Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Shen, X.
Right arrow Articles by Storb, U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shen, X.
Right arrow Articles by Storb, U.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 11, No. 10, 1663-1671, October 1999
© 1999 Japanese Society for Immunology

The CH1 and transmembrane domains of µ in the context of a {gamma}2b transgene do not suffice to promote B cell maturation

Xuejun Shen1,3, Grazyna Bozek1, Carl A. Pinkert2 and Ursula Storb1

1 Department of Molecular Genetics and Cell Biology, University of Chicago, Chicago, IL 60637, USA
2 Department of Comparative Medicine, University of Alabama at Birmingham, Birmingham, AL 35294-0019, USA

Correspondence to: U. Storb


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Mice carrying a {gamma}2b transgene have been shown previously to be deficient in B cell development. In particular, a developmental block exists at the pre-B cell stage. The few B cells that develop all express endogenous µ heavy chains. The phenotype suggests that {gamma}2b exerts a strong feedback inhibition on endogenous Ig gene rearrangement, but, unlike µ, cannot support further B cell development. In this study we have created hybrid transgenes between {gamma}2b and µ. Transgenic mice with a CH1 domain of µ, or both a CH1 and transmembrane/cytoplasmic domain of µ replacing the respective domains of a {gamma}2b transgene, have the same B cell defect as {gamma}2b transgenic mice. Interestingly, the severity of the defect is correlated with the level of expression of the transgene, suggesting that the degree of feedback inhibition of Ig gene rearrangement depends on the level and timing of Ig production. Crossing the {gamma}2b/µ transgenes into a Bcl-xL transgenic line allows immature {gamma}2b B cells to survive, but not to develop to maturity. Therefore, the missing function of µ is not simply an anti-apoptotic effect.

Keywords: B lymphocytes, bone marrow, gene rearrangement, mRNA, transgenic mice


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The development of B lymphocytes is closely related to the expression of Ig genes. Studies of transgenic and knockout mice have shown that the membrane form of µ and probably {delta} have to fulfill a number of functions in early B cell development, including maturation, feedback inhibition of heavy chain gene rearrangement, up-regulation of light chain gene rearrangement and, finally, feedback inhibition of the V(D)J recombinase (reviewed in 1). Transgenic {gamma}2b (2) and {gamma}2a (3,4) mice are effective in allelic exclusion and feedback inhibition of endogenous heavy chain gene rearrangement, but produce very few, if any, {gamma}2b-only or {gamma}2a-only expressing B cells. A mouse line with a hybrid transgene of {gamma}2b with membrane and cytoplasmic domains of µ ({gamma}2b/µmem) (2) has the same phenotype as {gamma}2b transgenic mice. So, although µmem knockout mice have shown that µmem is absolutely needed for normal B cell development (5), the µmem domain cannot rescue the B cell deficiency caused by the expression of a {gamma}2b transgene.

In {gamma}2b transgenic mice B cell development arrests at the transition of large Ig, B220+ pre-B cells into small Ig, B220+ pre-B cells (2,6). This is just after the stage at which B cell development is blocked in {lambda}5 knockout mice (7). The {lambda}5 chain appears to associate with the CH1 domain of µ (8,9). Deletion of CH1 inhibits B cell development (10). It was therefore possible that the CH1 domain of µ provides an interaction that triggers B cell maturation. While {gamma}2b can associate with {lambda}5 (11), its CH1 domain is different from that of µ in 80% of the amino acids. Thus, the CH1 domain of {gamma}2b may be unable to participate in a proper maturation signal.

To test for this possibility, we have produced transgenic mice with µ/{gamma}2b hybrid transgenes. In one type of transgenes the CH1 domain of {gamma}2b has been replaced by that of µ ({gamma}/µCH1). This transgene retains all other domains and the VH region of the original {gamma}2b transgene. In a second set of µ/{gamma} transgenic mice, in addition to CH1, the transmembrane and intracytoplasmic domains of {gamma}2b were replaced by those of µ ({gamma}/µCHM) on the assumption that an intramolecular co-operation between the homologous domains may be required.

It is important to determine which domain(s) of µ have the nurturing effect that is required for complete B cell maturation, as this may aid in the identification of potential extracellular ligands and cellular pathways that are involved in B cell development.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Transgenes and transgenic mice
The {gamma}/µCH1 and {gamma}/µCHM gene constructs were derived from a {gamma}2b transgene (12). The {gamma}/µCH1 transgene was constructed from the {gamma}2b transgene by replacing the {gamma}2b CH1 region contained on a 0.5 kb MunI–BstE II fragment with the 0.5 kb µCH1 region from pVH167µ (13) (Fig. 1Go). The {gamma}/µCHM transgene was constructed from the {gamma}/µCH1 transgene by replacing the {gamma}2b transmembrane and cytoplasmic domains contained in a 3 kb (KpnI–PvuI) fragment with µ membrane exons contained in a 2.6 kb KpnI–PvuI fragment from pVH167µ (13). Transgenic mice were generated by DNA microinjection using linearized ~12 kb SalI–ClaI fragments ({gamma}/µCH1 or {gamma}/µCHM) into the pronucleus of (C57/BL6xSJL) F2 zygotes as described (14,15). One {gamma}/µCH1 trangenic line, Cd-1, was produced by microinjection into fertilized eggs from CD-1 outbred mice. All founders were backcrossed with C57/BL6 mice. Founders were tested for the presence of the transgenes in tail DNA by Southern blot using VDJ and {gamma}2bCH3 regions (Fig. 1Go) as probes, and offspring were screened by a transgene-specific PCR assay using the primers 5'V{gamma}2b (GCTGAGCTGATGAGGCCTGGG) and 3'JH2{gamma}2b (CTGAGGAGACTGTGAGAGTG) (94°C, 30 s; 65°C, 60 s; 72°C, 60 s, 30 cycles). The Bcl-xL transgenic mice are described in Grillot et al. (16) and were kindly provided by Dr Craig Thompson.



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 1. Maps of {gamma}/µCH1 (A) and {gamma}/µCHM (B) transgenes. The constructs are drawn approximately to scale. Fragments VDJ and {gamma}2bCH3 were used as probes. Filled boxes, exons from µ; open boxes, exons from {gamma}2b (12); open oval, heavy chain enhancer; striped boxes, pKS vector sequences. S1, SalI; N, NcoI; B, BamHI; E, EcoRI; H, HindIII; K, KpnI; C1, ClaI.

 
Flow cytometry analysis
Flow cytometry (FACS; Becton Dickinson, Mountain View, CA) was performed essentially as described (17) using the following antibodies: phycoerythrin (PE)-conjugated goat anti-mouse {kappa} (Southern Biotechnology Associates, Birmingham, AL) at 0.05 µg/106 cells; FITC-conjugated rat anti-mouse CD45R/B220 (clone RA3-6B2) (PharMingen, San Diego, CA) at 2 µg/106 cells; PE-conjugated goat anti-mouse IgM (Southern Biotechnology Associates) at 0.4 µg/106 cells; FITC-conjugated anti-mouse IgMb (clone R6-60.2) (PharMingen) at 1 µg/106 cells; FITC-conjugated goat anti-mouse {gamma}2b (Southern Biotechnology Associates) at 1.5 µg/ 106 cells; R-PE–rat anti-mouse CD43 (Clone S7; PharMingen) at 0.8 µg/106 cells; and FITC–anti-mouse CD19 (Clone 1D3; PharMingen) at 1 µg/106 cells.

Samples were analyzed by FACScan (Becton Dickinson). A total of 104 splenic and 2.5x104 bone marrow lymphocytes, as determined by forward and side scatter, were analyzed per sample. FACS diagrams were generated with the CellQuest (Scripps Research Institute) software programs.

To separate pre-B cells at early stages (A, B and C) (18) from B cells at later stages (late pre-B, immature and mature B cells), bone marrow cells were double stained with anti-CD19 (pan-B cell antibody) and anti-S7 (early B cell marker). Populations of CD19+S7+ (early pre-B cells) and CD19+S7 (late pre-B, immature and mature B cells) were sorted by FACS.

RNA preparation and RT-PCR
Single-cell suspensions were made from spleen and bone marrow of transgenic mice and their non-transgenic littermates. Red blood cells were removed using DMEM/H2O (1:9). Total RNAs were extracted using RNA STAT-60 (Tel-Test, Friendswood, TX). First-strand cDNAs were generated from 3 µg of total RNA using oligo(dT)12–18 and SuperScript II RNase H reverse transcriptase (Gibco/BRL, Grand Island, NY). The first-strand cDNAs were diluted 1:2 to 1:5. Then 1 µl of each sample was analyzed by PCR using two sets of oligonucleotides designated {gamma}/µ for the transgene and En-µ for the endogeous µ gene. For {gamma} the 5' oligonucleotide is TGGTATGCAAAATCCACTACGGAGG; the 3' oligonucleotide is GCTGTGTGTACTTCCACGTTGTTC resulting in a 291 bp fragment. For En-µ the 5' oligonucleotide is the same as for the transgene; the 3' oligonucleotide is CGGTTTTGGAGTGAAGTTCGTGC resulting in a 389 bp fragment. Conditions for PCR were: denaturation at 94°C for 30 s, annealing at 57°C for 1 min and elongation at 72°C for 1 min. The PCR reactions were run for 20 cycles to ensure that amplification was within the linear range.

For sorted CD19+CD43+ (S7+) and CD19+CD43 (S7) cells, the cells were pelleted, and resuspended in RAN STAT-60 (Tel-Test). The other steps were as above, except that the first-strand cDNAs from sorted cells were not diluted and PCR reactions were run for 25 cycles because of the low cell concentrations.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Transgenic mice
Four {gamma}/µCH1 transgenic lines [BS1-1, BS1-2, BS1-3 (BS1-2 and BS1-3 segregated from the same founder) and Cd-1] and two {gamma}/µCHM transgenic lines (BS2-1 and BS2-2, segregated from the same founder) were generated using the constructs shown in Fig. 1Go. Lines BS1-1, BS1-2 and BS2-1 contain ~2–4 copies of the transgene, the other lines contain high copy numbers of the transgene, ~15 copies for Cd-1, 40 copies for BS1-3 and BS2-2 (Fig. 2Go). In all of the lines the transgene was expressed in all lymphoid tissues, bone marrow, spleen (Fig. 3Go) and thymus (not shown). Expression in thymus was expected, as it always occurred with heavy chain transgenes (1). The transgenes were not significantly expressed in the non-lymphoid tissues tested (liver, heart and brain; not shown).



View larger version (127K):
[in this window]
[in a new window]
 
Fig. 2. Southern blot of transgenes in kidney of transgenic mice. Six lines were generated: four from construct {gamma}/µCH1 and two from construct {gamma}/µCHM. There are ~2–4 copies in BS1-1, BS1-2 and BS2-1; ~15 copies in Cd-1; and ~40 copies in BS1-3 and BS2-2. The 343 line is a {gamma}2b transgenic line, which has the same VDJ region as the {gamma}/µ transgenic mice (2); it has three copies of the transgene. The VDJ region (see Fig. 1Go) was used as probe resulting in two transgene bands (Tr) and a major endogenous band (En; ~10 kb, 3' from just 5' of JH2) in BamHI-digested genomic DNAs. This figure was made from two gels.

 


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 3. Relative expression levels of transgene and endogenous µ gene in normal and transgenic mice as assayed by RT-PCR. Total RNA for cDNA synthesis was isolated from total nucleated bone marrow (B) and splenic (S) cells. Co-amplification with specific primers for the transgene and endogenous gene (see Methods) was performed at 20 cycles. The gel was stained by ethidium bromide and the image was inverted for better visual effect. Relative expression levels of transgene (Tr) versus endogenous (En) µ were determined by densitometry. These data and their repeats are summarized in Table 3Go.

 
B cell development is blocked in both {gamma}/µCH1 and {gamma}/µCHM transgenic mice
To determine whether B cell development is affected by transgene expression, bone marrow and splenic B cells from age-matched normal and transgenic mice were analyzed by FACS (Figs 4 and 5GoGo; Table 1Go). A severe depletion of B cells was seen in both bone marrow and spleen of most of the transgenic mice. From 4 to 25 weeks of age, all the lines, except BS1-2, have significantly lower percentages of B220+, {kappa}+ or µ+ (mIg+) cells compared to control mice (Table 1Go). The percentage of {kappa}+ cells matches that of µ+ cells (Fig. 6Go, middle panel; Table 1Go), indicating that there are essentially no B cells that express the {gamma} transgene encoded Ig without also expressing µ. The same phenomenon was observed in {gamma}2b-only transgenic mice (2) which means that for survival and development the B cells need signals from µ. All B cells in the spleen express {gamma}2b at low levels (Fig. 6Go, top; the shift along the x-axis is ~2–4 times higher than in the normal mice which have mainly µ+ B cells), but always in combination with µ encoded by endogenous genes. No {gamma}2b-only cells exist. Expression of {gamma}2b protein has been further confirmed by serum IgG analysis (not shown). Surprisingly, the defect is very severe in the BS2-1 and BS2-2 lines which carry the µmem domain-containing transgene ({gamma}/µ CHM; Table 1Go). Clearly, the µmem domain combined with the CH1 domain does not reproduce the maturation signal that a complete µ constant region can provide.




View larger version (123K):
[in this window]
[in a new window]
 
Fig. 4. Two-color FACS analysis of a {gamma}/µCH1 transgenic mouse (BS1-1) and a normal littermate for B220/{kappa} and B220/µ. (A) Bone marrow. (B) Spleen. The cells were gated on lymphoid cells by forward/side scatter. The percentage of total lymphoid cells in each compartment is indicated.

 



View larger version (98K):
[in this window]
[in a new window]
 
Fig. 5. Two-color FACS analysis of a {gamma}/µCHM transgenic mouse (BS2-1) and a normal littermate for B220/{kappa} and B220/µ. (A) Bone marrow. (B) Spleen. The cells were gated on lymphoid cells by forward/side scatter. The percentage of cells in each compartment are indicated.

 

View this table:
[in this window]
[in a new window]
 
Table 1. FACS analysis on splenic and bone marrow B cells
 


View larger version (49K):
[in this window]
[in a new window]
 
Fig. 6. Two-color FACS analysis of splenic lymphoid cells of two transgenic lines, {gamma}/µCH1 (BS1-1) and {gamma}/µCHM (BS2-1), and a normal littermate (of BS1-1) for {gamma}2b versus µ, {kappa} versus µ and µb versus µ.

 
The stage at which B cell development is inhibited in the bone marrow was assessed by further analyzing the cells that were B220lo and {kappa}. These cells comprise the early B cells stages A–D (18). Clearly, in the mice with strong suppression of B cell development (BS1-3, Cd-1, BS2-2) the most immature cells which are large and/or CD43+ (S7+) (stages A–C) are considerably increased compared with the proportion of these cells in age-matched non-transgenic mice (Table 2Go). This suggests that the stop in development is around the transition from stage C to stage D, the same as in the {gamma}2b-only transgenic mice. The skewing toward immature B cells does not exist in the BS1-2 line which also shows no depression of mature B cells, despite expression of the transgene (see below).


View this table:
[in this window]
[in a new window]
 
Table 2. Three-color FACS of bone marrow cells
 
Since the {gamma}/µ transgenes encode µCH1 (a allotype), there was a concern whether the anti-µ antibody may react with this µCH1 portion. Two-color FACS with anti-IgM antibody and anti-IgMb antibody (specific for the endogenous µ allotype) (Fig. 6Go, bottom) shows that all µ+ cells are expressing endogenous µb. Thus, there is no detectable cross-reaction with the transgenic µ and the anti-IgM antibody staining reflects endogenous µ protein.

The level of transgene expression determines the severity of endogenous µ suppression
The six lines of transgenic mice showed different levels of impairment of B cell development. While BS1-3 of {gamma}/µCH1 and BS2-2 of {gamma}/µCHM have the most severe B cell depression, BS1-2 of {gamma}/µCH1 has a near normal phenotype (Table 1Go).

RT-PCR from both bone marrow and splenic cells demonstrated that the transgene is expressed in all mice (Fig. 3Go). In order to determine how the effect on B cell development was related to the levels of expression of the transgene, the relative levels of transgenic versus endogenous µ were analyzed (Fig. 3Go; Table 3Go). There is a rather close correlation between the ratio of transgenic to endogenous heavy chain mRNA levels in the bone marrow and spleen and the degree of B cell impairment as measured by the percentage of B cells that are B220hi (the more mature cells in the bone marrow and peripheral B cells) (Table 3Go). Highest expression of the transgene corresponds to the lowest B cell numbers and vice versa.


View this table:
[in this window]
[in a new window]
 
Table 3. Transgene expression and B cell numbers
 
In order to determine when in B cell development the differential expression of the transgene versus endogenous µ were established, we sorted pro-B/early pre-B cells (CD43+) late pre-B/B cells (CD43) in the bone marrow (Fig. 7Go). Among the three transgenic lines analyzed in this way, BS1-3 has the most severe B cell deficiency, BS1-2 has near normal B cell development and BS1-1 has an intermediate phenotype. These differences are clearly reflected in the relative heavy chain mRNA levels. The most severely suppressed BS1-3 line shows high levels of transgene expression with hardly any endogenous µ expression as early as the pro-B/early pre-B cell stage. The other two lines show similar levels of transgenic and endogenous heavy chain expression at the early stage. Later, BS1-2 with the least severe phenotype shows higher expression of the endogenous versus transgenic heavy chain, while BS1-1 with the intermediate phenotype shows a balance of transgenic and endogenous heavy chain gene expression. Thus, it is likely that a high level of transgene expression most strongly interferes with the rearrangement of endogenous heavy chain genes.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 7. Relative levels of expression of {gamma}/µ transgene (Tr) and endogenous µ gene (En) in total and sorted CD19+CD43+ cells (S7+), and CD19+CD43 cells (S7) as assayed by RT-PCR (see legend of Fig. 3Go and Methods for details). *The endogenous µ mRNA is too low to quantify accurately; the observed ratio was >70. The size markers are 500, 400, 300 and 200 bp.

 
Bcl-xL only partially rescues B cell development in {gamma}/µ transgenic mice
Clearly, the {gamma}2b transgenic heavy chain with partial substitutions of µ elements does not permit B cell development. Because it was possible that the missing function of µ was only one that overcomes apoptosis, we crossed two {gamma}2b/µ transgenic lines with a line expressing a Bcl-xL transgene in the B cell lineage (Table 4Go). As described by others (16), mice that overexpress Bcl-xL in the B cell lineage have an increase in B cell numbers in the spleen and in the more mature cells in the bone marrow (Table 4Go, Bcl-xL). When the {gamma}/µ transgenics were crossed with Bcl-xL, an increase in the numbers of B cells and their precursors was seen in bone marrow and spleen compared with the {gamma}/µ transgene without the Bcl-xL transgene (Table 4Go). However, compared with mice carrying only the Bcl-xL transgene, the {gamma}/µ transgenic/Bcl-xL mice still had very low B cell levels in the spleen. In the bone marrow of the {gamma}xBcl-xL transgenic mice the B220hi B cells (mature) were also greatly reduced, compared with the Bcl-xL-only mice. However, the B220lo B cells were increased in the Bcl-xL transgenics in the presence of the {gamma}/µ transgenes. This is likely to reflect the survival of immature B cells. The strongest increase in B220lo cells was seen in {kappa}+ cells in bone marrow and spleen, and that increase was not matched by an increase in µ+ cells. This suggests that some cells that do not express µ, due to the strong feedback by the {gamma}2b transgene, were now rescued to survive.


View this table:
[in this window]
[in a new window]
 
Table 4. FACS analysis of {gamma}/Bcl-XL crosses
 
Since only immature cells were rescued by the Bcl-xL transgene, the missing function of µ is not solely an antiapoptotic effect, but rather a specific maturation function.


    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
This study shows that in {gamma}/µ transgenic mice all {kappa}+ B cells co-express endogenous µ, thus there are no mature B cells that express only the {gamma}/µ transgenic heavy chain. This result mimics the findings with conventional {gamma}2b transgenic mice (2,6), suggesting that the replacement of the {gamma}2b CH1 and membrane/cytoplasmic domains by those of µ cannot confer the maturation function of µ. The arrest in B cell development with the {gamma} transgenes appears to occur at the same stage as with {gamma}2b-only transgenes (6), at the transition from stage C to stage D (18). In the bone marrow of the {gamma}/µ transgenics with strong transgene expression (an exception is BS1-2), the B220+ cells are mainly CD43+ (stages A–C), but 19–21% of {kappa}/B220+ cells are CD43, showing that stage D is at least initiated (Table 2Go). Maturation to stage D is further supported by the finding that in crosses with Bcl-xL transgenic mice a large increase in {kappa}+/B220lo cells is obtained (Table 4Go). Most of these cells are µ, supporting the idea that {gamma}2b alone can promote the development to stage D at which {kappa} gene rearrangement initiates. In contrast to the {gamma}2b/µ and {gamma}2b-only transgenic mice, in {lambda}5 knockout mice (7) the arrest in B cell development is earlier (6). The {kappa}/B220lo cells in {lambda}5-knockout mice are essentially all CD43+/large pro-B/pre-B cells; apparently, in the absence of the surrogate light chains stage D of pre-B cell development cannot be reached. The {gamma}2b heavy chain can interact with the surrogate light chains as has been shown immunochemically (2). These considerations and the finding of CD43 small pre-B cells imply that both {gamma}2b and {gamma}/µ heavy chains require interaction with {lambda}5 to drive B cell development to stage D. However, development beyond that stage cannot be promoted by {gamma}2b (see below).

The {gamma}/µ transgenic mice also show the same effect as the {gamma}-only mice when an anti-apoptotic gene is overexpressed (Table 4Go). With Bcl-xL overexpression in the {gamma}/µ transgenics, considerable numbers of µ, but {kappa}+, B cells can be detected. The {kappa} genes rearrange at stage D (18) and apparently, in {gamma}-only or {gamma}/µ transgenics without Bcl-xL overexpression, the µ cells apoptose either before light chain gene rearrangement can occur, or perhaps during that process. It is interesting that Bcl-xL allows µ cells and some additional µ+ cells to survive transiently, but then apparently to die: the numbers of B cells are greatly reduced in {gamma} or {gamma}/µ transgenicxBcl-xL transgenic bone marrow and spleen compared with Bcl-xL transgenic or normal mice.

The findings with {gamma}2b-based transgenes are in sharp contrast to the findings with µ transgenic mice (13,19). In such mice, the µ transgene can replace the function of the endogenous µ gene; many B cells have unrearranged endogenous heavy chain genes and express only the transgene-encoded µ heavy chain.

Both the {gamma}2b and {gamma}2b/µ transgenes inhibit endogenous heavy chain gene rearrangement. Interestingly, the stronger the expression of the transgene, the stronger the feedback inhibition. In the BS1-2 line the transgene is barely expressed, resulting in a near normal B cell phenotype (Table 3Go). At the other extreme, in the BS1-3 and BS2-2 transgenic lines, the transgenes are most highly expressed and the B cell numbers are most severely curtailed (Table 3Go). Presumably, a certain threshold level of transgenic (or, by inference, endogenous) heavy chain is required to induce a signal that stops further heavy chain gene rearrangement. The staining of the transgenic B cells with anti-{gamma}2b is rather weak, an observation that has been made with all gamma transgenics (11, 20, and J. Kenny, pers. commun.). It is possible that the available antibodies are mainly directed to sites that are hidden in cell-bound {gamma} molecules, but it is perhaps more likely that the weak staining is due to low levels of {gamma}2b on the cell membrane. Thus, perhaps only those pre-B cells with low surface expression of {gamma}2b can allow rearrangement and expression of µ, and these cells remain low in membrane expression of {gamma}2b.

Since {gamma}2b is capable of delivering the `stop-heavy-chain-gene-rearrangement' signal, but not the maturation signal, either different regions of the heavy chains are involved in the different signals, or, a given region of µ can perform both functions, whereas the analogous region of {gamma}2b can perform only the feedback function. Structural differences between {gamma}2b proteins and µ proteins must be responsible for their functional differences. An obvious structural difference between µ and {gamma}2b is the cytoplasmic tail, which consists of only three amino acids in µ, but 28 amino acids in {gamma}2b (21). However, {gamma}2b-µmem (2) and {gamma}/µCH1-µmem transgenic mice (this paper) exhibit a phenotype identical to that of {gamma}2b transgenic mice. This argues that the µ transmembrane and cytoplasmic tail regions, even in combination with the CH1 domain of µ, are not sufficient to confer the µ maturation signal.

The CH1 domain of the µ heavy chain associates covalently with the surrogate light chain, presumably via the {lambda}5 chain (8,9). In {lambda}5 knockout mice, B cell development is greatly inhibited (7); however, a few B cells do develop apparently from those pre-B cells that rearrange conventional light chain genes before the critical cut-off time. Also, when {lambda}5 knockout mice are provided with a conventional light chain transgene, B cell development is normal (22,23). Normally, only the µ heavy chain is expressed in pre-B cells. Its CH1 domain differs in 81 of 105 amino acids from that of {gamma}2b (21), although many of the substitutions are conservative. The finding that the presence of the µCH1 domain in the {gamma}2b/µ hybrid transgene does not allow any development beyond that provided by {gamma}2b alone suggests that the maturation function of µ responsible for the pre-B to B cell transition may not proceed via interaction with the surrogate light chains.

The CH1 domain of µ has been shown to be essential for B cell development in µ transgenic mice (10). Transgenic mice with a µ transgene that lacks the CH1 domain aborted B cell development at about stage C (10). This was attributed to the need for the CH1 region to interact with Ig{alpha}/ß in B cell development, because the µ{Delta}CH1 protein was shown not to associate with Ig{alpha}/ß (10). The question can be raised whether the {gamma}2b or {gamma}2b/µ heavy chains associate with Ig{alpha} during B cell development in these transgenic mice. However, all Ig classes clearly associate with Ig{alpha}/ß and transport of Ig to the cell membrane requires {alpha}/ß (24). Furthermore, early B cell development does not occur in the absence of Igß (25). It is therefore likely that Ig{alpha}/ß functions normally in cooperation with the {gamma} transgenes.

There appear to be several domains that are required for proper Ig{alpha}/ß function in association with the B cell receptor. Besides CH1, there is clearly a direct interaction with the transmembrane domain (24). Deletion of the adjacent CH3 and CH4 domains of µ also prevents binding of Ig{alpha}/ß (24). Since the µ transmembrane domain, even in combination with the µCH1 domain, is not sufficient for the µ-specific function in B cell maturation, perhaps all µ domains that have been shown necessary for interaction with Ig{alpha}/ß are required for maturation as well.

Alternatively, or in addition, the interaction with some other surface molecule or ligand in a way that would be specific to some or all domains of µ is needed for B cell development. One possible candidate for such a cell membrane protein is CD19 which has been shown to interact with µ in the signal transduction of pre-B cell receptors (26). It will be interesting to determine if the interactions of {gamma}2b or {gamma}2b/µCH1 with CD19 and other cell membrane molecules are different from those of µ.


    Acknowledgments
 
The assistance of Larry Johnson and Michael Moser are gratefully acknowledged. We thank L. Degenstein at the University of Chicago Cancer Research Center Transgenic Facility for producing the Cd-1 mouse line. We are grateful to C. Thompson for the gift of Bcl-xL transgenic mice, and to N. Michael and A. Longacre for critical reading of the manuscript. This work was supported by NIH grant HD23089. The transgenic and FACS facilities are partially supported by an NIH grant to the University of Chicago Cancer Research Center. The DNA microinjections and oligonucleotide primer synthesis done at Alabama were supported in part by NCI grant CA13148 to the UAB Comprehensive Cancer Center.


    Abbreviations
 
PEphycoerythrin

    Notes
 
3 Present address: Department of Comparative Medicine, University of Alabama at Birmingham, Birmingham, AL 35294-0019, USA Back

Transmitting editor: K. Knight

Received 1 April 1999, accepted 24 June 1999.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Storb, U. 1995. Ig gene expression and regulation in Ig transgenic mice. In Honjo T. and Alt, F., eds, Immunoglobulin Genes, p. 345. Academic Press, New York.
  2. Roth, P., Doglio, L., Manz, J., Kim, J. Y., Lo, D. and Storb, U. 1993. Immunoglobulin {gamma}2b transgenes inhibit heavy chain gene rearrangement, but cannot promote B cell development. J. Exp. Med. 178:2007.[Abstract/Free Full Text]
  3. Battegay, M., Fiedler, P., Kalinka, U., Brombacher, F., Zinkernagel, R., Peter, H., Kohler, G. and Eibel, H. 1996. Non-tolerant B cells cause autoimmunity in anti-CD8 IgG2a transgenic mice. Eur. J. Immunol. 26:250.[Web of Science][Medline]
  4. Tsao, B. P., Ohnishi, K., Cheroutre, H., Mitchell, B., Teitell, M., Mixter, P., Kronenberg, M. and Hahn, B. H. 1992. Failed self-tolerance and autoimmunity in IgG anti-DNA transgenic mice. J. Immunol. 149:350.[Abstract]
  5. Kitamura, D., Roes, J., Kuhn, R. and Rajewski, K. 1991. A B cell-deficient mouse by targeted disruption of the membrane exon of the immunoglobulin µ chain gene. Nature 350:423.[Medline]
  6. Kurtz, B. S., Witte, P. and Storb, U. 1996. {gamma}2b provides only some of the sigfnals normally given via µ in B cell development. Int. Immunol. 9:415.[Abstract/Free Full Text]
  7. Kitamura, D., Kudo, A., Schaal, S., Mueller, W., Melchers, F. and Rajewsky, K. 1992. A critical role of {lambda}5 protein in B cell development. Cell 69:823.[Web of Science][Medline]
  8. Tsubata, T., Tsubata, R. and Reth, M. 1992. Cross linking of the cell surface immunoglobulin (µ-surrogate light chains complex) on pre-B cells induces activation of V gene rearrangements at the immunoglobulin {kappa} locus. Int. Immunol. 4:637.[Abstract/Free Full Text]
  9. Melchers, F., Karasuyama, H., Haasner, D., Bauer, S., Kudo, A., Sakaguchi, N., Jameson, B. and Rolink, A. 1993. The surrogate light chain in B-cell development. Immunol. Today. 14:60.[Web of Science][Medline]
  10. Iglesias, A., Nichogiannopoulou, A., Williams, G. S., Flaswinkel, H. and Koehler, G. 1993. Early B cell development requires mu signaling. Eur. J. Immunol. 23:2622.[Web of Science][Medline]
  11. Roth, P., Kurtz, B., Lo, D. and Storb, U. 1995. {lambda}5, but not µ is required for B cell maturation in a unique {gamma}2b transgenic mouse line. J. Exp. Med. 181:1059.[Abstract/Free Full Text]
  12. Tsang, H., Pinkert, C., Hagman, J., Lostrum, M., Brinster, R. L. and Storb, U. 1988. Cloning of a {gamma}2b gene encoding anti-Pseudomonas aeruginosa H chains and its introduction into the germ line of mice. J. Immunol. 141:308.[Abstract]
  13. Manz, J., Denis, K., Witte, O., Brinster, R. and Storb, U. 1988. Feedback inhibition of immunoglobulin gene rearrangement by membrane µ but not by secreted µ heavy chains. J. Exp. Med. 168:1363.[Abstract/Free Full Text]
  14. Brinster, R., Chen, H., Trumbauer, M., Yagle, M. and Palmiter, R. 1985. Factors affecting the efficiency of introducing foreign DNA into mice by microinjecting eggs. Proc. Natl Acad. Sci. USA 82:4438.[Abstract/Free Full Text]
  15. Polites, H. G. and Pinkert, C. A. 1994. DNA microinjection and transgenic animal production. In C. A. Pinkert, ed., Transgenic Animal Technology: A Laboratory Handbook, p. 15. Academic Press, San Diego, CA.
  16. Grillot, D., Merino, R., Pena, J., Fanslow, W., Finkelman, F., Thompson, C. and Nunez, G. 1996. Bcl-x exhibits regulated expression during B cell development and activation and modulates lymphocyte survival in transgenic mice. J. Exp. Med. 183:381.[Abstract/Free Full Text]
  17. Hagman, J., Lo, D., Doglio, L. T., Hackett, J., Jr, Rudin, C. M., Haasch, D., Brinster, R. and Storb, U. 1989. Inhibition of immunoglobulin gene rearrangement by the expression of a {lambda}2 transgene. J. Exp. Med. 169:1911.[Abstract/Free Full Text]
  18. Hardy, R. R., Carmack, C. E., Shinton, S. A., Kemp, J. D. and Hayakawa, K. 1991. Resolution and characterization of pro-B and pre-pro-B cell stages in normal mouse bone marrow. J. Exp. Med. 173:1213.[Abstract/Free Full Text]
  19. Nussenzweig, M. C., Shaw, A. C., Sinn, E., Danner, D. B., Holmes, K. L., Morse, H. C., III and Leder, P. 1987. Allelic exclusion in transgenic mice that express the membrane form of immunoglobulin µ. Science 236:816.[Abstract/Free Full Text]
  20. Roth, P. 1993. Characterization of {gamma}2b transgenic mice: effects on B cell development and allelic exclusion. Doctoral thesis, University of Chicago.
  21. Kabat, E., Wu, T., Perry, H. Gottesman, K. and Foeller, C. 1991. Sequences of Proteins of Immunological Interest. NIH, Bethesda, MD.
  22. Papavasiliou, F., Jankovic, M. and Nussenzweig, M. 1996. Surrogate or conventional light chains are required for membrane immunoglobulin mu to activate the precursor B cell transition. J. Exp. Med. 184:2025.[Abstract/Free Full Text]
  23. Pelanda, R., Schaal, S., Torres, R. and Rajewsky, K. 1996. A prematurely expressed Ig{kappa} transgene, but not a V{kappa}J{kappa} gene segment targeted into the Ig{kappa} locus, can rescue B cell development in lambda5-deficient mice. Immunity 5:229.[Web of Science][Medline]
  24. Reth, M. 1992. Antigen receptors on B lymphocytes. Annu. Rev. Immunol. 10:97.[Web of Science][Medline]
  25. Gong, S. and Nussenzweig, M. 1996. Regulation of an early developmental checkpoint in the B cell pathway by Ig-beta. Science 272:411.[Abstract]
  26. Krop, I., Shaffer, A., Fearon, D. and Schlissel, M. 1996. The signaling activity of murine CD19 is regulated during B cell development. J. Immunol. 157:48.[Abstract]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Shen, X.
Right arrow Articles by Storb, U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shen, X.
Right arrow Articles by Storb, U.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?