International Immunology, Vol. 11, No. 10, 1663-1671,
October 1999
© 1999 Japanese Society for Immunology
The CH1 and transmembrane domains of µ in the context of a
2b transgene do not suffice to promote B cell maturation
1 Department of Molecular Genetics and Cell Biology, University of Chicago, Chicago, IL 60637, USA
2 Department of Comparative Medicine, University of Alabama at Birmingham, Birmingham, AL 35294-0019, USA
Correspondence to: U. Storb
| Abstract |
|---|
|
|
|---|
Mice carrying a
2b transgene have been shown previously to be deficient in B cell development. In particular, a developmental block exists at the pre-B cell stage. The few B cells that develop all express endogenous µ heavy chains. The phenotype suggests that
2b exerts a strong feedback inhibition on endogenous Ig gene rearrangement, but, unlike µ, cannot support further B cell development. In this study we have created hybrid transgenes between
2b and µ. Transgenic mice with a CH1 domain of µ, or both a CH1 and transmembrane/cytoplasmic domain of µ replacing the respective domains of a
2b transgene, have the same B cell defect as
2b transgenic mice. Interestingly, the severity of the defect is correlated with the level of expression of the transgene, suggesting that the degree of feedback inhibition of Ig gene rearrangement depends on the level and timing of Ig production. Crossing the
2b/µ transgenes into a Bcl-xL transgenic line allows immature
2b B cells to survive, but not to develop to maturity. Therefore, the missing function of µ is not simply an anti-apoptotic effect.
Keywords: B lymphocytes, bone marrow, gene rearrangement, mRNA, transgenic mice
| Introduction |
|---|
|
|
|---|
The development of B lymphocytes is closely related to the expression of Ig genes. Studies of transgenic and knockout mice have shown that the membrane form of µ and probably
have to fulfill a number of functions in early B cell development, including maturation, feedback inhibition of heavy chain gene rearrangement, up-regulation of light chain gene rearrangement and, finally, feedback inhibition of the V(D)J recombinase (reviewed in 1). Transgenic
2b (2) and
2a (3,4) mice are effective in allelic exclusion and feedback inhibition of endogenous heavy chain gene rearrangement, but produce very few, if any,
2b-only or
2a-only expressing B cells. A mouse line with a hybrid transgene of
2b with membrane and cytoplasmic domains of µ (
2b/µmem) (2) has the same phenotype as
2b transgenic mice. So, although µmem knockout mice have shown that µmem is absolutely needed for normal B cell development (5), the µmem domain cannot rescue the B cell deficiency caused by the expression of a
2b transgene.
In
2b transgenic mice B cell development arrests at the transition of large Ig, B220+ pre-B cells into small Ig, B220+ pre-B cells (2,6). This is just after the stage at which B cell development is blocked in
5 knockout mice (7). The
5 chain appears to associate with the CH1 domain of µ (8,9). Deletion of CH1 inhibits B cell development (10). It was therefore possible that the CH1 domain of µ provides an interaction that triggers B cell maturation. While
2b can associate with
5 (11), its CH1 domain is different from that of µ in 80% of the amino acids. Thus, the CH1 domain of
2b may be unable to participate in a proper maturation signal.
To test for this possibility, we have produced transgenic mice with µ/
2b hybrid transgenes. In one type of transgenes the CH1 domain of
2b has been replaced by that of µ (
/µCH1). This transgene retains all other domains and the VH region of the original
2b transgene. In a second set of µ/
transgenic mice, in addition to CH1, the transmembrane and intracytoplasmic domains of
2b were replaced by those of µ (
/µCHM) on the assumption that an intramolecular co-operation between the homologous domains may be required.
It is important to determine which domain(s) of µ have the nurturing effect that is required for complete B cell maturation, as this may aid in the identification of potential extracellular ligands and cellular pathways that are involved in B cell development.
| Methods |
|---|
|
|
|---|
Transgenes and transgenic mice
The
/µCH1 and
/µCHM gene constructs were derived from a
2b transgene (12). The
/µCH1 transgene was constructed from the
2b transgene by replacing the
2b CH1 region contained on a 0.5 kb MunIBstE II fragment with the 0.5 kb µCH1 region from pVH167µ (13) (Fig. 1
/µCHM transgene was constructed from the
/µCH1 transgene by replacing the
2b transmembrane and cytoplasmic domains contained in a 3 kb (KpnIPvuI) fragment with µ membrane exons contained in a 2.6 kb KpnIPvuI fragment from pVH167µ (13). Transgenic mice were generated by DNA microinjection using linearized ~12 kb SalIClaI fragments (
/µCH1 or
/µCHM) into the pronucleus of (C57/BL6xSJL) F2 zygotes as described (14,15). One
/µCH1 trangenic line, Cd-1, was produced by microinjection into fertilized eggs from CD-1 outbred mice. All founders were backcrossed with C57/BL6 mice. Founders were tested for the presence of the transgenes in tail DNA by Southern blot using VDJ and
2bCH3 regions (Fig. 1
2b (GCTGAGCTGATGAGGCCTGGG) and 3'JH2
2b (CTGAGGAGACTGTGAGAGTG) (94°C, 30 s; 65°C, 60 s; 72°C, 60 s, 30 cycles). The Bcl-xL transgenic mice are described in Grillot et al. (16) and were kindly provided by Dr Craig Thompson.
|
Flow cytometry analysis
Flow cytometry (FACS; Becton Dickinson, Mountain View, CA) was performed essentially as described (17) using the following antibodies: phycoerythrin (PE)-conjugated goat anti-mouse
(Southern Biotechnology Associates, Birmingham, AL) at 0.05 µg/106 cells; FITC-conjugated rat anti-mouse CD45R/B220 (clone RA3-6B2) (PharMingen, San Diego, CA) at 2 µg/106 cells; PE-conjugated goat anti-mouse IgM (Southern Biotechnology Associates) at 0.4 µg/106 cells; FITC-conjugated anti-mouse IgMb (clone R6-60.2) (PharMingen) at 1 µg/106 cells; FITC-conjugated goat anti-mouse
2b (Southern Biotechnology Associates) at 1.5 µg/ 106 cells; R-PErat anti-mouse CD43 (Clone S7; PharMingen) at 0.8 µg/106 cells; and FITCanti-mouse CD19 (Clone 1D3; PharMingen) at 1 µg/106 cells. Samples were analyzed by FACScan (Becton Dickinson). A total of 104 splenic and 2.5x104 bone marrow lymphocytes, as determined by forward and side scatter, were analyzed per sample. FACS diagrams were generated with the CellQuest (Scripps Research Institute) software programs.
To separate pre-B cells at early stages (A, B and C) (18) from B cells at later stages (late pre-B, immature and mature B cells), bone marrow cells were double stained with anti-CD19 (pan-B cell antibody) and anti-S7 (early B cell marker). Populations of CD19+S7+ (early pre-B cells) and CD19+S7 (late pre-B, immature and mature B cells) were sorted by FACS.
RNA preparation and RT-PCR
Single-cell suspensions were made from spleen and bone marrow of transgenic mice and their non-transgenic littermates. Red blood cells were removed using DMEM/H2O (1:9). Total RNAs were extracted using RNA STAT-60 (Tel-Test, Friendswood, TX). First-strand cDNAs were generated from 3 µg of total RNA using oligo(dT)1218 and SuperScript II RNase H reverse transcriptase (Gibco/BRL, Grand Island, NY). The first-strand cDNAs were diluted 1:2 to 1:5. Then 1 µl of each sample was analyzed by PCR using two sets of oligonucleotides designated
/µ for the transgene and En-µ for the endogeous µ gene. For
/µ the 5' oligonucleotide is TGGTATGCAAAATCCACTACGGAGG; the 3' oligonucleotide is GCTGTGTGTACTTCCACGTTGTTC resulting in a 291 bp fragment. For En-µ the 5' oligonucleotide is the same as for the transgene; the 3' oligonucleotide is CGGTTTTGGAGTGAAGTTCGTGC resulting in a 389 bp fragment. Conditions for PCR were: denaturation at 94°C for 30 s, annealing at 57°C for 1 min and elongation at 72°C for 1 min. The PCR reactions were run for 20 cycles to ensure that amplification was within the linear range.
For sorted CD19+CD43+ (S7+) and CD19+CD43 (S7) cells, the cells were pelleted, and resuspended in RAN STAT-60 (Tel-Test). The other steps were as above, except that the first-strand cDNAs from sorted cells were not diluted and PCR reactions were run for 25 cycles because of the low cell concentrations.
| Results |
|---|
|
|
|---|
Transgenic mice
Four
/µCH1 transgenic lines [BS1-1, BS1-2, BS1-3 (BS1-2 and BS1-3 segregated from the same founder) and Cd-1] and two
/µCHM transgenic lines (BS2-1 and BS2-2, segregated from the same founder) were generated using the constructs shown in Fig. 1
|
|
B cell development is blocked in both
/µCH1 and
/µCHM transgenic miceTo determine whether B cell development is affected by transgene expression, bone marrow and splenic B cells from age-matched normal and transgenic mice were analyzed by FACS (Figs 4 and 5
+ or µ+ (mIg+) cells compared to control mice (Table 1
+ cells matches that of µ+ cells (Fig. 6
/µ transgene encoded Ig without also expressing µ. The same phenomenon was observed in
2b-only transgenic mice (2) which means that for survival and development the B cells need signals from µ. All B cells in the spleen express
2b at low levels (Fig. 6
2b-only cells exist. Expression of
2b protein has been further confirmed by serum IgG analysis (not shown). Surprisingly, the defect is very severe in the BS2-1 and BS2-2 lines which carry the µmem domain-containing transgene (
/µ CHM; Table 1
|
|
|
|
The stage at which B cell development is inhibited in the bone marrow was assessed by further analyzing the cells that were B220lo and
. These cells comprise the early B cells stages AD (18). Clearly, in the mice with strong suppression of B cell development (BS1-3, Cd-1, BS2-2) the most immature cells which are large and/or CD43+ (S7+) (stages AC) are considerably increased compared with the proportion of these cells in age-matched non-transgenic mice (Table 2
2b-only transgenic mice. The skewing toward immature B cells does not exist in the BS1-2 line which also shows no depression of mature B cells, despite expression of the transgene (see below).
|
Since the
/µ transgenes encode µCH1 (a allotype), there was a concern whether the anti-µ antibody may react with this µCH1 portion. Two-color FACS with anti-IgM antibody and anti-IgMb antibody (specific for the endogenous µ allotype) (Fig. 6
The level of transgene expression determines the severity of endogenous µ suppression
The six lines of transgenic mice showed different levels of impairment of B cell development. While BS1-3 of
/µCH1 and BS2-2 of
/µCHM have the most severe B cell depression, BS1-2 of
/µCH1 has a near normal phenotype (Table 1
).
RT-PCR from both bone marrow and splenic cells demonstrated that the transgene is expressed in all mice (Fig. 3
). In order to determine how the effect on B cell development was related to the levels of expression of the transgene, the relative levels of transgenic versus endogenous µ were analyzed (Fig. 3
; Table 3
). There is a rather close correlation between the ratio of transgenic to endogenous heavy chain mRNA levels in the bone marrow and spleen and the degree of B cell impairment as measured by the percentage of B cells that are B220hi (the more mature cells in the bone marrow and peripheral B cells) (Table 3
). Highest expression of the transgene corresponds to the lowest B cell numbers and vice versa.
|
In order to determine when in B cell development the differential expression of the transgene versus endogenous µ were established, we sorted pro-B/early pre-B cells (CD43+) late pre-B/B cells (CD43) in the bone marrow (Fig. 7
|
Bcl-xL only partially rescues B cell development in
/µ transgenic miceClearly, the
2b transgenic heavy chain with partial substitutions of µ elements does not permit B cell development. Because it was possible that the missing function of µ was only one that overcomes apoptosis, we crossed two
2b/µ transgenic lines with a line expressing a Bcl-xL transgene in the B cell lineage (Table 4
/µ transgenics were crossed with Bcl-xL, an increase in the numbers of B cells and their precursors was seen in bone marrow and spleen compared with the
/µ transgene without the Bcl-xL transgene (Table 4
/µ transgenic/Bcl-xL mice still had very low B cell levels in the spleen. In the bone marrow of the
/µxBcl-xL transgenic mice the B220hi B cells (mature) were also greatly reduced, compared with the Bcl-xL-only mice. However, the B220lo B cells were increased in the Bcl-xL transgenics in the presence of the
/µ transgenes. This is likely to reflect the survival of immature B cells. The strongest increase in B220lo cells was seen in
+ cells in bone marrow and spleen, and that increase was not matched by an increase in µ+ cells. This suggests that some cells that do not express µ, due to the strong feedback by the
2b transgene, were now rescued to survive.
|
Since only immature cells were rescued by the Bcl-xL transgene, the missing function of µ is not solely an antiapoptotic effect, but rather a specific maturation function.
| Discussion |
|---|
|
|
|---|
This study shows that in
/µ transgenic mice all
+ B cells co-express endogenous µ, thus there are no mature B cells that express only the
/µ transgenic heavy chain. This result mimics the findings with conventional
2b transgenic mice (2,6), suggesting that the replacement of the
2b CH1 and membrane/cytoplasmic domains by those of µ cannot confer the maturation function of µ. The arrest in B cell development with the
/µ transgenes appears to occur at the same stage as with
2b-only transgenes (6), at the transition from stage C to stage D (18). In the bone marrow of the
/µ transgenics with strong transgene expression (an exception is BS1-2), the B220+ cells are mainly CD43+ (stages AC), but 1921% of
/B220+ cells are CD43, showing that stage D is at least initiated (Table 2
+/B220lo cells is obtained (Table 4
2b alone can promote the development to stage D at which
gene rearrangement initiates. In contrast to the
2b/µ and
2b-only transgenic mice, in
5 knockout mice (7) the arrest in B cell development is earlier (6). The
/B220lo cells in
5-knockout mice are essentially all CD43+/large pro-B/pre-B cells; apparently, in the absence of the surrogate light chains stage D of pre-B cell development cannot be reached. The
2b heavy chain can interact with the surrogate light chains as has been shown immunochemically (2). These considerations and the finding of CD43 small pre-B cells imply that both
2b and
/µ heavy chains require interaction with
5 to drive B cell development to stage D. However, development beyond that stage cannot be promoted by
2b (see below).
The
/µ transgenic mice also show the same effect as the
-only mice when an anti-apoptotic gene is overexpressed (Table 4
). With Bcl-xL overexpression in the
/µ transgenics, considerable numbers of µ, but
+, B cells can be detected. The
genes rearrange at stage D (18) and apparently, in
-only or
/µ transgenics without Bcl-xL overexpression, the µ cells apoptose either before light chain gene rearrangement can occur, or perhaps during that process. It is interesting that Bcl-xL allows µ cells and some additional µ+ cells to survive transiently, but then apparently to die: the numbers of B cells are greatly reduced in
or
/µ transgenicxBcl-xL transgenic bone marrow and spleen compared with Bcl-xL transgenic or normal mice.
The findings with
2b-based transgenes are in sharp contrast to the findings with µ transgenic mice (13,19). In such mice, the µ transgene can replace the function of the endogenous µ gene; many B cells have unrearranged endogenous heavy chain genes and express only the transgene-encoded µ heavy chain.
Both the
2b and
2b/µ transgenes inhibit endogenous heavy chain gene rearrangement. Interestingly, the stronger the expression of the transgene, the stronger the feedback inhibition. In the BS1-2 line the transgene is barely expressed, resulting in a near normal B cell phenotype (Table 3
). At the other extreme, in the BS1-3 and BS2-2 transgenic lines, the transgenes are most highly expressed and the B cell numbers are most severely curtailed (Table 3
). Presumably, a certain threshold level of transgenic (or, by inference, endogenous) heavy chain is required to induce a signal that stops further heavy chain gene rearrangement. The staining of the transgenic B cells with anti-
2b is rather weak, an observation that has been made with all gamma transgenics (11, 20, and J. Kenny, pers. commun.). It is possible that the available antibodies are mainly directed to sites that are hidden in cell-bound
molecules, but it is perhaps more likely that the weak staining is due to low levels of
2b on the cell membrane. Thus, perhaps only those pre-B cells with low surface expression of
2b can allow rearrangement and expression of µ, and these cells remain low in membrane expression of
2b.
Since
2b is capable of delivering the `stop-heavy-chain-gene-rearrangement' signal, but not the maturation signal, either different regions of the heavy chains are involved in the different signals, or, a given region of µ can perform both functions, whereas the analogous region of
2b can perform only the feedback function. Structural differences between
2b proteins and µ proteins must be responsible for their functional differences. An obvious structural difference between µ and
2b is the cytoplasmic tail, which consists of only three amino acids in µ, but 28 amino acids in
2b (21). However,
2b-µmem (2) and
/µCH1-µmem transgenic mice (this paper) exhibit a phenotype identical to that of
2b transgenic mice. This argues that the µ transmembrane and cytoplasmic tail regions, even in combination with the CH1 domain of µ, are not sufficient to confer the µ maturation signal.
The CH1 domain of the µ heavy chain associates covalently with the surrogate light chain, presumably via the
5 chain (8,9). In
5 knockout mice, B cell development is greatly inhibited (7); however, a few B cells do develop apparently from those pre-B cells that rearrange conventional light chain genes before the critical cut-off time. Also, when
5 knockout mice are provided with a conventional light chain transgene, B cell development is normal (22,23). Normally, only the µ heavy chain is expressed in pre-B cells. Its CH1 domain differs in 81 of 105 amino acids from that of
2b (21), although many of the substitutions are conservative. The finding that the presence of the µCH1 domain in the
2b/µ hybrid transgene does not allow any development beyond that provided by
2b alone suggests that the maturation function of µ responsible for the pre-B to B cell transition may not proceed via interaction with the surrogate light chains.
The CH1 domain of µ has been shown to be essential for B cell development in µ transgenic mice (10). Transgenic mice with a µ transgene that lacks the CH1 domain aborted B cell development at about stage C (10). This was attributed to the need for the CH1 region to interact with Ig
/ß in B cell development, because the µ
CH1 protein was shown not to associate with Ig
/ß (10). The question can be raised whether the
2b or
2b/µ heavy chains associate with Ig
/ß during B cell development in these transgenic mice. However, all Ig classes clearly associate with Ig
/ß and transport of Ig to the cell membrane requires
/ß (24). Furthermore, early B cell development does not occur in the absence of Igß (25). It is therefore likely that Ig
/ß functions normally in cooperation with the
transgenes.
There appear to be several domains that are required for proper Ig
/ß function in association with the B cell receptor. Besides CH1, there is clearly a direct interaction with the transmembrane domain (24). Deletion of the adjacent CH3 and CH4 domains of µ also prevents binding of Ig
/ß (24). Since the µ transmembrane domain, even in combination with the µCH1 domain, is not sufficient for the µ-specific function in B cell maturation, perhaps all µ domains that have been shown necessary for interaction with Ig
/ß are required for maturation as well.
Alternatively, or in addition, the interaction with some other surface molecule or ligand in a way that would be specific to some or all domains of µ is needed for B cell development. One possible candidate for such a cell membrane protein is CD19 which has been shown to interact with µ in the signal transduction of pre-B cell receptors (26). It will be interesting to determine if the interactions of
2b or
2b/µCH1 with CD19 and other cell membrane molecules are different from those of µ.
| Acknowledgments |
|---|
The assistance of Larry Johnson and Michael Moser are gratefully acknowledged. We thank L. Degenstein at the University of Chicago Cancer Research Center Transgenic Facility for producing the Cd-1 mouse line. We are grateful to C. Thompson for the gift of Bcl-xL transgenic mice, and to N. Michael and A. Longacre for critical reading of the manuscript. This work was supported by NIH grant HD23089. The transgenic and FACS facilities are partially supported by an NIH grant to the University of Chicago Cancer Research Center. The DNA microinjections and oligonucleotide primer synthesis done at Alabama were supported in part by NCI grant CA13148 to the UAB Comprehensive Cancer Center.
| Abbreviations |
|---|
| PE | phycoerythrin |
| Notes |
|---|
3 Present address: Department of Comparative Medicine, University of Alabama at Birmingham, Birmingham, AL 35294-0019, USA
Transmitting editor: K. Knight
Received 1 April 1999, accepted 24 June 1999.
| References |
|---|
|
|
|---|
- Storb, U. 1995. Ig gene expression and regulation in Ig transgenic mice. In Honjo T. and Alt, F., eds, Immunoglobulin Genes, p. 345. Academic Press, New York.
-
Roth, P., Doglio, L., Manz, J., Kim, J. Y., Lo, D. and Storb, U. 1993. Immunoglobulin
2b transgenes inhibit heavy chain gene rearrangement, but cannot promote B cell development. J. Exp. Med. 178:2007.[Abstract/Free Full Text] - Battegay, M., Fiedler, P., Kalinka, U., Brombacher, F., Zinkernagel, R., Peter, H., Kohler, G. and Eibel, H. 1996. Non-tolerant B cells cause autoimmunity in anti-CD8 IgG2a transgenic mice. Eur. J. Immunol. 26:250.[Web of Science][Medline]
- Tsao, B. P., Ohnishi, K., Cheroutre, H., Mitchell, B., Teitell, M., Mixter, P., Kronenberg, M. and Hahn, B. H. 1992. Failed self-tolerance and autoimmunity in IgG anti-DNA transgenic mice. J. Immunol. 149:350.[Abstract]
- Kitamura, D., Roes, J., Kuhn, R. and Rajewski, K. 1991. A B cell-deficient mouse by targeted disruption of the membrane exon of the immunoglobulin µ chain gene. Nature 350:423.[Medline]
-
Kurtz, B. S., Witte, P. and Storb, U. 1996.
2b provides only some of the sigfnals normally given via µ in B cell development. Int. Immunol. 9:415.[Abstract/Free Full Text] -
Kitamura, D., Kudo, A., Schaal, S., Mueller, W., Melchers, F. and Rajewsky, K. 1992. A critical role of
5 protein in B cell development. Cell 69:823.[Web of Science][Medline]
-
Tsubata, T., Tsubata, R. and Reth, M. 1992. Cross linking of the cell surface immunoglobulin (µ-surrogate light chains complex) on pre-B cells induces activation of V gene rearrangements at the immunoglobulin
locus. Int. Immunol. 4:637.[Abstract/Free Full Text] - Melchers, F., Karasuyama, H., Haasner, D., Bauer, S., Kudo, A., Sakaguchi, N., Jameson, B. and Rolink, A. 1993. The surrogate light chain in B-cell development. Immunol. Today. 14:60.[Web of Science][Medline]
- Iglesias, A., Nichogiannopoulou, A., Williams, G. S., Flaswinkel, H. and Koehler, G. 1993. Early B cell development requires mu signaling. Eur. J. Immunol. 23:2622.[Web of Science][Medline]
-
Roth, P., Kurtz, B., Lo, D. and Storb, U. 1995.
5, but not µ is required for B cell maturation in a unique
2b transgenic mouse line. J. Exp. Med. 181:1059.[Abstract/Free Full Text] -
Tsang, H., Pinkert, C., Hagman, J., Lostrum, M., Brinster, R. L. and Storb, U. 1988. Cloning of a
2b gene encoding anti-Pseudomonas aeruginosa H chains and its introduction into the germ line of mice. J. Immunol. 141:308.[Abstract]
-
Manz, J., Denis, K., Witte, O., Brinster, R. and Storb, U. 1988. Feedback inhibition of immunoglobulin gene rearrangement by membrane µ but not by secreted µ heavy chains. J. Exp. Med. 168:1363.
[Abstract/Free Full Text] -
Brinster, R., Chen, H., Trumbauer, M., Yagle, M. and Palmiter, R. 1985. Factors affecting the efficiency of introducing foreign DNA into mice by microinjecting eggs. Proc. Natl Acad. Sci. USA 82:4438.
[Abstract/Free Full Text] - Polites, H. G. and Pinkert, C. A. 1994. DNA microinjection and transgenic animal production. In C. A. Pinkert, ed., Transgenic Animal Technology: A Laboratory Handbook, p. 15. Academic Press, San Diego, CA.
-
Grillot, D., Merino, R., Pena, J., Fanslow, W., Finkelman, F., Thompson, C. and Nunez, G. 1996. Bcl-x exhibits regulated expression during B cell development and activation and modulates lymphocyte survival in transgenic mice. J. Exp. Med. 183:381.
[Abstract/Free Full Text] -
Hagman, J., Lo, D., Doglio, L. T., Hackett, J., Jr, Rudin, C. M., Haasch, D., Brinster, R. and Storb, U. 1989. Inhibition of immunoglobulin gene rearrangement by the expression of a
2 transgene. J. Exp. Med. 169:1911.[Abstract/Free Full Text] -
Hardy, R. R., Carmack, C. E., Shinton, S. A., Kemp, J. D. and Hayakawa, K. 1991. Resolution and characterization of pro-B and pre-pro-B cell stages in normal mouse bone marrow. J. Exp. Med. 173:1213.
[Abstract/Free Full Text] -
Nussenzweig, M. C., Shaw, A. C., Sinn, E., Danner, D. B., Holmes, K. L., Morse, H. C., III and Leder, P. 1987. Allelic exclusion in transgenic mice that express the membrane form of immunoglobulin µ. Science 236:816.
[Abstract/Free Full Text] -
Roth, P. 1993. Characterization of
2b transgenic mice: effects on B cell development and allelic exclusion. Doctoral thesis, University of Chicago.
- Kabat, E., Wu, T., Perry, H. Gottesman, K. and Foeller, C. 1991. Sequences of Proteins of Immunological Interest. NIH, Bethesda, MD.
-
Papavasiliou, F., Jankovic, M. and Nussenzweig, M. 1996. Surrogate or conventional light chains are required for membrane immunoglobulin mu to activate the precursor B cell transition. J. Exp. Med. 184:2025.
[Abstract/Free Full Text] -
Pelanda, R., Schaal, S., Torres, R. and Rajewsky, K. 1996. A prematurely expressed Ig
transgene, but not a V
J
gene segment targeted into the Ig
locus, can rescue B cell development in lambda5-deficient mice. Immunity 5:229.[Web of Science][Medline]
- Reth, M. 1992. Antigen receptors on B lymphocytes. Annu. Rev. Immunol. 10:97.[Web of Science][Medline]
- Gong, S. and Nussenzweig, M. 1996. Regulation of an early developmental checkpoint in the B cell pathway by Ig-beta. Science 272:411.[Abstract]
- Krop, I., Shaffer, A., Fearon, D. and Schlissel, M. 1996. The signaling activity of murine CD19 is regulated during B cell development. J. Immunol. 157:48.[Abstract]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








