids and cDNAs
The mouse CD9 cDNA (12) cloned in pMV2 was first subcloned in the pBluescript plasmid (Stratagene, La Jolla, CA) at the BamHI–NotI restriction sites and then in pMKIT-neo expression vector (kindly provided by Dr Kazuo Maruyama, Tokyo Medical and Dental University, School of Medicine, Tokyo) between the XhoI and NotI sites. The mouse CD5 cDNA was directly amplified from mouse thymocyte mRNA by reverse transcription and PCR with primers CGGGATCCTCCATGGACTCCCACGAAGTGCTG and GCTCTAGATTACAGTCTCTGAGCCACTTGCAGG, subcloned into the XbaI–EcoRV sites of pBluescript plasmid, and then cloned into the XhoI–NotI restriction sites of pMKIT-neo expression vector. The mouse CD81 cDNA was amplified from EL4 mRNA by reverse transcription and PCR with primers GGAATTCCACCGTGGGGGTGGAGGGCTGCACCAAATGCand CGGGATCCCGTCAGTACACGGAGCTGTTCCGGATGCC,and cloned into the EcoRI–BamHI sites of pBluescript.

Construction of CD9-deletion mutants
CD9-deletion mutant genes lacking each region of the CD9 gene, but instead containing the HA epitope tag in the deleted region (Fig. 1Go), were constructed according to the PCR-based overlap extension method previously described (17). The following oligonucleotide primers were used: Primer-1, GGAATTCCATGCCGGTCAAAGGAGGTAG; Primer-2, AGCGTAATCCGGAACATCGTATGGGTACACCTCATCCTTGTGGGT; Primer-3, TACCCATACGATGTTCCGGATTACGCTAACAACAAGTTCCACATC; Primer-4, CGGGATCCCGCTAGACCATTTCTCGGCTCC; Primer-5, AGCGTAATCCGGAACA-TCGTATGGGTACCCGGGAGCGTAATCCGGAACATCG-TATGGGTA; Primer-6, TACCCATACGATGTTCCGGATTACGCTGGTACCTACCCATACGATGTTCCGGATTACGCT; Primer-7, TACCCATACGATGTTCCGGATTACGCTGACTCTCAGACCAAG; Primer-8, GGAATTCCATGTACCCATACGATGTTCCGGATTACGCT; Primer-9, AGCGTAATCCGGAACATCGTATGGGTAGAACTTGTTGTTGAA; Primer-10, CGGGATCCCGCTAAGCGTAATCCGGAACATCGTATGGGTA; Primer-11, AGCGTAATCCGGAACATCGTATGGGTAGAATCGGAGCCATAGTCC; Primer-12, TACCCATACGATGTTCCGGATTACGCTTCCAGTTTCTACACAGGA; Primer-13, AGCGTAATCCGGAACATCGTATGGGTAACTGGAATGGTTATTCTC; and Primer-14, TACCCATACGATGTTCCGGATTACGCTCACAAGGATGAGGTGATT. Each mutant was deleted of the following region: Mutant-1 (MT1), sequences 346–561; Mutant-2 (MT2), sequences 112–152; Mutant-3 (MT3), sequences 4–111; Mutant-4 (MT4), sequences 160–329; and Mutant-5 (MT5), sequences 574–681.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 1. A schematic diagram of CD9-deletion mutant and CD9/CD81 chimeric genes. The construction of mutant and chimeric genes is described in details in Methods.

 
The construction of MT1 was done by three steps of PCR. First, two separate PCR reactions were set up on the CD9/pBluescript plasmid using the following two primer pairs: Primer-1 containing the restriction site EcoRI at the 5' end and Primer-2 containing the HA epitope tag at the 3' end (first pair), and Primer-3 containing the HA epitope tag at the 5' end and Primer-4 containing the restriction site BamHI at the 3' end (second pair). The resulting PCR products were gel purified, and the second step of two separate PCR were performed for the purified first PCR product and the following primers: Primer-1 and Primer-5 containing two copies of HA epitope tag at the 3' end (first pair), and Primer-6 containing two copies of HA epitope tag at the 5' end and Primer-4 (second pair). The second PCR products were gel purified, and the third PCR was performed for the purified second PCR product and Primer-1 and Primer-4. The third PCR product was gel purified and digested by EcoRI and BamHI and ligated into pBluescript plasmid. MT2 and MT4 were constructed similarly by three steps of PCR reactions using the following primers. For MT2, the first step of PCR: Primer-1, Primer-11, Primer-12 and Primer-4; the second step of PCR: Primer-1, Primer-5, Primer-6 and Primer-4; and the third step of PCR; Primer-1 and Primer-4. For MT4, the first step of PCR: Primer-1, Primer-13, Primer-14 and Primer-4; the second step of PCR: Primer-1, Primer-5, Primer-6 and Primer-4; and the third step of PCR: Primer-1 and Primer-4.

For the construction of MT3, the first PCR was set up on the CD9/pBluescript plasmid using Primer-7 containing the HA epitope tag at the 5' end and Primer-4. The resulting PCR product was gel purified and the second PCR was performed using the purified first PCR product and Primer-6 and Primer-4. The second PCR product was gel purified and the third PCR was performed using the purified second PCR product and Primer-8 containing the start codon (ATG) and the HA epitope tag at the 5' end and Primer-4.

For the construction of MT5, the first PCR was set up on the CD9/pBluescript plasmid using Primer-1 and Primer-9 containing the HA epitope tag at the 3' end. The resulting PCR product was gel purified and the second PCR was performed using the purified first PCR product and Primer-1 and Primer-5. The second PCR product was gel purified and the third PCR was performed using the purified second PCR product and Primer-1 and Primer-10 containing the HA epitope tag and the stop codon (TAG) at the 3' end.

For transfection, all deletion mutants in pBluescript were digested by EcoRI and NotI and ligated into pMKIT-neo expression plasmid. The inclusion of three copies of HA epitope tag in all deletion mutants was confirmed by sequencing. All plasmids were purified by Qiagen Plasmid Maxi Kit (Qiagen, Valencia, CA).

Construction of CD9/CD81 chimeric molecules
CD9/CD81 chimera genes were also constructed according to the PCR-based overlap extension method (17). The procedure was essentially the same as that for CD9-deletion mutants. The following oligonucleotide primers were prepared by referring to a previous report (18). CD9/CD81 Chimera-a: Primer-1; Primer-15, 5'-CD81/GCTCCCACAGCAATGAGAAT/ACTGGAATGGTTATTCTCTT/CD9-3'; Primer-16, 5'-CD9/AA-GAGAATAACCATTCCAGT/ATTCTCATTGCTGTGGGAGC/CD81-3'; Primer-17, 5'-CD9/TTAATCACCTCATCCTTGTG/TACGAAGCCCCAGATGCCTG/CD81-3'; Primer-18, 5'-CD81/ CAGGCATCTGGGGCTTCGTA/CACAAGGATGAGGTGATTAA/CD9–3'; and Primer-4. CD9/CD81 Chimera-b: Primer-1, Primer-19, 5'-CD9/TCAACAACAAGTTCCACATC/CTGTACCTCATTGGAATTGC/CD81-3'; Primer-20, 5'-CD81/GCAATTCCAATGAGGTACAG/GATGTGGAACTTGTTGTTGA/CD9–3'; and Primer-16. The substitution of the relevant region in chimera genes was confirmed by sequencing.

Immunofluorescence and flow cytometry
Cells (1x106) were directly stained with phycoerythrin (PE)-labeled anti-CD5 (PharMingen). The surface expression of CD9 and CD81 was analyzed by staining with anti-CD9 (9D3) or anti-CD81 (2F7). Anti-CD9-stained or anti-CD81-stained cells were incubated with biotinylated mouse anti-rat IgG (Jackson ImmunoResearch, West Grove, PA) followed by PE-conjugated streptavidin (Becton Dickinson, San Jose, CA) or FITC-labeled goat anti-hamster IgG (Jackson ImmunoResearch) respectively. Cells were analyzed on a FACSCalibur (Becton Dickinson).

Transfection
The stable transfection of EL4 cells was carried out as previously described (19). Briefly, cells (7.5x 106) in 0.75 ml of PBS were mixed with 15 µg of DNA in a 0.4 cm cuvette (BioRad, Richmond, CA), placed on ice for 15 min, and subjected to an electric field of 300 V and capacitance of 960 µF with a Gene Pulser (BioRad). The cells were immediately placed on ice for 5 min, and cultured in RPMI 1640 medium supplemented with 10% FBS and 2-mercaptoethanol at 100 mm culture dishes in a humidified atmosphere of 5% CO2 at 37°C for 3 days. Then cells (1x104) were selected with 0.5 mg/ml G418 (Gibco/BRL, Rockville, MD). The resistant clones appeared after 2 weeks. Five clones for each mutant gene were obtained. COS-7 cells were transiently transfected using TransFast Transfection Reagent (Promega, Madison, WI) according to the instructions of the manufacturer. Briefly, cells (5x105) were seeded in 60 mm dishes in 4 ml of DMEM supplemented with 10% FBS and cultured overnight at 5% CO2 at 37°C. Medium was removed from cultures of COS-7 cells and cells were incubated with 2 ml of TransFast/DNA mixture for 1 h at 37°C. Then, 4 ml of DMEM supplemented with 10% FBS was added. The cells were harvested after 1 day.

Preparation of membrane fractions
Membrane fractions of EL4 cells transfected with various CD9 mutant molecules were prepared as previously described with minor modifications (20). Briefly, the cells were lysed in lysis buffer (20 mM Tris–HCl, pH 7.4, 10 mM EDTA, 5 mM EGTA, 1 mM PMSF, 10 µg/ml leupeptin and 10 µg/ml aprotinin) by passing through a 27-gauge needle. The lysate was centrifuged at 800 g for 5 min at 4°C in order to remove nuclei and the supernatant was centrifuged at 100,000g for 20 min at 4°C in a Beckman TL-100s ultracentrifuge. The membrane pellet was solubilized in lysis buffer containing 1% CHAPS by pipetting and vortexing, and centrifuged at 12,000 g for 10 min at 4°C in a microcentrifuge. The supernatant was used as the membrane fraction.

Immunoprecipitation and Western blotting
The cells were lysed in 1 ml of lysis buffer (1% CHAPS, 10 mM Tris, pH 7.4, 150 mM NaCl, 0.5 mM CaCl2, 0.5 mM MgCl2, 0.02% NaN3, 1 mM PMSF, 10 µg/ml leupeptin and 10 µg/ml aprotinin). After 30 min incubation on ice, the insoluble material was removed by centrifugation at 15,000 r.p.m. and the lysate was precleared with Protein A– or Protein G–Sepharose beads for 2 h at 4°C under constant rotation. Proteins were then immunoprecipitated with 5 µg mAb directly coupled to Protein A– or Protein G–Sepharose beads. After 1 h incubation at 4°C under constant rotation, the beads were washed 4 times in lysis buffer containing 0.5% CHAPS and the proteins were separated in 12% SDS–PAGE under non-reducing conditions.

For Western blotting, the proteins were transferred to a PVDF membrane (Millipore, Bedford, MA) in buffer containing 25 mM Tris, 192 mM glycine and 20% methanol, and the membrane was blocked overnight in 2.5% non-fat dry milk in PBS containing 0.05% Tween 20. CD9 and CD5 were probed by a combination of mAb (53-7-313 and KMC8) and horseradish peroxidase-conjugated mouse anti-rat IgG and visualized with ECL (Amersham Pharmacia, Little Chalfont, UK). For HA tag detection, 12CA5 binding was revealed by horseradish peroxidase-conjugated sheep-anti-mouse Ig (Amersham Pharmacia).

Capping and immunofluorescence microscopy
All procedures were performed at 0–4°C unless otherwise described. Lymph node T cells were suspended at 2x106/ml in PBS and incubated with biotinylated anti-CD9 (9D3) or biotinylated anti-CD5 mAb (10 µg/ml) for 30 min, washed in buffer (ice-cold 2% BSA/PBS) and then incubated with 20 µg/ml Red670-conjugated streptavidin (Gibco/BRL) plus 5 µg/ml FITC-conjugated anti-CD5 or anti-CD9 at 37°C for 30 min. After capping, cells were washed with ice-cold HBBS/0.1% sodium azide and then fixed immediately in 1 ml 4% paraformaldehyde in PBS for 20 min at room temperature. Fixed cells were plated onto glass coverslips, mounted in glycerol/PBS and examined on a Carl Zeiss microscope (Zeiss LSM410) using an oil immersion lens. Appropriate excitation and barrier filters were used to observe fluorescence. Photographs of cells shown in figures represent the majority of cells displaying cell surface staining patterns observed in these experiments.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Co-precipitation of various T cell surface molecules with anti-CD9 mAb
A T cell population and thymocyte population were prepared from B6 lymph nodes and thymuses. Together with MRL104.8a thymic stromal cells which were utilized as immunizing cells in the preparation of the anti-CD9 (9D3) hybridoma, these populations were surface biotinylated and lysed in detergent-containing lysis buffer. The cell lysates were immunoprecipitated with anti-CD9 (9D3)-bound beads and bound proteins were subjected to SDS–PAGE (Fig. 2Go). Approximately 24 kDa CD9 protein was detected in the lysates of thymic stromal cells, mature T cells and thymocytes, which is consistent with our previous results (12). The results also show that anti-CD9 co-precipitates a number of proteins expressed on the surface of mature T cells and thymocytes. Because most of these co-precipitated proteins were not detected in the lysates from thymic stromal cells, they were regarded as CD9-interacting molecules expressed on cells of the T lineage.



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 2. Various T cell surface proteins co-precipitated with anti-CD9 mAb. MRL104.8a thymic stromal cells, purified mature T cells and thymocytes were surface-biotinylated, detergent-extracted and precipitated with anti-CD9 (9D3)-bound beads. Bound proteins were subjected to SDS–PAGE under non-reduced conditions.

 
To determine which T cell surface molecules associate with CD9, lysates of mature T cells were immunoprecipitated with beads coupling anti-CD9 (9D3) mAb or mAb against representative T cell surface molecules, CD3 (TCR), CD4 (co-receptor) and CD5 (a non-CD28 co-stimulatory molecule). Immunoprecipitates were resolved by SDS–PAGE and analyzed by immunoblotting with anti-CD3, anti-CD4 or anti-CD5. Figure 3Go shows that anti-CD9 mAb co-precipitates CD3, CD4 and CD5. The association of CD9 with CD3, CD4 and CD5 was reciprocally observed by immunoprecipitation with anti-CD3, -CD4 or -CD5 followed by immunoblotting with anti-CD9 (KMC8) (data not shown). In addition to these molecules, CD9 was found to associate with various non-CD28 co-stimulatory molecules such as CD2, CD29 and CD44 as well as with CD28, although to a lesser extent (data not shown).



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 3. Anti-CD9 co-precipitates CD3, CD4 and CD5. The lysates of mature T cells were immunoprecipitated with indicated mAb. Immunoprecipitates were resolved by SDS–PAGE and immunoblotted with anti-CD3, anti-CD4 or anti-CD5 mAb.

 
Association of CD9 with CD5
Among the molecules co-precipitated with anti-CD9, CD5 was the most prominent one. Moreover, because the association of tetraspanin members with CD5 has been less investigated, we focused on CD5 as a CD9-associated molecule and examined on a confocal microscopy how tightly CD9 associates with CD5. Purified mature T cells were simultaneously incubated with FITC-conjugated anti-CD5 and biotinylated anti-CD9 or FITC-conjugated anti-CD9 and biotinylated anti-CD5 followed by cross-linking with Red670-conjugated streptavidin to induce capping of CD9 or CD5 molecules. Treatment of T cells with FITC-conjugated anti-CD5 or anti-CD9 alone (without ligation) resulted in a diffuse or ring pattern of plasma membrane staining (Fig. 4a and bGo). Ligation of CD9 or CD5 molecules with biotinylated mAb plus streptavidin led to the collection of CD9 or CD5 to polarized surface caps (Fig. 4c and fGo). Simultaneous staining with FITC-conjugated anti-CD5 or anti-CD9 also showed a cap (Fig. 4d and eGo), and extensive overlaps of CD9 and CD5 were observed. These results demonstrate the tight association of CD9 with CD5 on the T cell.



View larger version (68K):
[in this window]
[in a new window]
 
Fig. 4. Collection of CD5 or CD9 to the CD9- or CD5-engaged site respectively. Mature T cells were stained simultaneously with FITC–anti-CD9 or FITC–anti-CD5 and biotinylated anti-CD5 or anti-CD9 followed by cross-linking with Red670–streptavidin for 30 min at 37°C. Stained cells were examined by confocal microscopy.

 
Preparation of EL4 cell lines transfected with CD9 mutant genes lacking various domains
We investigated which domains of the CD9 molecule are required for the association with CD5. For this purpose, the mouse EL4 cell line was chosen because EL4 cells express CD5 but do not express CD9 (Fig. 5Go, upper two panels). Transfection of EL4 cells with wild-type of CD9 gene generated a CD5+CD9+ EL4 cell line (Fig. 5Go, second line of panels). Anti-CD9 or anti-CD5 immunoprecipitation followed by anti-CD5 or anti-CD9 immunoblotting was performed using the lysates from mock-transfected EL4 cells and cells transfected with the wild-type CD9 gene together with lysates of mature T cells as control. Figure 6Go shows that co-precipitation of CD5 with anti-CD9 and of CD9 with anti-CD5 is seen in mature T cells and CD9-transfected EL4 cells but not in mock-transfected EL4 cells.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 5. The expression of anti-CD9 (9D3) epitope on EL4 cells transfected with CD9-deletion mutant genes. Stable EL4 transformants were established by transfection with mock (negative control), wild-type CD9 (positive control) and five CD9-deletion mutant genes. Cells were stained with anti-CD9 (9D3) and anti-CD5 mAb.

 


View larger version (48K):
[in this window]
[in a new window]
 
Fig. 6. Association of CD9 with CD5 in CD5+ EL4 cells transfected with CD9 gene. EL4 cells were transfected with wild-type CD9 gene to establish a stable CD9 transfectant line. Lysates were prepared from CD9 transfectant, mock transfectant and lymph node T cells, and subjected to immunoprecipitation with anti-CD9 or anti-CD5 followed by immunoblotting with anti-CD5 or anti-CD9.

 
The above results permitted us to construct CD9 mutant genes lacking various domains, to prepare EL4 lines transfected with these mutant genes and to investigate the role of each CD9 domain in the association with CD5. EL4 cells were transfected with mutant genes illustrated in Fig. 1Go, yielding five types of stable transformants designated MT1, MT2, MT3, MT4 and MT5. These transformants were examined for the expression of anti-CD9 (9D3)-reactive epitope (9D3 epitope) as well as CD5 expression. All transformants exhibited comparable levels of CD5 expression. The MT2 and MT3 transformants expressed 9D3 epitope (Fig. 5Go). Among the rest of transformants, MT4 exhibited a slight level of the 9D3 epitope, whereas this epitope was virtually negative for MT1 and MT5.

Role for TM2/TM3 domains between two EC domains in the association with CD5
To examine the membrane expression of incorporated gene products and its association with CD5 molecule, membrane fractions were prepared from EL4 cells transfected with various mutant genes. The lysates from membrane fractions of five transformants and mock control were immunoprecipitated with anti-HA mAb. Immunoprecipitates resolved by SDS–PAGE were analyzed by immunoblotting with anti-HA, anti-CD9 or anti-CD5 (Fig. 7Go). Figure 7Go(A) shows that MT1 and MT2 express high levels of HA tag epitope derived from the incorporated genes. MT4 also expressed the mutant gene-derived protein although at lower levels compared to those for MT1 or MT2. In contrast, MT3 and MT5 proteins were only slightly (MT3) or only marginally (MT5) detected by immunblotting with anti-HA antibody. However, these results do not necessarily exclude the failure of transfected genes to express the relevant proteins. For example, the surface expression of the MT3 gene was demonstrated by flow cytometry using anti-CD9 (Fig. 5Go). Consistent with this, immunoblotting of the MT3 membrane fraction with anti-CD9 revealed the expression of the MT3 containing both HA tag and CD9 epitopes (Fig. 7BGo). These observations indicate that even although the protein of the transfected gene is expressed, anti-HA immunoblotting fails to detect it depending on the incorporated site of HA tag. This leads to the possibility that the MT5 protein may also be expressed despite the failure of the detection with anti-HA.



View larger version (57K):
[in this window]
[in a new window]
 
Fig. 7. Expression of transfected mutant genes and association of their products with CD5. Membrane fractions were prepared from MT1, MT2, MT3, MT4 and MT5 transfectants and mock transfectants. Their lysates were immunoprecipitated with anti-HA followed by immunoblotting with anti-HA (A), anti-CD9 (B) or anti-CD5 (C).

 
The association of CD9 mutant proteins with CD5 was examined (Fig. 7CGo). The results show that high levels of CD5 association were observed for the MT3 protein, and that the MT1 and MT5 proteins exhibit considerable levels of association with CD5. In contrast, the association of the MT2 and MT4 proteins with CD5 was weak; in particular, the capacity of the MT4 protein lacking TM2/TM3 domains to associate with CD5 was only marginal. This was observed with several EL4 clones transfected with the MT4 mutant gene (data not shown).

To further examine the capacity of the MT2 or MT4 protein to associate with CD5, COS-7 cells were transiently transfected with the MT2 or MT4 mutant gene together with the CD5 gene. Figure 8Go shows that the anti-HA immunoprecipitate of MT2 lysate contains CD5, indicating the capacity of the MT2 protein to associate with CD5. The expression of mutant proteins in transiently transfected COS-7 cells was higher in the MT4 than in the MT2. However, CD5 was not detected in the immunoprecipitate of the MT4 lysate with anti-HA. This was also the case when the dose of MT4 plasmid DNA used for transfection was increased 2-fold. Taken together, the results demonstrate a critical role for TM2/TM3 domains in the association with CD5.



View larger version (60K):
[in this window]
[in a new window]
 
Fig. 8. Failure of the MT4 protein to associate with CD5 in COS-7 cells. COS-7 cells were transiently transfected with the CD5 gene and either the MT2 or MT4 mutant gene at the indicated doses. The lysates from these COS-7 transfectants were immunoprecipitated with anti-HA followed by immunoblotting with anti-CD5 or anti-HA (A). In (B), portions of the same lysates as used in (A) were immunoblotted with anti-CD5.

 
The expression of CD9 epitope and association with CD5 are restored by the insertion of the CD81 TM2/TM3 domains into the MT4 mutant gene
EL4 cells express another tetraspanin member CD81 (Fig. 9AGo). We examined whether CD81 also associates with CD5. To do this in comparison with the association of CD9 with CD5, membrane fractions were prepared from EL4/mock- and EL4-transfected with the wild-type CD9 gene. Lysates of these membrane fractions were immunoprecipitated with anti-CD9 or anti-CD81 followed by immunoblotting with anti-CD5 (Fig. 9BGo). The association of CD81 and CD5 or CD9 and CD5 was seen in both types or in the latter type of membrane fractions respectively. Based on these observations, we next examined whether the failure of the MT4 protein to associate with CD5 can be restored by the insertion of the CD81 TM2/TM3 domains into the MT4. Two types of CD9–CD81 chimeric genes were constructed: CD9/CD81 Chimera-a in which the TM2 and TM3 domains of CD9 were replaced with those of CD81, and, as control, CD9/CD81 Chimera-b in which the TM4 domain of CD9 was replaced with that of CD81 (Fig. 1Go). In EL4 transformants transfected with these chimera genes, the surface expression of anti-CD9 (9D3) epitope and association of chimeric proteins and CD5 protein were examined (Fig. 10Go). While the expression of 9D3 epitope was only slight or negligible on the MT4 or MT5 respectively, lacking TM domains at either site of a large EC domain (Fig. 5Go), the insertion of the CD81-corresponding domains into these CD9-deletion mutants resulted in the restoration of the epitope expression (Fig. 10AGo). Moreover, Fig. 10Go(B) shows that both types of chimeric proteins associate with CD5. These results indicate that the proper surface expression of anti-CD9 epitope requires TM domains at both sides of a large EC domain and that the CD81 TM2/TM3 domains substitute for those of the CD9 gene in terms of the role in the association with CD5.



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 9. Association of CD81 with CD5 in EL4 cells. (A) EL4 mock-transfectant and EL4 cells transfected with the wild-type CD9 gene were stained with anti-CD9, anti-CD5 or anti-CD81. (B) Membrane fractions prepared from EL4 mock or CD9 transfectants were immunoprecipitated (IP) with anti-CD9 or anti-CD81 followed by immunoblotting with anti-CD5. Graded doses of proteins were loaded.

 


View larger version (47K):
[in this window]
[in a new window]
 
Fig. 10. Association of CD9/CD81 chimeric proteins with CD5. (A) EL4 cells transfected with two types of CD9/CD81 chimeric genes were stained with anti-CD9 or anti-CD5. (B) Membrane fractions from EL4 mock or EL4 transfected with CD9/CD81 chimeric genes were immunoprecipitated (IP) with anti-CD9 followed by immunoblotting with anti-CD5. Graded doses of proteins were loaded.

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
While CD9, a member of the tetraspanin superfamily, exhibits nearly ubiquitous tissue distribution like other tetraspanin members, its expression on the T cell has only recently been observed. Our earlier study (12) demonstrated using a newly established anti-CD9 mAb that most mature T cells as well as thymocytes express CD9 and, moreover, CD9 on the T cell functions as a T cell co-stimulatory molecule.

The idea has been widely accepted that the tetraspanin molecules lacking their own signal-transducing region function through association with other membrane molecules (1,2). Based on this, the present study first investigated which surface molecules are the partners for CD9 association on the T cell. We found that CD9 associates with various T cell molecules; CD3 (TCR), CD4 (co-receptor), and T cell co-stimulatory molecules CD5, CD2, CD44 and CD29 (CD2, CD44 and CD29; our unpublished observations). Because CD5 association was the most prominent, we next focused on the CD9CD5 interaction and investigated which regions of CD9 are responsible for the association. Two transmembrane domains (TM2 and TM3) located between two EC domains were found to be responsible for the association of CD9 with CD5. Thus, this study provided a set of new observations regarding the interaction of CD9 with its associated partners on the T cell.

Among the tetraspanin members expressed on the T cell, the most extensively studied are CD81 and CD82. The importance of both molecules has been implicated in T cell development and T cell activation (1,2,21). For example, experiments using an anti-CD81 mAb (2F7) in a fetal thymus organ culture suggested that CD81 is required for thymocyte differentiation (22). Cross-linking of CD82 on T cells contributes to T cell activation: an anti-CD82 mAb exhibited a co-stimulatory effect on T cell proliferation when immobilized together with an anti-CD3 mAb (9,23). These tetraspanins have been shown to associate with T cell co-receptors CD4 and CD8 (4,24,25). However, the association of T cell tetraspanins with co-stimulatory molecules such as CD5 and CD44 (26) has not thus far been described. Our present study provides the first finding of the association of T cell tetraspanins with co-stimulatory molecules. This observation was made mainly for the association of CD9 with CD5, but was also observed for CD81–CD5 association. In particular, CD9 association with CD5 was firmly established by two different approaches: (i) immunoprecipitation and immunoblotting experiments, and (ii) the analysis of anti-CD9 or anti-CD5 engaged cap on a confocal microscopy. Because CD5 functions in the thymus as a negative modulator (27) and for mature T cells as a positive modulator (26,28,29), the association of CD9 with CD5 may represent an aspect of molecular mechanisms underlying thymocyte differentiation and T cell activation.

After establishing the association of CD9 with CD5, this study aimed to localize the region of CD9 responsible for the association with CD5. This was done by introducing CD9 mutant molecules deleted of various domains into EL4 cells expressing CD5 but lacking endogenous CD9. Because tetraspanins exhibit a complex structure having four TM domains, a possibility may be raised that any of the domains, especially the TM domains, is required to allow the entire molecule to be expressed on the cell surface in a proper conformation. Therefore, the analysis of the association with CD5 had to be performed in parallel to the observation of the cell surface expression of transfected mutant genes. EL4 transformants MT1 and MT2 lacking either EC domain by replacement with the HA epitope tag expressed mutant gene products because membrane fractions showed anti-HA immunoblotting (Fig. 7AGo) and staining of transfectants with anti-HA was observed by flow cytometry (our unpublished data). Flow cytometry analysis also revealed that anti-CD9 (9D3) mAb reacted with the MT2 but not MT1 (Fig. 5Go), indicating the localization of the 9D3 epitope at the large EC domain. The MT3 transfectant displayed anti-CD9 staining (Fig. 5Go) as well as anti-CD9 immunoblotting (Fig. 7BGo). Thus, the MT1, MT2 and MT3 transfectants express the product of transfected mutant genes on the surface. The MT4 showed low but detectable levels of anti-HA immunoblotting. The surface expression of the MT5 product was detected neither by anti-HA/anti-CD9 immunoblotting (Fig. 7A and BGo) nor anti-CD9 flow cytometry (Fig. 5Go). Nevertheless, these observations do not totally exclude the possibility of the surface expression of the MT5 product. In fact, this was seen by the association of the MT5 product with CD5 (Fig. 7CGo) (vide infra). Taken together, TM domains of the tetraspanin CD9 play an important role in the expression of CD9, i.e. the surface expression of mutant proteins per se relies on the presence of TM2/TM3 domains, while the proper expression of the large EC domain as evaluated by the detection of the 9D3 epitope depends on the presence of the TM domains at both sides of the EC domain.

Little is known regarding the domain(s) responsible for the association of the tetraspanin members with other molecules. Most of the foregoing studies are concerned with which portion of the partner molecules is required for the association with tetraspanins (10,24,30,31). Only one study investigated the role of each tetraspanin domain in the association (18). The results showed that the large EC domain or the fourth TM domain or both of CD9 are involved in the association with the mature ß1 integrin, whereas association with the ß1 integrin precursor requires two different TM domains (TM1/TM3) of CD9. In the present study, we investigated the requirement of CD9 domains for the association with CD5. The MT1, MT3 and MT5 mutant proteins were found to associate with CD5 (Fig. 7CGo). Although the HA tag epitope was not detected in the anti-HA immunoprecipitate of the MT5 lysate by anti-HA immunoblotting (Fig. 7AGo), the same immunoprecipitate showed the co-precipitation of CD5 (Fig. 7CGo). Similar observations were made for the anti-HA immunoprecipitate of the MT3 lysate showing marginal levels of anti-HA (Fig. 7AGo), but high levels of anti-CD5 immunoblotting (Fig. 7CGo).

The association of the MT1, MT3 or MT5 protein with CD5 indicated that EC2, TM1 and TM4 domains are not required for the association. In contrast, the MT2 and MT4 mutant proteins in stable EL4 transformants exhibited slight and only marginal levels of association with CD5 (Fig. 7CGo), suggesting that CD5 association relies on the relevant domains (EC2 and TM2/TM3), particularly on TM2/TM3 domains. Because the MT4 lacking TM2/TM3 domains expressed a small amount of the mutant protein, it is possible that the negligible association of MT4 with CD5 is due partly to the limitation in the expression of the MT4 protein. To further examine the capacity of the MT4 protein to associate with CD5, COS-7 cells were co-transfected with the CD5 gene and the MT4 mutant gene in comparison with the MT2. In transient COS-7 transfectants, the MT4 mutant protein as determined by anti-HA immunoblotting was expressed at higher levels than those of the MT2 protein (Fig. 8AGo). Nevertheless, the anti-HA immunoprecipitate of the MT4 lysate did not contain CD5 in contrast to a clear capacity of the MT2 to associate with CD5. Thus, the failure to detect the association of the MT4 protein with CD5 may not be ascribed solely to the inefficient expression of the MT4 protein. Moreover, when the TM2/TM3 region of CD81 gene was inserted into the deleted region of CD9 gene (CD9/CD81 Chimera-a), this chimera protein was expressed on the surface of transfectants and its association with CD5 was observed (Fig. 10A and BGo). These observations are compatible with the notion that TM2/TM3 domains of CD9 are responsible for the association of CD9 with CD5, together with the possibility that TM2/TM3 domains of CD81 also have the capacity to associate with CD5. However, it should also be noted that CD5 association was apparently weaker in the MT2 protein lacking the small EC domain than in other mutant proteins such as the MT1 lacking the large EC domain. Therefore, it is needed to take into consideration that the small EC domain of CD9 also has a role in the association with CD5.

Our present results contrast with the observations of Rubinstein et al. (18) in terms of the requirement for the particular CD9 domains in the association with other surface proteins. However, their study investigated the association with ß1 integrin and ours dealt with the association with CD5. It could be possible that the CD9 region responsible for the association differs depending on the partner molecules. In general, the tetraspanin members such as CD9, CD63, CD81 and CD82 associate with each other (8) and multiple other molecules (1,2) to form a surface tetraspanin network (8). Such a network may be achieved through the mechanism in which each tetraspanin can bind to various molecules at its different regions. The observations that CD9 associates with two different molecules at the distinct regions of CD9 may be consistent with this notion. It has been proposed that the observed functions of tetraspanins relate to their ability to facilitate interactions between other proteins contained in functional complexes (32). In the view of the role for tetraspanins as a `molecular facilitator', CD9 associating with CD5 may function to facilitate the redistribution of CD5 for the expression of its co-stimulatory capacity. Thus, the present study adds to our knowledge of the physiology and function of the tetraspanin superfamily.


    Acknowledgments
 
The authors are grateful to Dr Steve Neven for critical reviewing of this paper, and to Miss Tomoko Katsuta and Miss Mari Yoneyama for secretarial assistance. This work was supported by Grants-in-Aid for Scientific Research from the Ministry of Education, Science and Culture, Japan.


    Abbreviations
 
B6 C57BL/6
EC extracellular
HA hemagglutinin
PE phycoerythrin
TM transmembrane

    Notes
 
Transmitting editor: T. Saito

Received 9 August 1999, accepted 10 September 1999.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Wright, M. D. and Tomlinson, M. G. 1994. The ins and outs of the transmembrane 4 superfamily. Immunol. Today 15:588.[ISI][Medline]
  2. Maecker, H. T., Todd, S. C. and Levy, S. 1997. The tetraspanin superfamily: molecular facilitators. FASEB J. 11:428.[Abstract]
  3. Bell, G. M., Seaman, W. E., Niemi, E. C. and Imboden, J. B. 1992. The OX-44 molecule couples to signaling pathways and is associated with CD2 on rat T lymphocytes and a natural killer cell line. J. Exp. Med. 175:527.[Abstract/Free Full Text]
  4. Imai, T. and Yoshie, O. 1993. C33 antigen and M38 antigen recognized by monoclonal antibodies inhibitory to syncytium formation by human T cell leukemia virus type 1 are both members of the transmembrane 4 superfamily and associate with each other and with CD4 or CD8 in T cells. J. Immunol. 151:6470.[Abstract]
  5. Bradbury, L. E., Kansas, G. S., Levy, S., Evans, R. L. and Tedder, T. F. 1992. The CD19/CD21 signal transducing complex of human B lymphocytes includes the target of antiproliferative antibody-1 and Leu-13 molecules. J. Immunol. 149:2841.[Abstract]
  6. Tedder, T. F., Zhou, L. J. and Engel, P. 1994. The CD19/CD21 signal transduction complex of B lymphocytes. Immunol. Today 15:437.[ISI][Medline]
  7. Mannion, B. A., Berditchevski, F., Kraeft, S. K., Chen, L. B. and Hemler, M. E. 1996. Transmembrane-4 superfamily proteins CD81 (TAPA-1), CD82, CD63, and CD53 specifically associated with integrin {alpha}4ß1 (CD49d/CD29). J. Immunol. 157:2039.[Abstract]
  8. Rubinstein, E., Le-Naour, F., Lagaudriere-Gesbert, C., Billard, M., Conjeaud, H. and Boucheix, C. 1996. CD9, CD63, CD81, and CD82 are components of a surface tetraspan network connected to HLA-DR and VLA integrins. Eur. J. Immunol. 26:2657.[ISI][Medline]
  9. Lebel-Binay, S., Lagaudriere, C., Fradelizi, D. and Conjeaud, H. 1995. CD82, member of the tetra-span-transmembrane protein family, is a co-stimulatory protein for T cell activation. J. Immunol. 155:101.[Abstract]
  10. Bradbury, L. E., Goldmacher, V. S. and Tedder, T. F. 1993. The CD19 signal transduction complex of B lymphocytes. Deletion of the CD19 cytoplasmic domain alters signal transduction but not complex formation with TAPA-1 and Leu 13. J. Immunol. 151:2915.[Abstract]
  11. Schick, M. R., Nguyen, V. Q. and Levy, S. 1993. Anti-TAPA-1 antibodies induce protein tyrosine phosphorylation that is prevented by increasing intracellular thiol levels. J. Immunol. 151:1918.[Abstract]
  12. Tai, X. G., Yashiro, Y., Abe, R., Toyooka, K., Wood, C. R., Morris, J., Long, A., Ono, S., Kobayashi, M., Hamaoka, T., Neben, S. and Fujiwara, H. 1996. A role for CD9 molecules in T cell activation. J. Exp. Med. 184:753.[Abstract/Free Full Text]
  13. Ogata, M., Matsubara, H., Takai, Y., Kosaka, H., Katagiri, T., Sano, H., Ishimura, K., Fujita, H., Hamaoka, T. and Fujiwara, H. 1989. Capacities of a newly established thymic stromal cell clone to express Ia antigens and to produce interleukin-6, colony-stimulating factor, and thymic stroma-derived T-cell growth factor. J. Leuk. Biol. 45:69.[Abstract]
  14. Oritani, K., Wu, X., Medina, K., Hudson, J., Miyake, K., Gimble, J. M., Burstein, S. A. and Kincade, P. W. 1996. Antibody ligation of CD9 modifies production of myeloid cells in long-term cultures. Blood 87:2252.[Abstract/Free Full Text]
  15. Ledbetter, J. A. and Herzenberg, L. A. 1979. Xenogeneic monoclonal antibodies to mouse lymphoid differentiation antigens. Immunol. Rev. 47:63.[ISI][Medline]
  16. Leo, O., Foo, M., Sachs, D. H., Samelson, L. E. and Bluestone, J. A. 1987. Identification of a monoclonal antibody specific for a murine T3 polypeptide. Proc. Natl Acad. Sci. USA 84:1374.[Abstract/Free Full Text]
  17. Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K. and Pease, L. R. 1989. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51.[ISI][Medline]
  18. Rubinstein, E., Poindessous-Jazat, V., Le-Naour, F., Billard, M. and Boucheix, C. 1997. CD9, but not other tetraspans, associates with the ß1 integrin precursor. Eur. J. Immunol. 27:1919.[ISI][Medline]
  19. Whitehurst, C. E. and Geppert, T. D. 1996. MEK1 and the extracellular signal-regulated kinases are required for the stimulation of IL-2 gene transcription in T cells. J. Immunol. 156:1020.[Abstract]
  20. Sawai, H., Okazaki, T., Takeda, Y., Tashima, M., Sawada, H., Okuma, M., Kishi, S., Umehara, H. and Domae, N. 1997. Ceramide-induced translocation of protein kinase C-{delta} and -{varepsilon} to the cytosol. Implications in apoptosis. J. Biol. Chem. 272:2452.[Abstract/Free Full Text]
  21. Levy, S., Todd, S. C. and Maecker, H. T. 1998. CD81 (TAPA-1): a molecule involved in signal transduction and cell adhesion in the immune system. Annu. Rev. Immunol. 16:89.[ISI][Medline]
  22. Boismenu, R., Rhein, M., Fischer, W. H. and Havran, W. L. 1996. A role for CD81 in early T cell development. Science 271:198.[Abstract]
  23. Nojima, Y., Hirose, T., Tachibana, K., Tanaka, T., Shi, L., Doshen, J., Freeman, G. J., Schlossman, S. F. and Morimoto, C. 1993. The 4F9 antigen is a member of the tetraspans transmembrane protein family and functions as an accessory molecule in T cell activation and adhesion. Cell. Immunol. 152:249.[ISI][Medline]
  24. Imai, T., Kakizaki, M., Nishimura, M. and Yoshie, O. 1995. Molecular analyses of the association of CD4 with two members of the transmembrane 4 superfamily, CD81 and CD82. J. Immunol. 155:1229.[Abstract]
  25. Todd, S. C., Lipps, S. G., Crisa, L., Salomon, D. R. and Tsoukas, C. D. 1996. CD81 expressed on human thymocytes mediates integrin activation and interleukin 2-dependent proliferation. J. Exp. Med. 184:2055.[Abstract/Free Full Text]
  26. Yashiro, Y., Tai, X. G., Toyo-oka, K., Park, C. S., Abe, R., Hamaoka, T., Kobayashi, M., Neben, S. and Fujiwara, H. 1998. A fundamental difference in the capacity to induce proliferation of naive T cells between CD28 and other co-stimulatory molecules. Eur. J. Immunol. 28:926.[ISI][Medline]
  27. Tarakhovsky, A., Kanner, S. B., Hombach, J., Ledbetter, J. A., Muller, W., Killeen, N. and Rajewsky, K. 1995. A role for CD5 in TCR-mediated signal transduction and thymocyte selection. Science 269:535.[Abstract/Free Full Text]
  28. Ledbetter, J. A., Martin, P. J., Spooner, C. E., Wofsy, D., Tsu, T. T., Beatty, P. G. and Gladstone, P. 1985. Antibodies to Tp67 and Tp44 augment and sustain proliferative responses of activated T cells. J. Immunol. 135:2331.[Abstract]
  29. Ceuppens, J. L. and Baroja, M. L. 1986. Monoclonal antibodies to the CD5 antigen can provide the necessary second signal for activation of isolated resting T cells by solid-phase-bound OKT3. J. Immunol. 137:1816.[Abstract]
  30. Matsumoto, A. K., Martin, D. R., Carter, R. H., Klickstein, L. B., Ahearn, J. M. and Fearon, D. T. 1993. Functional dissection of the CD21/CD19/TAPA-1/Leu-13 complex of B lymphocytes. J. Exp. Med. 178:1407.[Abstract/Free Full Text]
  31. Berditchevski, F., Bazzoni, G. and Hemler, M. E. 1995. Specific association of CD63 with the VLA-3 and VLA-6 integrins. J. Biol. Chem. 270:17784.[Abstract/Free Full Text]
  32. Maecker, H. T., Todd, S. C. and Levy, S. 1997. The tetraspanin superfamily: molecular facilitators. FASEB J. 11:428.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
BloodHome page
J. C. Qi, J. Wang, S. Mandadi, K. Tanaka, B. D. Roufogalis, M. C. Madigan, K. Lai, F. Yan, B. H. Chong, R. L. Stevens, et al.
Human and mouse mast cells use the tetraspanin CD9 as an alternate interleukin-16 receptor
Blood, January 1, 2006; 107(1): 135 - 142.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M.-T. Zilber, N. Setterblad, T. Vasselon, C. Doliger, D. Charron, N. Mooney, and C. Gelin
MHC class II/CD38/CD9: a lipid-raft-dependent signaling complex in human monocytes
Blood, November 1, 2005; 106(9): 3074 - 3081.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Gimferrer, M. Farnos, M. Calvo, M. Mittelbrunn, C. Enrich, F. Sanchez-Madrid, J. Vives, and F. Lozano
The Accessory Molecules CD5 and CD6 Associate on the Membrane of Lymphoid T Cells
J. Biol. Chem., February 28, 2003; 278(10): 8564 - 8571.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
W.-J. Won and J. F. Kearney
CD9 Is a Unique Marker for Marginal Zone B Cells, B1 Cells, and Plasma Cells in Mice
J. Immunol., June 1, 2002; 168(11): 5605 - 5611.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Seigneuret, A. Delaguillaumie, C. Lagaudriere-Gesbert, and H. Conjeaud
Structure of the Tetraspanin Main Extracellular Domain. A PARTIALLY CONSERVED FOLD WITH A STRUCTURALLY VARIABLE DOMAIN INSERTION
J. Biol. Chem., October 19, 2001; 276(43): 40055 - 40064.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. M. Oyarce, T. C. Steveson, L. Jin, and B. A. Eipper
Dopamine beta -Monooxygenase Signal/Anchor Sequence Alters Trafficking of Peptidylglycine alpha -Hydroxylating Monooxygenase
J. Biol. Chem., August 24, 2001; 276(35): 33265 - 33272.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Berditchevski, E. Gilbert, M. R. Griffiths, S. Fitter, L. Ashman, and S. J. Jenner
Analysis of the CD151{middle dot}alpha 3beta 1 Integrin and CD151{middle dot}Tetraspanin Interactions by Mutagenesis
J. Biol. Chem., October 26, 2001; 276(44): 41165 - 41174.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (16)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Toyo-oka, K.
Right arrow Articles by Fujiwara, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation